CN105483212A - AgNCs/HpDNA probe based microRNA SDA (strand-displacement amplification) detection method - Google Patents

AgNCs/HpDNA probe based microRNA SDA (strand-displacement amplification) detection method Download PDF

Info

Publication number
CN105483212A
CN105483212A CN201510703249.3A CN201510703249A CN105483212A CN 105483212 A CN105483212 A CN 105483212A CN 201510703249 A CN201510703249 A CN 201510703249A CN 105483212 A CN105483212 A CN 105483212A
Authority
CN
China
Prior art keywords
hpdna
agncs
detection method
mir
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510703249.3A
Other languages
Chinese (zh)
Inventor
崔大祥
张晶璞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Jiaotong University
Original Assignee
Shanghai Jiaotong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Jiaotong University filed Critical Shanghai Jiaotong University
Priority to CN201510703249.3A priority Critical patent/CN105483212A/en
Publication of CN105483212A publication Critical patent/CN105483212A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an AgNCs/HpDNA probe based microRNA SDA (strand-displacement amplification) detection method. The method includes that silver nanoclusters are synthesized by the aid of a hairpin type DNA template and serve as novel molecular bacons, and single detection of gastric plasm miRNA markers is realized by a hybridization resulted G-rich fluorescence enhancement effect in strand displacement isothermal amplification reaction mediated by a G-rich sequence of a dangling end of a primer. The AgNCs/HpDNA probe based microRNA SDA detection method has the advantages of high specificity, short reaction time, low material consumption and simplicity and convenience in operation and creates a new direction for establishing a quick and simple novel miRNA detection method.

