CN105483212A

CN105483212A - AgNCs/HpDNA probe based microRNA SDA (strand-displacement amplification) detection method

Info

Publication number: CN105483212A
Application number: CN201510703249.3A
Authority: CN
Inventors: 崔大祥; 张晶璞
Original assignee: Shanghai Jiaotong University
Current assignee: Shanghai Jiaotong University
Priority date: 2016-02-22
Filing date: 2016-02-22
Publication date: 2016-04-13

Abstract

The invention discloses an AgNCs/HpDNA probe based microRNA SDA (strand-displacement amplification) detection method. The method includes that silver nanoclusters are synthesized by the aid of a hairpin type DNA template and serve as novel molecular bacons, and single detection of gastric plasm miRNA markers is realized by a hybridization resulted G-rich fluorescence enhancement effect in strand displacement isothermal amplification reaction mediated by a G-rich sequence of a dangling end of a primer. The AgNCs/HpDNA probe based microRNA SDA detection method has the advantages of high specificity, short reaction time, low material consumption and simplicity and convenience in operation and creates a new direction for establishing a quick and simple novel miRNA detection method.

Description

MicroRNA SDA detection method based on AgNCs/HpDNA probe

Technical Field

The invention relates to the field of medicine and molecular diagnosis, in particular to a microRNASDA detection method based on AgNCs/HpDNA probes, and particularly relates to a single microRNA detection method based on hairpin type DNA template synthesis silver nanocluster probe binding strand instead of isothermal amplification.

Background

MicroRNA (miRNA) is a type of endogenous non-coding small RNA molecule with the length of about 21nt, and can participate in regulating the expression level of mRNA through precise or non-precise complementary pairing with the mRNA. Multiple mirnas can coordinate to regulate one mRNA, or one miRNA can simultaneously affect multiple target genes, thereby forming a highly complex regulatory network that affects a range of biological functions from molecule to cell to tissue level. Abnormal expression of mirnas is closely related to disease and cancer development. More importantly, multiple miRNA markers have been found to be useful for early diagnosis, prognosis and monitoring of progression of cancer. Wherein, the Shanghai university of transportation Zhang MiR-16-5 pandemic subject group obtains two plasma miRNA markers of miR-16-5p and miR-19b-3p by microarray miRNA whole genome scanning and combining qRT-PCR technology, and indicates that the two can be used for indicating the development process of gastric cancer (Zhang, J., Song, Y., Zhang, C., et al. (2015) circular and chronic miR-16-5 pandmur-19 b-3 passwonovelophil promoter of gastric cancer. Theranostics,5,733 and 745.). Among them, qRT-PCR is a gold standard for quantitative detection of mirnas, but it is time-consuming and laborious because it requires reverse transcription and thermocycling amplification and detection step by step. Therefore, a new method for detecting miRNA, which is convenient and rapid, needs to be developed further.

The advent of isothermal amplification technology has led to the interest of many researchers in freeing them from the thermal cycling denaturation step and instrumentation. As the first generation isothermal amplification technology, Strand-displacement amplification (SDA) is rapidly developed by the inspiration of the base excision repair mechanism in DNA repair, and various subtypes including multi-primer SDA (multiplex-induced SDA), shear-induced SDA (nick-induced SDA), loop-mediated isothermal amplification (LAMP), and structure-transformation-induced SDA (structure-switched SDA) have been developed so far. The SDA is induced by structure conversion, and a special designed shearing site and an additional use of a shearing enzyme are not needed, but only the combination of the target nucleic acid to be detected and the hairpin structure probe is combined to cause the latter to be opened so as to induce the SDA reaction, so that the method is particularly suitable for detecting short-chain nucleic acid molecules and miRNA. At present, a detection probe commonly used for the structure-switched-induced SDA is a hairpin DNA molecular beacon (mb) with one end connected to a fluorescent dye and the other end connected to a fluorescence quencher, but since it requires DNA to be modified by coupling, the detection cost is increased, and the detection application is limited.

