CN105463128A - Quantitative detection method for strawberry viruses - Google Patents
Quantitative detection method for strawberry viruses Download PDFInfo
- Publication number
- CN105463128A CN105463128A CN201410594988.9A CN201410594988A CN105463128A CN 105463128 A CN105463128 A CN 105463128A CN 201410594988 A CN201410594988 A CN 201410594988A CN 105463128 A CN105463128 A CN 105463128A
- Authority
- CN
- China
- Prior art keywords
- room temperature
- centrifugal
- strawberry
- add
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a quantitative detection method for strawberry viruses. According to the quantitative detection method, first-chain cDNA is synthesized by purified whole strawberry RNA in a reverse transcription mode, then the cDNA serves as a template, and sense primers and antisense primers are added, wherein the sense primers and the antisense primers correspond to coat protein genes of the to-be-detected viruses; amplification is carried out with the real-time fluorescent quantitative PCR technology, and the amplification Ct value of virus target genes in to-be-detected samples is obtained; according to a standard curve, the infected virus concentration of the to-be-detected samples can be obtained. The strawberry viruses can be accurately and quantitatively detected, and the quantitative detection method is high in sensitivity, low in cost, easy to operate and convenient to apply and popularize.
Description
Technical field
The invention belongs to strawberry prevention and cure of viruses field, be specifically related to a kind of quantitative detecting method of strawberry virus.
Technical background
Strawberry (
fragariaXananassa) be Rosaceae Fragaria per nnial herb.Strawberry cultivating area development is in recent years very fast, and Gross World Product is own through leaping to the 2nd in berry fruits.China is the country that world's strawberry plants Species distributing is maximum, is also the country that cultivated strawberry area is maximum, output is maximum in the world simultaneously.The long-term vegetative propagation of strawberry and continuous cropping and cause kind of sexual involution and the infected virus disease of plant, often show as that plant is downgraded, resistance reduces, malformed fruit increases, fruit quality declines, and yield per unit reduces.Strawberry Virus is widely distributed all over the world, wherein strawberry light yellow edge virus (
strawberrymildyellowedgevirus, SMYEV) be distributed more widely, endanger heavier topmost RNA viruses.Usually adopt regular-PCR or Enzyme-multiplied immune technique to carry out virus disease detection in prior art, its detection specificity is poor, and sensitivity is lower and may have false positive or false negative result.Real-time fluorescence quantitative PCR (RealtimequantitativePCR) technology that developed recently gets up has higher detection sensitivity and accuracy, but also quantitative fluorescent PCR is not used for the method for the detection by quantitative of strawberry virus in prior art.
Summary of the invention
For the problems referred to above, the invention provides a kind of quantitative detecting method of strawberry virus, accurate quantification detection can be carried out to strawberry virus, and highly sensitive.
The present invention is achieved through the following technical solutions:
A quantitative detecting method for strawberry virus, comprises the following steps:
(1) strawberry total serum IgE is extracted;
(2) purification process is carried out to the RNA extracted in step (1);
(3) the first chain cDNA is synthesized in reverse transcription;
(4) with the cDNA obtained in step (3) for template, add the upstream and downstream primer corresponding with the coat protein gene of virus to be detected, real-time fluorescence quantitative PCR (RealtimequantitativePCR) is adopted to carry out increasing and detecting, obtain the Ct value of the target gene of sample, then reference standard curve tries to achieve the concentration that sample infects virus.The method is quantitatively accurate, and highly sensitive.
Alternately, in the quantitative detecting method of above-mentioned strawberry virus, described virus to be detected is strawberry light yellow edge virus (SMYEV), and the upstream and downstream primer sequence corresponding with the coat protein gene of this virus used in described real-time fluorescence quantitative PCR amplification is respectively:
Upstream primer SMYEVcp-F3:CGCTGCTGCCAGTAATAAGG;
Downstream primer SMYEVcp-R6:CGAGGGCGAGGAACCAAT.Adopt the upstream and downstream primer designed for strawberry light yellow edge virus (SMYEV) specially, high to the detection accuracy of this virogene, avoid occurring false positive results, high specificity, highly sensitive, and being applicable to the detection of the strawberry light yellow edge virus (SMYEV) with different geographical source, universality is good, easy to utilize.