Description

Based on the microRNA SDA detection method of AgNCs/HpDNA probe
Technical field
The present invention relates to medical science and molecular diagnosis field, be a kind of microRNASDA detection method based on AgNCs/HpDNA probe, particularly relate to a kind of single MicroRNA detection method replacing isothermal duplication based on hair clip type DNA profiling synthesis ag nano-cluster probe marriage chain.
Background technology
MicroRNA (miRNA) is the endogenous non-coding small RNA molecular that a class length is about 21nt, and it, by accurate between mRNA or non-precision complementary pairing, participates in the expression level of regulation and control mRNA.Multiple miRNA can coordinated regulation mRNA, or a miRNA also can affect multiple target gene simultaneously, thus forms the regulated and control network of a high complexity, affects from molecule to cell again to a series of biological functions organizing level.MiRNA abnormal expression and disease and cancer occur closely related.Significantly, found that multiple miRNA marker can be used for early diagnosis of cancer, prognosis and process monitoring.Wherein, Cui great Xiang seminar of Shanghai Communications University micro-array chip miRNA genome-wide screening obtains miR-16-5p and miR-19b-3p two kinds of blood plasma miRNA marks in conjunction with qRT-PCR technology screening, and point out that the two can be used for instruction cancer of the stomach generation development process (Zhang, J., Song, Y., Zhang, C., etal. (2015) CirculatingmiR-16-5pandmiR-19b-3pastwonovelpotentialbiom arkerstoindicateprogressionofgastriccancer.Theranostics, 5,733-745.).Wherein, qRT-PCR is the gold standard carrying out miRNA detection by quantitative, but needs proceed step by step reverse transcription and thermal cycling amplification and detection due to it, causes this method consuming time and effort.So be still necessary to further develop fast and convenient miRNA new detecting method.
The appearance of isothermal amplification technique makes nucleic acid amplification technologies because having broken away from the constraint of thermal cycling denaturing step and instrument, and receives the concern of numerous investigator.As first-generation isothermal amplification technique, chain replaces amplification Strand-displacementamplification (SDA) and develops rapidly by the inspiration of base excision repair mechanism in DNA reparation, so far, develop and comprised many primers SDA (multiplyprimedSDA), shear-induced SDA (nicking-initiatedSDA), ring mediated isothermal amplification (loop-mediatedisothermalamplification (LAMP)) and Structure Conversion bring out the multiple hypotypes such as SDA (structure-switching-triggeredSDA).Wherein, bringing out SDA due to Structure Conversion does not need particular design shearing site and extra use to shear enzyme, and by means of only target nucleic acid to be measured and hairpin structure probe combination and cause the latter to open and induce SDA to react, be particularly suitable for detecting short-chain nucleic acids molecule and miRNA.At present, being usually used in detection probes that Structure Conversion brings out SDA is the hair clip type DNA molecular beacon (molecularbeacon (MB)) that one end is connected with fluorescence dye and the other end and connects fluorescent quenching, but because it needs to carry out coupling modification to DNA, testing cost is increased, detects application limited.
Along with the rise of DNA profiling synthesis ag nano-cluster (DNA-templatedsilvernanoclusters (AgNCs/DNA)), make to develop the novel nucleic acid fluorescent probe except fluorescence dye or quantum dot are modified.Ag nano-cluster is the aggregate that the diameter be only made up of several or tens silver atoms is less than 1nm, and it is easy to synthesis, and fluorescence controllable.The more important thing is, due to the introducing of DNA profiling in AgNCs/DNA, specific photophysics characteristic can be obtained by means of only change DNA sequence dna, length and conformation.Recently, existing multiple DNA sequence dna synthesis AgNCs is used for nucleic acid or miRNA detection.Yang and Shah with 5 '-CCTCCTTCCTCC-3 ' for AgNCs nucleation region sequence, and connect with miRNA hybridization sequences, by the fluorescent quenching effect of this probe, carry out detecting (Yang to miR-160 and miR-172, S.W.andVosch, T. (2011) RapiddetectionofmicroRNAbyasilvernanoclusterDNAprobe.Ana l.Chem., 83,6935-6939.).Liu utilization index isothermal amplification generates the DNA profiling being used for red fluorescence AgNCs and synthesizing, and by relation between fluorescence intensity and DNA profiling concentration, measures miR-141.These detect or by fluorescent quenching effect, or carry out amplification of signal and signal detection respectively, cause specificity bad, or complex operation (Liu, Y.