With the rise of the synthesis of silver nanoclusters (DNA-templated silver nanoclusters (AgNCs/DNA)) with DNA templates, it has become possible to develop novel nucleic acid fluorescent probes other than fluorescent dye or quantum dot modifications. The silver nanoclusters are aggregates consisting of only a few or several tens of silver atoms having a diameter of less than 1nm, which are easily synthesized and whose fluorescence can be controlled. More importantly, due to the introduction of the DNA template in AgNCs/DNA, specific photophysical properties can be obtained by merely changing the DNA sequence, length and conformation. Recently, a variety of DNA sequence synthesis AgNCs have been used for nucleic acid or miRNA detection. Yang and Shah used 5'-CCTCCTTCCTCC-3' as the AgNCs nucleation region sequence and connected with miRNA hybridization sequence, and detected miR-160 and miR-172 by virtue of the fluorescence quenching effect of the probe (Yang, S.W. and Vosch, T. (2011) rapid chemoluminescence of microRNAbyasilvaninennocclusterDNAPRObe. anal. chem.83, 6935-6939.). Liu utilizes an exponential isothermal amplification reaction to generate a DNA template for red fluorescent AgNCs synthesis, and miR-141 is determined by means of the relation between fluorescence intensity and DNA template concentration. These tests either rely on the effect of fluorescence quenching or, respectively, signal amplification and signal detection, lead to poor specificity or are cumbersome to handle (Liu, Y. -Q., Zhang, M., Yin, B. -C.andYe, B. -C. (2012) Attomolarultrarapid fluorescence amplification byDNA-scaffoldslave-nanocruster-nanocomprex. TM., chem.,84, 5165-. While Yeh reports the fluorescence enhancing effect of hybridization-mediated G-rich sequences on AgNCs/DNA, it makes it possible to establish a nucleic acid detection platform based on light-up signals (Yeh, H.C., Sharma, J., Han, J.J., Martinez, J.S. and Werner, J.H. (2010) ADNA-silver nanoparticle fluorescence amplification. NanoLett.,10, 3106-. However, simple hybridization detection is not easy, but it is difficult to ensure good specificity. Therefore, in order to further improve the detection specificity and simplify the operation steps, the fluorescence enhancement effect of the G-rich sequence based on AgNCs/DNA is combined with the structure conversion-induced SDA amplification technology for the first time, and the interaction of the two is researched, so that the controllable, simple and high-specificity detection is realized.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention aims to provide a miRNASDA detection method based on an AgNCs/HpDNA probe, in particular to a method for detecting miRNA by combining a hairpin DNA template synthesis silver nanocluster (AgNCs/HpDNA) probe with SDA reaction, namely, aiming at the miRNA marker miR-19b-3p obtained by early screening, the AgNCs/HpDNA probe is designed and constructed, the fluorescence enhancement performance of a G-rich sequence of the probe is verified, and on the basis, single detection and single base mismatch detection are carried out on the miRNA marker.

The purpose of the invention is realized by the following technical scheme:

in a first aspect, the present invention provides an HpDNA having a sequence as shown in seq id no: 1 is shown.

In a second aspect, the present invention provides an AgNCs/HpDNA based on said HpDNA, said AgNCs/HpDNA being prepared by the process of:

mixing AgNO₃Solution, NaBH₄Adding the solution into HpDNA, shaking and standing to obtain AgNCs/HpDNA.

Preferably, the HpDNA, AgNO₃、NaBH₄The ratio of the final molar concentration of (a) to (b) is 1:17: 17; the oscillation time is 45 s-1 min, and the oscillation is particularly violent oscillation; the standing is specifically carried out at room temperature for 18h in a dark environment.

In a third aspect, the invention provides an application of AgNCs/HpDNA in detecting gastric cancer plasma miRNA marker miR-19b-3p, wherein the sequence of miR-19b-3p is shown as SEQ ID NO: 2, respectively.