Alternately, in the quantitative detecting method of above-mentioned strawberry virus, the regression equation of described typical curve is Y=-0.3229X+9.3399, R
2=0.91, wherein X represents Ct value, and Y represents the mass body volume concentrations of virus, and its unit is pg/uL.On the basis of the mass body volume concentrations of gained, adopt following formula to convert and obtain copy number/volumetric concentration Z.This formula is specially: Z=Y/ (5699*324) * 6*10
11.Directly adopt the typical curve after optimizing and reduction formula, do not need again drawing standard curve voluntarily, operate easier, greatly reduce cost, saved the time, easy to utilize.
Alternately, in the quantitative detecting method of above-mentioned strawberry virus, described typical curve can adopt following methods to make: respectively with at least four kinds have different weaker concn containing the recombinant plasmids of virus coat protein gene for template, adopt the upstream and downstream primer identical with step (4) and identical fluorescent quantitative PCR, testing conditions, obtain Ct value corresponding to different concns respectively, be then depicted as Ct value-virus concentration curve.Described have the optional gradient dilution concentration of different weaker concn, and described typical curve adopts equation of linear regression to carry out matching, and other other weaker concns or other conventional fit approach also can be adopted to carry out matching.
Alternately, in the quantitative detecting method of above-mentioned strawberry virus, also comprise reference gene verification step in described method, be specially: with the cDNA obtained in step (3) for template, with strawberry
actinas reference gene, add the upstream and downstream primer corresponding with reference gene, adopt regular-PCR or real-time fluorescence quantitative PCR to carry out increasing and detecting, the described upstream and downstream primer corresponding with reference gene is respectively:
Upstream primer FAactin-F1:GTATGGTCAAGGCTGGGTTTGCTGG;
Downstream primer FAactin-R1:CGTCACCGACATAAGCATCTTTCTG.Testing sample cDNA template quality can be confirmed by reference gene inspection, belong to a Quality Control in detection, avoid causing final false negative result because of the operational issue such as extraction, purifying, reverse transcription of RNA.
Alternately, in the quantitative detecting method of above-mentioned strawberry virus, described step (1) is specially: get Strawberry ripening blade, after grinding, adds grinding buffer solution and beta-mercaptoethanol, fully grinds in liquid nitrogen; Grinding mixture to be transferred in EP pipe and to add 10% sarcosyl; 70 ° of C water-bath 10min, turn upside down for several times therebetween; Ice bath 5min immediately; Centrifugal under room temperature; Dehydrated alcohol, NaI and heavy molten silicon dioxde solution is added in transfer supernatant liquor to clean EP pipe; Room temperature leaves standstill 30min, and period turns upside down for several times, centrifugal under room temperature; Abandon supernatant solution, add lavation buffer solution washing precipitation; Repeated washing once; Dry 4min under being deposited in room temperature, heavily be dissolved in sterilizing DEPC(diethylpyrocarbonate, diethylpyrocarbonate) in water, add deoxyribonuclease I (RNase-freeDNaseI) and DNA enzymatic damping fluid, 25 ° of C water-bath 10min, obtain total serum IgE crude extract.
Alternately, in the quantitative detecting method of above-mentioned strawberry virus, described step (1) is specially: get Strawberry ripening blade 0.1 ~ 0.2g, after grinding in liquid nitrogen, add 2mL grinding buffer solution (4M guanidinium isothiocyanate, 0.2M sodium-acetate, 25mMEDTA, 1 M Potassium ethanoate, 2.5%PVP-4000) and 200 μ L beta-mercaptoethanols, fully grind.100 μ L10% sarcosyls are added in transferase 10 .5mL grinding mixture to 1.5mLEP pipe.70 ° of C water-bath 10min, period turns upside down for several times (1 time/2min).Ice bath 5min immediately.The centrifugal 3min of room temperature 13000rpm.To shift in 300 μ L supernatant liquors to clean 1.5mLEP pipe and to add 150 μ L dehydrated alcohols, the heavy molten silicon dioxde solution (pH2.0) of 300 μ L6MNaI and 30 μ L.Room temperature leaves standstill 30min, and period turns upside down for several times (1 time/5min).Room temperature centrifugal 6000rpm, 1min.Abandon supernatant solution, add lavation buffer solution (10mMTris-HCl, 50mMNaCl, 5MEDTA, 50% dehydrated alcohol) 500 μ L washing precipitation.Repeated washing once.Dry 4min under being deposited in room temperature, is heavily dissolved in 95 μ L sterilizing DEPC water, adds DNA enzymatic I(RNase-freeDNaseI) and DNA enzymatic damping fluid, 25 ° of C water-bath 10min, obtain total serum IgE crude extract.