-Q., Zhang, M., Yin, B.-C.andYe, B.-C. (2012) AttomolarultrasensitivemicroRNAdetectionbyDNA-scaffolded silver-nanoclusterprobebasedonisothermalamplification.An al.Chem., 84,5165-5169.).And report the rich G sequence of hybridization-mediated to the enhancement effect of fluorescence of AgNCs/DNA along with Yeh, foundation is made to become possible (Yeh, H.C., Sharma based on the detection of nucleic acids platform of light-up signal, J., Han, J.J., Martinez, J.S.andWerner, J.H. (2010) ADNA-silvernanoclusterprobethatfluorescesuponhybridizati on.NanoLett., 10,3106-3110.).But, although simple hybridization check is easy, be difficult to also guarantee good specificity.Thus, for improving detection specificity further, simplify the operation step, and the rich G sequence enhancement effect of fluorescence based on AgNCs/DNA is brought out SDA amplification technique with Structure Conversion and is combined by first, and the interaction of both research, to realizing controllable, easy and high specific detection.
Summary of the invention
In order to overcome above-mentioned the deficiencies in the prior art, the object of this invention is to provide a kind of miRNASDA detection method based on AgNCs/HpDNA probe, specifically one reacts based on hair clip type DNA profiling synthesis ag nano-cluster (AgNCs/HpDNA) probe the method detected miRNA in conjunction with SDA, namely in earlier stage screening the miRNA marker miR-19b-3p obtained, design and build AgNCs/HpDNA probe, verify the rich G sequence Fluorescence Increasing performance of this probe, on this basis, single detection is carried out to miRNA marker, and single base mispairing detects.
The object of the invention is to be achieved through the following technical solutions:
First aspect, the invention provides a kind of HpDNA, sequence is as shown in SEQIDNO:1.
Second aspect, the invention provides a kind of AgNCs/HpDNA based on described HpDNA, and described AgNCs/HpDNA is prepared by the following method:
By AgNO 3solution, NaBH 4solution adds in HpDNA, concussion, leaves standstill, obtains AgNCs/HpDNA.
Preferably, described HpDNA, AgNO 3, NaBH 4the ratio of whole volumetric molar concentration be 1:17:17; The time of described concussion is 45s ~ 1min, and concussion is specially concuss; Described leaving standstill is specially ambient temperatare in dark situation and puts 18h.
The third aspect, the invention provides a kind of described AgNCs/HpDNA and detecting the application in cancer of the stomach blood plasma miRNA mark miR-19b-3p, the sequence of described miR-19b-3p is as shown in SEQIDNO:2.
Fourth aspect, the invention provides a kind of cancer of the stomach blood plasma miRNA mark miR-19b-3pSDA detection method based on described AgNCs/HpDNA, described detection method comprises: with described AgNCs/HpDNAs for molecular probe, SDA reaction is carried out under the primer effect overhanging end containing rich G sequence, by rich G sequence hybridization fluorescent reinforcing effect, realize miR-16-5p to detect, this primer sequence is as SEQIDNO:3.
Preferably, the cumulative volume of described SDA reaction is 50 μ L, wherein,
Preferably, described damping fluid 1 × Nb2.1 comprises 50mMNaAc, 10mMTris-HAc, 10mMMg (Ac) 2 and 100 μ g/mLBSA, pH of buffer 7.9 (25 DEG C).
Preferably, the reaction conditions of described SDA reaction is: in 55 DEG C of environment, hatch 55min.The excitation wavelength of fluoroscopic examination is 490nm and 430nm.5th aspect, the invention provides the application of described detection method in single base mispairing nucleotide sequence detects.
The technical solution adopted in the present invention is:
As shown in Figure 1, for the synthesis of the hair clip type probe (GRE19b (5s) C) of AgNCs containing three districts, be respectively neck region HpS, ring district HpL and 3 ' overhangs district HpGO.Wherein, C sequence is rich in for the synthesis of AgNCs in the specially designed district that overhangs, and HpGO (5 '-CCCCCCCCCCCCCCCGCCCGCC-3 ') overhang with the rich G in complementary strand under hybridization sequence near and obtain green fluorescence enhancing signal.The probe detected for miR-19b-3p is GRE19b (5s) C, and its sequence is as shown in SEQIDNO:1.
And miRNA sequence to be measured holds neck HpS partial sequence and ring district HpL complementation respectively with 5 ', corresponding sequence area is respectively MSc and MLc, this is designed with to be beneficial to opens hairpin structure better, and corresponding target miRNA is miR-19b-3p, and its sequence is as shown in SEQIDNO:2.