In a fourth aspect, the invention provides a method for detecting a gastric cancer plasma miRNA marker miR-19b-3pSDA based on the AgNCs/HpDNA, wherein the method comprises the following steps: and (2) performing SDA reaction under the action of a primer containing a G-rich sequence pendulous end by using the AgNCs/HpDNAs as a molecular probe, and realizing miR-16-5p detection by virtue of a G-rich sequence hybridization fluorescence enhancement effect, wherein the primer sequence is shown as SEQIDNO: 3.

preferably, the SDA reaction has a total volume of 50 μ L, wherein,

preferably, the buffer 1 XNb2.1 comprises 50mM NaAc, 10mM Tris-HAc, 10mM Mgc (Ac)2 and 100. mu.g/mLBSA, the buffer pH7.9(25 ℃).

Preferably, the reaction conditions for the SDA reaction are: incubate at 55 ℃ for 55 min. The excitation wavelengths for fluorescence detection were 490nm and 430 nm. In a fifth aspect, the invention provides the use of the detection method in the detection of single base mismatched nucleic acid sequences.

The technical scheme adopted by the invention is as follows:

as shown in FIG. 1, the hairpin probe (GRE19b (5s) C) used for the synthesis of AgNCs contained three regions, a neck region HpS, a loop region HpL and a 3' overhang region HpGO. Wherein the specially designed overhang region is rich in C sequence for synthesis of AgNCs, and HpGO (5'-CCCCCCCCCCCCCCCGCCCGCC-3') is close to the G-rich overhang sequence in the complementary strand under hybridization to obtain green fluorescence enhancement signal. The probe for detecting miR-19b-3p is GRE19b (5s) C, and the sequence of the probe is shown as SEQ ID NO: 1 is shown.

The miRNA sequence to be detected is respectively complementary with a partial sequence of a neck HpS at the 5' end and a loop region HpL, the corresponding sequence regions are MSc and MLc respectively, the design is favorable for better opening a hairpin structure, the corresponding target miRNA is miR-19b-3p, and the sequence of the target miRNA is represented by SEQ ID NO: 2, respectively.

The primer sequence also consists of two regions, a complementary region of the neck region (PGSc,5 '-TATACG-3') and a dangling region of the G-rich sequence (PO: 5'-GGGTGGGGTGGGGTGGGG-3'), and the primer corresponding to HpDNA is Pri6(7s), the sequence of which is shown in SEQ ID NO: 3, respectively.

The detection mechanism of mirnas is as follows. First, AgNCs were generated on hairpin probes, and the AgNCs/GRE19b (5s) C probe showed no or weak fluorescence emission at 490nm wavelength excitation. In the presence of the target miRNA, it opens the hairpin structure by hybridizing to AgNCs/HpDNA. Subsequently, the primer is hybridized to the 3' end of the neck of the hairpin probe, polymerase chain reaction is guided under the combined action of polymerase and dNTP, and the complementary strand HpDNAC (GRE19b (5s) G with the sequence shown as SEQ ID NO: 4) of the HpDNA is obtained through extension, so that the G-rich dangling complementary sequence in the hybridized double strand AgNCs/HpDNA-HpDNAC is close to the AgNCs, and the fluorescence enhancement signal of the probe at the wavelength is obtained. At the same time, the target miRNA sequence previously bound to HpDNA is replaced and released into the next cycle reaction. In contrast, in the absence of the target miRNA, HpDNA remains in a closed state, primers cannot bind, and therefore HpDNA cannot be amplified to produce HpDNA, and finally, a fluorescence enhancement signal at this wavelength cannot be obtained.