Alternately, in the quantitative detecting method of above-mentioned strawberry virus, described step (1) is specially: strawberry plants is organized in rapid grind into powder in liquid nitrogen, adds cell pyrolysis liquid, make its abundant cracking; The mixture of above-mentioned cell pyrolysis liquid and tissue grinder thing is transferred in clean centrifuge tube; Protein liquid removal and chloroform mixing is added in centrifuge tube; Centrifugal under room temperature, supernatant liquor is transferred in another clean centrifuge tube; Add isopyknic rinsing liquid, fully mix; Then mixture is joined in a centrifugal adsorbing column, centrifugal under room temperature, abandon and penetrate liquid; Add and wash post liquid, room temperature is centrifugal, abandons and penetrates liquid; Repeat to wash column operation one time.Then to dry post, room temperature is centrifugal to remove residual liquid again; RNase-freeDNaseI is joined in DNA enzymatic damping fluid and mix, join in centrifugal adsorbing column; Room temperature places 15 minutes; Directly in centrifugal adsorbing column, add enzyme liquid, mixing, 12000g(centrifugal acceleration, wherein g represents universal gravity constant) centrifugal 1 minute of room temperature, abandon and penetrate liquid.Add enzyme liquid again, centrifugal 1 minute of 12000g room temperature, abandons and penetrates liquid; Empty centrifugal 2 minutes of room temperature; Transferred to by centrifugal adsorbing column in the centrifuge tube without RNA enzyme, add RNA elutriant, room temperature places 2 minutes, centrifugal 1 minute of 12000g room temperature; Add RNA elutriant again, room temperature places 2 minutes, and centrifugal 1 minute of 12000g room temperature, in centrifuge tube, solution is total serum IgE crude extract.
Alternately, in the quantitative detecting method of above-mentioned strawberry virus, described step (1) is specially: by about 100mg plant tissue rapid grind into powder in liquid nitrogen, add 1mL cell pyrolysis liquid, vortex oscillation 40s makes its abundant cracking.The mixture of transfer 1mL cell pyrolysis liquid and tissue grinder thing moves in clean 1.5mL plastic centrifuge tube.Add in centrifuge tube on the protein liquid removal of 300 μ L and 200 μ L chloroform earthquake devices and shake 30s mixing, now solution is uniform milkiness shape.Room temperature 12000g(centrifugal acceleration, wherein g represents universal gravity constant) centrifugal 10 minutes, two is alternate with cytoclasis thing thick for the 5-10mm that has an appointment.650 μ L supernatant liquors are transferred in another clean 1.5mL plastic centrifuge tube.Add isopyknic rinsing liquid, fully put upside down mixing.Then joined by mixture in a centrifugal adsorbing column and (if can not once join in adsorption column by complete soln, please join in adsorption column at twice, be less than 700 μ L at every turn), centrifugal 1 minute of 12000g room temperature, abandons and penetrates liquid.Add 500 μ L and wash post liquid, centrifugal 1 minute of 12000g room temperature, abandons and penetrates liquid.Add 500 μ L again and wash post liquid, come again.And then centrifugal 1 minute of room temperature 12000g is to remove residual liquid.The RNase-freeDNaseI of 5 μ L is joined in 45 μ LDNA enzyme buffer liquid and mix, join in centrifugal adsorbing column.Room temperature places 15 minutes.What in centrifugal adsorbing column, directly add 0.5mL removes enzyme liquid, and after closing the lid, to mixing for several times, centrifugal 1 minute of 12000g room temperature, abandons and penetrate liquid point.What add 0.5mL again removes enzyme liquid, and centrifugal 1 minute of 12000g room temperature, abandons and penetrate liquid.Empty centrifugal 2 minutes of room temperature.Transferred to by centrifugal adsorbing column in the 1.5mL centrifuge tube without RNA enzyme, add 50 μ LRNA elutriants, room temperature places 2 minutes, centrifugal 1 minute of 12000g room temperature.Add 50 μ LRNA elutriants again, room temperature places 2 minutes, and centrifugal 1 minute of 12000g room temperature, in centrifuge tube, solution is total serum IgE crude extract.Gained crude extract can use immediately or deposit in-80 DEG C stand-by.