Primer sequence is also made up of two regions, be respectively the complementary district (PGSc in neck region, 5 '-TATACG-3 ') and rich G sequence overhang district (PO:5 '-GGGTGGGGTGGGGTGGGG-3 '), the primer of corresponding HpDNA is Pri6 (7s), and its sequence is as shown in SEQIDNO:3.
The testing mechanism of miRNA is as follows.First, hair clip type probe generates AgNCs, AgNCs/GRE19b (5s) C probe excites the transmitting or more weak of lower unstressed configuration at 490nm wavelength.When there being target miRNA, it by hybridizing with AgNCs/HpDNA, and opens hairpin structure.Subsequently, primer hybridization is held to hairpin probe neck 3 ', under the acting in conjunction of polysaccharase and dNTP, guide polymerase chain reaction, extend complementary strand HpDNAc (GRE19b (5s) G obtaining HpDNA, its sequence is as shown in SEQIDNO:4), thus make rich G in heteroduplex AgNCs/HpDNA-HpDNAc overhang complementary sequence and AgNCs is close, and obtain the Fluorescence Increasing signal of the probe being positioned at this wavelength place.Meanwhile, the target miRNA sequence be previously combined with HpDNA is substituted and discharges, and enters next circulating reaction.On the contrary, when not having target miRNA, HpDNA is kept closed, and primer cannot be in conjunction with, and then also cannot increase and generate HpDNAc, finally, cannot obtain the Fluorescence Increasing signal at this wavelength place.
Compared with prior art, the invention has the beneficial effects as follows:
The first, based on AgNCs/HpDNA probe and rich G sequence enhancement effect of fluorescence thereof, the high specific that can realize miRNA detects.Compare SYBRGreen and arbitrarily insert double-strandednucleic acid, as long as and MB hairpin probe opens the mechanism that can produce fluorescent signal response, after the complementary sequence that the present invention's probe used is only with rich G to overhang sequence in formation is also hybridized with it, just can generate Fluorescence Increasing signal, hairpin probe is opened and any intermediate heteroduplex all can not produce this signal, thus has high specific.
The second, the rich G sequence reinforcing effect of hybridization-mediated can produce double check signal to a reaction, i.e. Fluorescence Increasing degree and fluorescent quenching degree, judges to provide abundanter information for detecting product.
3rd, hair clip type DNA, both as the template of SDA reaction, again as the generation template of AgNCs, shortens the reaction times and saves reaction material.By by AgNO 3with NaBH 4mix with hair clip type DNA according to a certain percentage, AgNCs/HpDNA probe can be prepared.Although this probe needs standing 18h to make AgNCs fully aging, it can disposable a large amount of preparation standing storage, and time of repose also can foreshorten to 4h.On this basis, the SDA reaction times only a step complete, duration 55min, also can foreshorten to 30min further.
Accompanying drawing explanation
By reading the detailed description done non-limiting example with reference to the following drawings, other features, objects and advantages of the present invention will become more obvious:
Fig. 1 is Cleaning Principle schematic diagram;
Wherein, 1. HpDNA template generates AgNCs; 2. target miRNA hybridize complementary is in the 5 ' neck region of HpDNA and Huan Qu; 3. HpDNA opens; 4. rich G overhangs primer and is incorporated into HpDNA3 ' neck region; 5. form rich G at polysaccharase effect downward-extension and overhang complementary strand HpDNAc; 6. target miRNA discharges, and enters next circulation SDA and reacts;
Fig. 2 is the checking of rich G sequence hybridization fluorescent reinforcing effect; Wherein,
Figure A.AgNCs/GRE19b (5s) C probe and hybrid product fluorescence emission spectrum thereof;
GRE19b (5s) C-Pri6 (7s): AgNCs/GRE19b (5s) C and Pri6 (7s) hybridizes,
GRE19b (5s) C-Pri6 (7s)-h19b:AgNCs/GRE19b (5s) C and Pri6 (7s) and miR-19b-3p hybridization,
GRE19b (5s) C-G:AgNCs/GRE19b (5s) C and GRE19b (5s) G is hybridized;
Figure B. reaction product gel electrophoresis figure;
Swimming lane 1-3 is followed successively by not containing nucleic acids marker GRE19b (5s) C, GRE19b (5s) G and GRE19b (5s) C-G of AgNCs; Swimming lane 4-6 is followed successively by GRE19b (5s) C, GRE19b (5s) C-Pri6 (7s), GRE19b (5s) C-Pri6 (7s)-h19b and GRE19b (5s) C-G);
Fig. 3 is that the single miRNA of gradient concentration detects; Wherein,
A, B:490nm wavelength excites lower miR-19b-3p to detect fluorescence emission spectrum and relation between fluorescence emission peak enhancement value and determined nucleic acid concentration;