Compared with the prior art, the invention has the beneficial effects that:

firstly, based on the AgNCs/HpDNA probe and the fluorescence enhancement effect of the G-rich sequence thereof, the high specificity detection of miRNA can be realized. Compared with a mechanism that SYBRGreen is randomly inserted into double-stranded nucleic acid and a fluorescent signal response can be generated only by opening a hairpin probe of MB, the probe used by the invention can generate a fluorescence enhancement signal only after forming a complementary sequence with a G-rich dangling sequence and hybridizing with the complementary sequence, and the signal can not be generated by opening the hairpin probe and any intermediate hybridized double strand, so that the specificity is high.

Secondly, the hybridization-mediated G-rich sequence enhancement effect can generate double detection signals, namely fluorescence enhancement degree and fluorescence quenching degree, for one reaction, and more abundant information is provided for judging detection products.

Third, hairpin DNA serves as both a template for SDA reaction and for AgNCs generation, reducing reaction time and saving reaction materials. By mixing AgNO₃With NaBH₄Mixing the probe with hairpin DNA according to a certain proportion to prepare the AgNCs/HpDNA probe. Although the probe needs to be left to stand for 18 hours to sufficiently age the AgNCs, it can be prepared in large quantities at one time and stored for a long period of time, and the standing time can be shortened to 4 hours. On the basis, the SDA reaction time is completed in one step, the time length is 55min, and the time can be further shortened to 30 min.

Drawings

Other features, objects and advantages of the invention will become more apparent upon reading of the detailed description of non-limiting embodiments with reference to the following drawings:

FIG. 1 is a schematic view of the detection principle;

wherein, AgNCs are generated on the HpDNA template; hybridizing and complementing the target miRNA to a 5' neck region and a ring region of HpDNA; opening HpDNA; fourthly, the G-rich dangling primer is combined with the neck region of HpDNA 3'; extending under the action of polymerase to form a G-rich dangling complementary strand HpDNAC; sixthly, releasing the target miRNA, and entering the next cycle SDA reaction;

FIG. 2 is a graph showing the fluorescent enhancement effect of G-rich sequence hybridization; wherein,

FIG. A. fluorescence emission spectra of AgNCs/GRE19b (5s) C probe and its hybridization product;

GRE19b (5s) C-Pri6(7 s): AgNCs/GRE19b (5s) C was hybridized with Pri6(7s),

GRE19b (5s) C-Pri6(7s) -h19 b: AgNCs/GRE19b (5s) C was hybridized with Pri6(7s) and miR-19b-3p,

GRE19b (5s) C-G: AgNCs/GRE19b (5s) C hybridized to GRE19b (5s) G;

FIG. B is a gel electrophoresis of the reaction product;

lanes 1-3 are the nucleic acid markers GRE19b (5s) C, GRE19b (5s) G and GRE19b (5s) C-G, in that order, without AgNCs; lanes 4-6 are in sequence GRE19b (5s) C, GRE19b (5s) C-Pri6(7s), GRE19b (5s) C-Pri6(7s) -h19b and GRE19b (5s) C-G;

FIG. 3 is a gradient concentration single miRNA assay; wherein,

A. b: detecting a fluorescence emission spectrum and a relation between a fluorescence emission peak enhancement value and the concentration of the nucleic acid to be detected by miR-19b-3p under the excitation of 490nm wavelength;

C. d: detecting a fluorescence emission spectrum and a relation between a fluorescence emission peak attenuation value and the concentration of the nucleic acid to be detected by miR-19b-3p under the excitation of the wavelength of 430 nm;

FIG. 4 is a single base mismatch detection; wherein,

A. b: fluorescence emission spectrum and fluorescence emission peak enhancement value of nucleic acid to be detected based on GRE19b (5s) C detection probe under 490nm wavelength excitation;

C. d: fluorescence emission spectrum and fluorescence emission peak attenuation value of nucleic acid to be detected based on GRE19b (5s) C detection probe under 430nm wavelength excitation; h19b refers to miR-19b-3p, h16 refers to miR-16-5p, h19bDM I, II refers to 1 base mismatch miR-19b-3p mimics respectively;