Alternately, in the quantitative detecting method of above-mentioned strawberry virus, described step (2) can adopt RNA purification process conventional in prior art, and its Main Function is the purity improving total serum IgE, removing polyphenol polysaccharide wherein, to ensure accuracy and the sensitivity of Viral diagnosis.As optional, described purification step is specially: in above-mentioned 100 μ L total serum IgE crude extracts, add 350 μ L solution RK, fully mix.Add 250 μ L dehydrated alcohols, fully mix, carry out next step immediately.Proceed in adsorption column by the solution of last gained together with precipitation, the centrifugal 30s of 12000rpm, discards the waste liquid in collection tube.500 μ L rinsing liquid RW are added in adsorption column CR2, after room temperature places 2min, 12000rpm, centrifugal 30s.Repeat above-mentioned rinse cycle once.Finally, the centrifugal 5min of 12000rpm, removes residual liquid.Proceeded to by adsorption column CR2 in a new centrifuge tube, add 25 μ LRNase-FreeddH2O, room temperature places 2min, 12000rpm, centrifugal 2min.Add again 25 μ LRNase-FreeddH2O, room temperature places 2min, repeats 12000rpm, centrifugal 2min.Merge the solution obtained for twice and namely obtain purified total serum IgE.Further, RNA solution 2 μ L can also be got, use ultramicron microplate spectrophotometer Epoch(BIO-TEK, the U.S.) detect concentration and the purity of RNA.
Alternately, in the quantitative detecting method of above-mentioned strawberry virus, it is that template synthesizes the method for the first chain cDNA through reverse transcription with RNA that described step (3) can adopt conventional in prior art.As optional, described reverse transcription step can be: in 1.5mLEP pipe, add about 10 μ L total serum IgE (about 1000ng) respectively, 8 μ LRNase-FreeddH2O and the hexabasic base random primer of 6 μ L (TaKaRa, Japan), and EP pipe is in 95 ° of C water-bath 5min; Ice bath 2min immediately.Add respectively in clean 1.5mLEP pipe, 1 μ LMMLV ThermoScript II (TaKaRa, Japan), 10 μ L ThermoScript II buffer, 7.5 μ LRNase-FreeddH2O, 5 μ LdNTP(2.5mM) and 2.5 μ LDTT(50mM), after 37 ° of C water-bath 10min, transfer to 42 ° of C water-bath 60min immediately; Finally be transferred to 70 ° of C water-bath 5min deactivation, namely obtain the first chain cDNA.
Alternately, in the quantitative detecting method of above-mentioned strawberry virus, described real-time fluorescence quantitative PCR amplification and detecting step are specially:
Amplification system: SYBR fluorescence dye 10 μ L, upstream primer 0.18 μ L, downstream primer 0.18 μ L, cDNA template 2 μ L, sterilizing ultrapure water 7.64 μ L;
Amplification program: 95 ° of C sex change 5min; 95 ° of C sex change 10s, 57 ° of C renaturation 10s, 72 ° of C renaturation 15s(collect fluorescent signal), 35 circulations; 95 ° of C sex change 1s, 60 ° of C renaturation 1s, 95 ° of C persistent collection fluorescent signals; 40 ° of C preserve 30s;
Adopt LightCycler 480 software (also can adopt other PCR quantitative analysis softwares) to carry out absolute quantification analysis to sample, obtain Ct value.
Alternately, in the quantitative detecting method of above-mentioned strawberry virus, described employing regular-PCR is to strawberry
actinthe step that reference gene carries out increasing and detecting is specially:
Amplification system is: cDNA2.0 μ L, Buffer2.5 μ L, MgCl22.0 μ L, FAactin-F1 upstream primer 0.25 μ L(table 2), FAactin-R1 downstream primer 0.25 μ L, Taq polysaccharase 0.5 μ L, ddH2O16 μ L;
Amplification program comprises: 95 ° of C denaturation 5min; 95 ° of C sex change 30s, 64 ° of C renaturation 40s, 72 ° of C extend 50s, amount to 35 circulations; 72 ° of C extend 7min; After 2% Agarose horizontal electrophoresis, gel imaging instrument photographic recording, observes whether occur the band (120bp) that reference gene amplified fragments is corresponding.