C, D:430nm wavelength excites lower miR-19b-3p to detect fluorescence emission spectrum and fluorescence emission peak weakens relation between value and determined nucleic acid concentration;
Fig. 4 is that single base mispairing detects; Wherein,
A, B:490nm wavelength excites down fluorescence emission spectrum based on the determined nucleic acid of GRE19b (5s) C detection probes and fluorescence emission peak enhancement value;
C, D:430nm wavelength excites down and weakens value based on the fluorescence emission spectrum of the determined nucleic acid of GRE19b (5s) C detection probes and fluorescence emission peak; H19b refers to miR-19b-3p, and h16 refers to miR-16-5p, and h19bDM I, II refers to that the plan of the miR-19b-3p of 1 base mispairing is like thing respectively;
Fig. 5 is that miR-19b-3p detects in real time: based on the isothermal duplication curve (A) of the different concns miR-19b-3p of GRE19b (5s) C detection probes, melting curve (B) and melting temperature (Tm) (C);
Fig. 6 is the gel electrophoresis figure based on GRE19b (5s) C probe in detecting miR-19b-3p and mismatch DNA; Wherein, miR-19b-3p concentration is followed successively by 0 (swimming lane 4), 0.5 μM (swimming lane 5), 2.5 μMs (swimming lane 6), mismatch DNA is that 0.5 μM of miR-16-5p (swimming lane 7) and h19bDM I (swimming lane 8) and h19bDM II (swimming lane 9), swimming lane 1-3 are followed successively by not containing nucleic acids marker GRE19b (5s) C, GRE19b (5s) G and GRE19b (5s) C-G of AgNCs.
Embodiment
Below in conjunction with specific embodiment, the present invention is described in detail.Following examples will contribute to those skilled in the art and understand the present invention further, but not limit the present invention in any form.It should be pointed out that to those skilled in the art, without departing from the inventive concept of the premise, some distortion and improvement can also be made.These all belong to protection scope of the present invention.
Involved by the application, sequence is as follows:
GRE19b(5s)C(SEQIDNo.1)：tatacgtcagttttgcatggatttgcacaactgacgtatacccccccccccccccgcccgcc
hsa-miR-19b-3p(SEQIDNo.2)：ugugcaaauccaugcaaaacuga
Pri6(7s)(SEQIDNo.3)：gggtggggtggggtggggtatacg
GRE19b(5s)G(SEQIDNo.4)：gggtggggtggggtggggtatacgtcagttgtgcaaatccatgcaaaactgacgtata
h19bDMⅠ(SEQIDNo.5)：tgtgcaaatccatgcaaaaccga
h19bDMⅡ(SEQIDNo.6)：tgtgcaaatcgatgcaaaactga
embodiment 1, detection scheme feasibility are verified
(1) AgNCs/HpDNAs probe synthesis
Synthesize according to method in Yeh literary composition.HpDNAs (GRE19b (5s) C), AgNO 3, NaBH 4initial concentration is respectively 100 μMs, 1mM and 1mM.Phosphate buffered saline buffer stock concentration is 200mM (Pi, pH8.0).Equimolar AgNO 3and NaBH 4successively according to 1GRE19b (5s) C:17AgNO 3: 17NaBH 4ratio join in HpDNA, make three's final concentration be respectively 15 μMs, 250 μMs and 250 μMs (Pi, 20mM, pH8.0).Wherein, NaBH 4need fresh configuration, and finally in 30s, join Ag fast +in the mixed solution of/HpDNA, afterwards, concuss 45s ~ 1min.Gained solution ambient temperatare in dark situation puts 18h, to obtain stable AgNCs/HpDNAs probe.
(2) rich G sequence hybridization fluorescent reinforcing effect checking
To in obtained probe AgNCs/GRE19b (5s) C, add corresponding a certain amount of primer (Pri6 (7s)) respectively, or the mixture of primer (Pri6 (7s)) and target miRNA (miR-19b-3p), or complementary strand HpDNAc (GRE19b (5s) G, SEQIDNO:4), make the mixed solution obtaining equimolar probe and above-mentioned nucleic acid, in 55 DEG C of environment, hatch 55min afterwards.Finally, in 4 DEG C of dark situations, place more than 1h, fluoroscopic examination can be carried out on spectrophotofluorometer.
(3) result
In SDA reaction, HpDNAc, primer, target miRNA all can be hybridized with AgNCs/HpDNA, and for this reason, we determine the fluorescence of above-mentioned hybrid product respectively.As shown in Figure 2, AgNCs/GRE19b (5s) C probe is only when forming GRE19b (5s) C-G with its complementary strand thereof, just can produce significant Fluorescence Increasing at 490nmex/570nmem place, and the hybridization of other nucleic acid comprises primer and target miRNA all can not obtain so significant enhancing signal (Fig. 2 (A)).Meanwhile, Gel electrophoresis results display AgNCs/HpDNA-HpDNAcs forms the brightest double-strand band, and adding of target miRNA also can form a small amount of double-strand batten band, and adding of primer can not produce double-strand batten band (Fig. 2 (B)).The above results shows, rich G sequence enhancement effect of fluorescence occurs over just on AgNCs/HpDNA-HpDNAcs, and there will not be on any intermediate of SDA reaction, and really by target miRNA but not primer opens HpDNA, confirms that this inspection policies is feasible.In addition, it should be noted that in the swimming lane of every AgNCs/GRE19b of having (5s) C and all produce an additional band, travelling speed is faster than GRE19b (5s) C, may be under AgNCs effect, make this probe self structure unstable, the fragment that Partial digestion produces.