FIG. 5 shows real-time detection of miR-19b-3 p: isothermal amplification curves (A), melting curves (B) and melting temperatures (C) of different concentrations of miR-19B-3p based on GRE19B (5s) C detection probe;

FIG. 6 is a gel electrophoresis image for detecting miR-19b-3p and mismatched nucleic acids based on a GRE19b (5s) C probe; wherein the miR-19b-3p concentrations are 0 (lane 4), 0.5. mu.M (lane 5), 2.5. mu.M (lane 6), the mismatched nucleic acids are 0.5. mu.M miR-16-5p (lane 7) and h19bDM I (lane 8) and h19bDM II (lane 9), and the nucleic acid markers GRE19b (5s) C, GRE19b (5s) G and GRE19b (5s) C-G without AgNCs are provided in lanes 1-3.

Detailed Description

The present invention will be described in detail with reference to specific examples. The following examples will assist those skilled in the art in further understanding the invention, but are not intended to limit the invention in any way. It should be noted that variations and modifications can be made by persons skilled in the art without departing from the spirit of the invention. All falling within the scope of the present invention.

The sequences involved in this application are as follows:

GRE19b(5s)C(SEQIDNo.1)：tatacgtcagttttgcatggatttgcacaactgacgtatacccccccccccccccgcccgcc

hsa-miR-19b-3p(SEQIDNo.2)：ugugcaaauccaugcaaaacuga

Pri6(7s)(SEQIDNo.3)：gggtggggtggggtggggtatacg

GRE19b(5s)G(SEQIDNo.4)：gggtggggtggggtggggtatacgtcagttgtgcaaatccatgcaaaactgacgtata

h19bDMⅠ(SEQIDNo.5)：tgtgcaaatccatgcaaaaccga

h19bDMⅡ(SEQIDNo.6)：tgtgcaaatcgatgcaaaactga

example 1 validation of assay protocol feasibility

(1) AgNCs/HpDNAs probe synthesis

The synthesis was carried out according to the method in Yeh. HpDNAs (GRE19b (5s) C), AgNO₃，NaBH₄The starting concentrations were 100. mu.M, 1mM and 1mM, respectively. The stock concentration of phosphate buffer was 200mM (Pi, pH 8.0). Equimolar AgNO₃And NaBH₄In turn according to 1GRE19b (5s) C:17AgNO₃:17NaBH₄Was added to HpDNA to give final concentrations of 15. mu.M, 250. mu.M and 250. mu.M (Pi,20mM, pH8.0), respectively. Wherein, NaBH₄Fresh make-up is required and finally rapid addition to Ag within 30s⁺After that, the mixture solution of HpDNA is shaken vigorously for 45 s-1 min. The obtained solution was left at room temperature in a dark environment for 18 hours to obtain a stable AgNCs/HpDNAs probe.

(2) G-rich sequence hybridization fluorescence enhancement effect verification

To the obtained probe AgNCs/GRE19b (5s) C, a corresponding amount of primer (Pri6(7s)), or a mixture of primer (Pri6(7s)) and target miRNA (miR-19b-3p), or complementary strand HpDNac (GRE19b (5s) G, SEQ ID NO: 4) was added, and a mixture of equimolar amounts of the probe and the above nucleic acid was allowed to stand at 55 ℃ for 55 min. And finally, standing for more than 1h in a dark environment at 4 ℃ to perform fluorescence detection on a fluorescence spectrophotometer.