embodiment 2, single miRNA detect
(1) AgNCs/GRE19b (5s) C probe synthesis
Prepare AgNCs/GRE19b (5s) C probe according to step described in (1), but GRE19b (5s) C final concentration is 5 μMs, AgNO 3and NaBH 4add-on still presses 1GRE19b (5s) C:17AgNO 3: 17NaBH 4carry out.
(2) single miRNA detects
Be 50 μ LSDA reaction solutions in each reaction tubes, comprise following composition: 1 × Nb2.1 makes damping fluid (pH of buffer 7.925 DEG C) (50mMNaAc, 10mMTris-HAc, 10mMMg (Ac) by oneself 2with 100 μ g/mLBSA) 200 μMs of dNTPs, 10UBsu polysaccharases (without DTT), AgNCs/GRE19b (5s) C probe (2.5 μMs of HpDNA), the target miRNA (0.05-2.5 μM of miR-19b-3p) of different concns and 2.5 μMs of primer Pri6 (7s).Gained reaction solution hatches 55min under being placed in 55 DEG C of conditions, preserves subsequently in 4 DEG C of dark situations, can carry out fluoroscopic examination on spectrophotofluorometer, experiment repetition 3 times.In addition, reaction solution based on AgNCs/GRE19b (5s) C probe also detects on real-time fluorescence quantitative PCR instrument Bio-RadiQ5, utilize FAM look group, 55min is hatched under 55 DEG C of conditions, gather real-time qPCR signal simultaneously, be warming up to 95 DEG C with the speed of 1 DEG C/30s from 25 DEG C subsequently, draw high resolving power solubility curve (HRM).
(3) result
The single miRNA detected result of gradient concentration as shown in Figure 3.Along with the increase of miR-19b-3p concentration, reaction product excites lower fluorescence to strengthen gradually at 490nm wavelength, excites lower fluorescence to weaken gradually at 430nm wavelength.After drawing point diagram, change can be seen linearly.Detect based on above-mentioned probe miR-19b-3p and be limited to 0.05 μM (λ ex=490nm) and 0.1 μM (λ ex=430nm).
Based on the real-time detection display of miR-19b-3p three kinds of concentration 0 μM of AgNCs/GRE19b (5s) C probe, the reaction solution of 1 μM and 2.5 μMs all has linear amplification curve (Fig. 4), and in ~ 20min blank sample not production background signal.What this result confirmed that SDA reacts carries out smoothly.In addition, this probe also can be used for drawing HRM curve, and its product of the reaction solution Tm value obtaining target miRNA is 55 DEG C.
Gel electrophoresis results display gradient concentration 0 μM, the reaction solution double-stranded products AgNCs/HpDNA-HpDNAcs band of 0.5 μM and 2.5 μMs becomes clear gradually, residue strand AgNCs/HpDNA band becomes faint (Fig. 6) gradually, and the single miRNA that also show based on AgNCs/GRE19b (5s) C probe detects carrying out smoothly of SDA reaction.
embodiment 3, single base mispairing detection of nucleic acids
(1) single base mispairing detection of nucleic acids
According in embodiment 2 (1,2) described step is carried out, only determined nucleic acid is changed into 0.5 μM of mismatch DNA, namely based on AgNCs/GRE19b (5s) C probe in detecting miR-16-5p, h19bDM I (sequence SEQIDNO:5) and h19bDM II (sequence SEQIDNO:6).
(2) result
Mismatch DNA detected result as shown in Figure 5.Can see, in the detection based on AgNCs/GRE19b (5s) C probe, only miR-19b-3p (λ ex=490nm) shows the highest Fluorescence Increasing signal, all the other samples are all more weak at the Fluorescence Increasing of this excitation wave strong point, in addition, based on AgNCs/GRE19b (5s) C probe under 430nm wavelength excites, miR-19b-3p and h19bDM I shows as fluorescent quenching equally, and contrary Fluorescence Increasing appears in miR-16-5p and h19bDM I.As fully visible, the detected representation based on AgNCs/GRE19b (5s) C probe goes out certain specificity, but detect a base mispairing in miRNA and HpDNA neck region complementary portion (MSc district) shows very unstable.
Gel electrophoresis results display mismatch DNA sample strip consistent with blank sample band (Fig. 6), demonstrates the specificity of this detection method further.
Above specific embodiments of the invention are described.It is to be appreciated that the present invention is not limited to above-mentioned particular implementation, those skilled in the art can make various distortion or amendment within the scope of the claims, and this does not affect flesh and blood of the present invention.

Claims (10)

1. a HpDNA, is characterized in that, sequence is as shown in SEQIDNO:1.
2. based on an AgNCs/HpDNA of HpDNA described in claim 1, it is characterized in that, described AgNCs/HpDNA is prepared by the following method:
By AgNO 3solution, NaBH 4solution adds in HpDNA, concussion, leaves standstill, obtains AgNCs/HpDNA.
3. AgNCs/HpDNA according to claim 2, is characterized in that, described HpDNA, AgNO 3, NaBH 4the ratio of whole volumetric molar concentration be 1:17:17;
The time of described concussion is 45s ~ 1min;
Described leaving standstill is specially ambient temperatare in dark situation and puts 18h.
4. AgNCs/HpDNA according to claim 2 is detecting the application in cancer of the stomach blood plasma miRNA mark miR-19b-3p, and the sequence of described miR-19b-3p is as shown in SEQIDNO:2.
5. the cancer of the stomach blood plasma miRNA mark miR-19b-3pSDA detection method based on AgNCs/HpDNA described in claim 2, it is characterized in that, described detection method comprises: with described AgNCs/HpDNAs for molecular probe, SDA reaction is carried out under the primer effect overhanging end containing rich G sequence, by rich G sequence hybridization fluorescent reinforcing effect, respectively under 430nm and 490nm wavelength excites, realize miR-19b-3p and detect.
6. cancer of the stomach blood plasma miRNA mark miR-19b-3pSDA detection method according to claim 5, it is characterized in that, this primer sequence is as SEQIDNO:3.
7. cancer of the stomach blood plasma miRNA mark miR-19b-3pSDA detection method according to claim 5, is characterized in that, the cumulative volume of described SDA reaction is 50 μ L, wherein,
8. cancer of the stomach blood plasma miRNA mark miR-19b-3pSDA detection method according to claim 7, it is characterized in that, described damping fluid 1 × Nb2.1 comprises 50mMNaAc, 10mMTris-HAc, 10mMMg (Ac) 2with 100 μ g/mLBSA, pH of buffer 7.9.
9. cancer of the stomach blood plasma miRNA mark miR-19b-3pSDS detection method according to claim 7, is characterized in that, the reaction conditions of described SDA reaction is hatch 55min in 55 DEG C of environment.
10. the application of the detection method according to any one of claim 5 to 9 in single base mispairing nucleotide sequence detects.
CN201510703249.3A 2016-02-22 2016-02-22 AgNCs/HpDNA probe based microRNA SDA (strand-displacement amplification) detection method Pending CN105483212A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510703249.3A CN105483212A (en) 2016-02-22 2016-02-22 AgNCs/HpDNA probe based microRNA SDA (strand-displacement amplification) detection method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510703249.3A CN105483212A (en) 2016-02-22 2016-02-22 AgNCs/HpDNA probe based microRNA SDA (strand-displacement amplification) detection method