(3) Results

In the SDA reaction, HpDNAC, primers and target miRNA can all hybridize with AgNCs/HpDNA, and for this purpose, we measure the fluorescence of the hybridization products. As shown in fig. 2, the AgNCs/GRE19b (5s) C probe produced significant fluorescence enhancement at 490nmex/570nmem only when hybridized to its complementary strand to form GRE19b (5s) C-G, while hybridization of other nucleic acids, including primers and target mirnas, did not yield such significant enhancement signals (fig. 2 (a)). Meanwhile, the results of gel electrophoresis show that AgNCs/HpDNA-HpDNACs form the brightest double-strand band, a small amount of double-strand-like band can be formed by adding the target miRNA, and the double-strand-like band cannot be generated by adding the primer (FIG. 2 (B)). The above results show that the G-rich sequence fluorescence enhancement effect only occurs on AgNCs/HpDNA-HpDNACs, but not on any intermediate of the SDA reaction, and that HpDNA is indeed opened by the target miRNA and not by the primers, confirming that this detection strategy is feasible. In addition, it is noted that, in all the lanes with AgNCs/GRE19b (5s) C, an additional band is generated, the migration speed is faster than that of GRE19b (5s) C, and the probe structure is unstable under the action of AgNCs, so that the generated fragment is partially degraded.

Example 2 detection of Single MiRNA

(1) AgNCs/GRE19b (5s) C Probe Synthesis

AgNCs/GRE19b (5s) C probes were prepared as described in (1) but with GRE19b (5s) C at a final concentration of 5. mu.M, AgNO₃And NaBH₄The addition amount is still 1GRE19b (5s) C:17AgNO₃:17NaBH₄The process is carried out.

(2) Single miRNA detection

50 μ LSDA reaction solution contained in each reaction tube 1 × Nb2.1 self-made buffer (pH 7.925 ℃ C.) (50mM NaAc, 10mM Tris-HAc, 10mM Mgg (Ac))₂And 100 μ g/mLBSA)200 μ M dNTPs, 10UBsu polymerase (without DTT), AgNCs/GRE19b (5s) C probe (2.5 μ M DPPDNA), different concentrations of target miRNA (0.05-2.5 μ M miR-19b-3p) and 2.5 μ M primer Pri6(7 s). The obtained reaction solution is incubated for 55min at the temperature of 55 ℃, then is stored in a dark environment at the temperature of 4 ℃, and then the fluorescence detection can be carried out on a fluorescence spectrophotometer, and the experiment is repeated for 3 times. In addition, the reaction solution based on the AgNCs/GRE19b (5s) C probe was also detected on a real-time fluorescence quantitative PCR instrument Bio-RadiQ5, using FAM chromogen, incubated at 55 ℃ for 55min while collecting real-time qPCR signals, and then heated from 25 ℃ to 95 ℃ at a rate of 1 ℃/30s, plottedHigh resolution dissolution profile (HRM).

(3) Results

The results of the gradient concentration single miRNA detection are shown in fig. 3. With the increase of the concentration of miR-19b-3p, the fluorescence of the reaction product is gradually enhanced under the excitation of 490nm wavelength, and the fluorescence is gradually reduced under the excitation of 430nm wavelength. After plotting the dot plot, the variation can be seen to be linear. The detection limit was 0.05 μ M (λ ex 490nm) and 0.1 μ M (λ ex 430nm) based on the above probe miR-19b-3 p.

Real-time detection of miR-19b-3p based on the AgNCs/GRE19b (5s) C probe showed that the three reaction solutions with concentrations of 0. mu.M, 1. mu.M and 2.5. mu.M all had linear amplification curves (FIG. 4), and no background signal was generated by the blank within-20 min. This result confirms the smooth progress of the SDA reaction. In addition, the probe can also be used for drawing an HRM curve to obtain a reaction solution with target miRNA, wherein the Tm value of the product is 55 ℃.

Gel electrophoresis results show that double-stranded products AgNCs/HpDNA-HpDNACs of reaction liquid with gradient concentrations of 0 mu M, 0.5 mu M and 2.5 mu M are gradually bright, and the residual single-stranded AgNCs/HpDNA bands are gradually weak (figure 6), and also show that single miRNA detection SDA reaction based on the AgNCs/GRE19b (5s) C probe is smoothly carried out.