Publications (1)

Publication Number Publication Date
CN105483212A true CN105483212A (en) 2016-04-13

Family

ID=55670483

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510703249.3A Pending CN105483212A (en) 2016-02-22 2016-02-22 AgNCs/HpDNA probe based microRNA SDA (strand-displacement amplification) detection method

Country Status (1)

Country Link
CN (1) CN105483212A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105928917A (en) * 2016-04-20 2016-09-07 盐城工学院 Silver nanocluster sensor, and preparation method and application thereof
CN113061649A (en) * 2021-04-02 2021-07-02 福州大学 Surface enhanced Raman spectrum sensor for detecting microRNA and preparation method thereof

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
CHRIS I. RICHARDS等: "Oligonucleotide-Stabilized Ag Nanocluster Fluorophores", 《J. AM. CHEM. SOC.》 *
HSIN-CHIH YEH等: "A DNA -Silver Nanocluster Probe That Fluoresces upon Hybridization", 《NANO LETT. 》 *
HSIN-CHIH YEH等: "A Fluorescence Light-Up Ag Nanocluster Probe That Discriminates Single-Nucleotide Variants by Emission Color", 《J. AM. CHEM. SOC.》 *
JINGPU ZHANG等: "Circulating MiR-16-5p and MiR-19b-3p as two novel potential biomarkers to indicate progression of gastric cancer", 《THERANOSTICS》 *
JINGPU ZHANG等: "Hairpin DNA-Templated Silver Nanoclusters as Novel Beacons in Strand Displacement Amplifi cation for MicroRNA Detection", 《ANAL. CHEM.》 *
SEONG WOOK YANG等: "Rapid Detection of MicroRNA by a Silver Nanocluster DNA Probe - Analytical Chemistry", 《ANAL. CHEM.》 *
YU-QIANG LIU等: "Attomolar Ultrasensitive MicroRNA Detection by DNA-Scaffolded Silver-Nanocluster Probe Based on Isothermal Amplifi cation", 《ANAL. CHEM.》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105928917A (en) * 2016-04-20 2016-09-07 盐城工学院 Silver nanocluster sensor, and preparation method and application thereof
CN113061649A (en) * 2021-04-02 2021-07-02 福州大学 Surface enhanced Raman spectrum sensor for detecting microRNA and preparation method thereof

Similar Documents

Publication Publication Date Title
Ye et al. Research advances in the detection of miRNA
US20220010358A1 (en) Method for detection of rna
CN103789435B (en) A kind of miRNA fluorescence detection reagent kit based on cascade constant-temperature amplification and method
Zhang et al. Multiplexed detection of microRNAs by tuning DNA-scaffolded silver nanoclusters
CN105274226A (en) MicroRNA SDA (strand-displacement amplification) detection method based on AgNCs/HpDNA probes
Chi et al. Direct fluorescence detection of microRNA based on enzymatically engineered primer extension poly-thymine (EPEPT) reaction using copper nanoparticles as nano-dye
CN106480021B (en) A kind of nucleic acid constant-temperature exponential amplification techniques based on symmetric annular dumbbell template and its application in microRNA detection
US20120045768A1 (en) Methods and compositions to detect and differentiate small rnas in rna maturation pathway
CA2610861A1 (en) Normalization of samples for amplification reactions
CN104278088A (en) MiRNA detection method based on constant-temperature index amplification reaction and surface-enhanced raman spectroscopy detection and application of miRNA detection method
Dai et al. Catalytic hairpin assembly gel assay for multiple and sensitive microRNA detection
CN110734967B (en) Joint composition and application thereof
CN105018603A (en) Constant temperature index amplification technology based on triple amplification reaction connection in series and application of constant temperature index amplification technology in microRNA detection
Yoon et al. Highly sensitive multiplex detection of microRNA using light-up RNA aptamers
CN106868140A (en) The method of multiple fluorescence quantitative PCR
Li et al. Efficient dual-amplification system for G-quadruplex-based non-enzymatic fluorescence detection of microRNA
Park et al. Multiplexed miRNA detection based on target-triggered transcription of multicolor fluorogenic RNA aptamers
Chen et al. Imaging of intracellular-specific microRNA in tumor cells by symmetric exponential amplification-assisted fluorescence in situ hybridization
CN105483212A (en) AgNCs/HpDNA probe based microRNA SDA (strand-displacement amplification) detection method
Zhou et al. Ψ-type hybridization and CRISPR/Cas12a-based two-stage signal amplification for microRNA detection
Li et al. DNA polymerase/NEase-assisted signal amplification coupled with silver nanoclusters for simultaneous detection of multiple microRNAs and molecular logic operations
CN108300775B (en) Annular dumbbell-shaped probe and application thereof
CN105274227A (en) MicroRNA SDA detecting method based on AgNCs/HpDNA probes
CN110628888A (en) Nucleic acid probe assembled by triggering miRNA-21 and cell fluorescence imaging
Wang et al. Sensitive detection of mRNA by using specific cleavage-mediated isothermal exponential amplification reaction

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20160413

RJ01 Rejection of invention patent application after publication