Example 3 Single base mismatch nucleic acid detection

(1) Single base mismatch nucleic acid detection

The procedure described in example 2 (1, 2) was followed, except that the nucleic acid to be tested was changed to 0.5. mu.M mismatched nucleic acid, i.e., miR-16-5p, h19bDM I (sequence SEQ ID NO: 5) and h19bDM II (sequence SEQ ID NO: 6) were detected on the basis of the AgNCs/GRE19b (5s) C probe.

(2) Results

The results of the mismatch nucleic acid detection are shown in FIG. 5. It can be seen that in the detection based on the AgNCs/GRE19b (5s) C probe, only miR-19b-3p (λ ex ═ 490nm) showed the highest fluorescence enhancement signal, and the fluorescence enhancement of the remaining samples was weak at the excitation wavelength, and in addition, miR-19b-3p and h19bDM I also showed fluorescence quenching, while miR-16-5p and h19bDM I showed opposite fluorescence enhancement, under excitation at a wavelength of 430nm based on the AgNCs/GRE19b (5s) C probe. In conclusion, the detection based on the AgNCs/GRE19b (5s) C probe shows a certain specificity, but the detection is not stable in the mismatching of miRNA and one base on the complementary part (MSc region) of the HpDNA neck region.

The gel electrophoresis result shows that the mismatched nucleic acid sample band is consistent with the blank sample band (FIG. 6), and the specificity of the detection method is further verified.

The foregoing description of specific embodiments of the present invention has been presented. It is to be understood that the present invention is not limited to the specific embodiments described above, and that various changes and modifications may be made by one skilled in the art within the scope of the appended claims without departing from the spirit of the invention.

Claims

1. An HpDNA, characterized by the sequence shown in SEQ ID NO: 1 is shown.

2. An AgNCs/HpDNA based on the HpDNA of claim 1, wherein the AgNCs/HpDNA is prepared by the method comprising:

3. According toThe AgNCs/HpDNA of claim 2, wherein the HpDNA, AgNO₃、NaBH₄The ratio of the final molar concentration of (a) to (b) is 1:17: 17;

the oscillation time is 45 s-1 min;

the standing is specifically carried out at room temperature for 18h in a dark environment.

4. The application of AgNCs/HpDNA according to claim 2 in detecting gastric cancer plasma miRNA marker miR-19b-3p, wherein the sequence of miR-19b-3p is shown as SEQ ID NO: 2, respectively.

5. A method for detecting gastric cancer plasma miRNA marker miR-19b-3pSDA based on the AgNCs/HpDNA of claim 2, wherein the method comprises the following steps: and (2) performing SDA reaction under the action of a primer containing a G-rich sequence dangling end by using the AgNCs/HpDNAs as a molecular probe, and realizing miR-19b-3p detection under the excitation of wavelengths of 430nm and 490nm respectively by virtue of a G-rich sequence hybridization fluorescence enhancement effect.

6. The method for detecting the gastric cancer plasma miRNA marker miR-19b-3pSDA according to claim 5, wherein the primer sequence is represented by SEQ ID NO: 3.

7. the method for detecting the gastric cancer plasma miRNA marker miR-19b-3pSDA according to claim 5, wherein the total volume of the SDA reaction is 50 μ L,

8. the method for detecting gastric cancer plasma miRNA marker miR-19b-3pSDA of claim 7, wherein the buffer solution 1 × Nb2.1 comprises 50mM NaAc, 10mM Tris-HAc, 10mM Mgg (Ac)₂And 100. mu.g/mLBSA, buffer pH 7.9.

9. The method for detecting the gastric cancer plasma miRNA marker miR-19b-3pSDS as claimed in claim 7, wherein the SDA reaction is carried out under 55 ℃ incubation for 55 min.

10. Use of the detection method according to any one of claims 5 to 9 for the detection of single base mismatched nucleic acid sequences.