All features disclosed in this specification sheets, or the step in disclosed all methods or process, except mutually exclusive feature and/or step, all can combine by any way.
Beneficial effect of the present invention:
Compared with prior art, the quantitative detecting method of strawberry virus of the present invention, can carry out accurate quantification detection to strawberry virus, and highly sensitive, and cost is lower, simple to operate, easy to utilize.
accompanying drawing illustrates:
Fig. 1 is the average core acid concentration of the total serum IgE that three kinds of extracting method obtain, and wherein P1, P2, P3 represent method described in method described in embodiment 1, QIAGEN RNA isolation kit and embodiment 2 respectively.
Fig. 2 is the gel imaging photo of the sample segment of regular-PCR multiplex amplification described in embodiment 5.
The part enclosure protein gene sequence of Fig. 3 for the Sichuan of strawberry SMYEV described in embodiment 5 strain isolated and the virus isolated strain constructing system evolution tree graph of other countries.
Fig. 4 is regular-PCR described in embodiment 6 and real-time fluorescence quantitative PCR detection template threshold concentration comparison diagram.
The recombinant plasmid pMD-19-SMYEVcp that Fig. 5 contains virus coat protein gene for gradient dilution described in embodiment 7 builds SMYEVcp canonical plotting.
Fig. 6 carries out regular-PCR and real-time fluorescence quantitative PCR detected result comparison diagram respectively for two samples described in embodiment 8.
Fig. 7 is the schematic flow sheet of the quantitative detecting method of strawberry virus of the present invention.
embodiment:
Embodiment is by the following examples described in further detail foregoing of the present invention again.But this should be interpreted as that the scope of the above-mentioned theme of the present invention is only limitted to following example.Not departing from any amendment made within the spirit and principles in the present invention, and the equivalent replacement made according to ordinary skill knowledge and customary means or improvement, all should be included in protection scope of the present invention.Raw materials usedly in following examples all can to buy from the market.
embodiment 1total RNAs extraction
Get Strawberry ripening blade 0.1g, after grinding in liquid nitrogen, add 2mL grinding buffer solution (4M guanidinium isothiocyanate, 0.2M sodium-acetate, 25mMEDTA, 1 M Potassium ethanoate, 2.5%PVP-4000) and 200 μ L beta-mercaptoethanols, fully grind.100 μ L10% sarcosyls are added in transferase 10 .5mL grinding mixture to 1.5mLEP pipe.70 ° of C water-bath 10min, period turns upside down for several times (1 time/2min).Ice bath 5min immediately.The centrifugal 3min of room temperature 13000rpm.To shift in 300 μ L supernatant liquors to clean 1.5mLEP pipe and to add 150 μ L dehydrated alcohols, the heavy molten silicon dioxde solution (pH2.0) of 300 μ L6MNaI and 30 μ L.Room temperature leaves standstill 30min, and period turns upside down for several times (1 time/5min).Room temperature centrifugal 6000rpm, 1min.Abandon supernatant solution, add lavation buffer solution (10mMTris-HCl, 50mMNaCl, 5MEDTA, 50% dehydrated alcohol) 500 μ L washing precipitation.Repeated washing once.Dry 4min under being deposited in room temperature, be heavily dissolved in 95 μ L sterilizing DEPC water, add deoxyribonuclease I (RNase-freeDNaseI) and BufferRDD, 25 ° of C water-bath 10min, obtain total serum IgE crude extract.The method lower cost.
embodiment 2total RNAs extraction
By about 100mg plant tissue rapid grind into powder in liquid nitrogen, add 1mL cell pyrolysis liquid, vortex oscillation 40s makes its abundant cracking.The mixture of transfer 1mL cell pyrolysis liquid and tissue grinder thing moves in clean 1.5mL plastic centrifuge tube.Add in centrifuge tube on the protein liquid removal of 300 μ L and 200 μ L chloroform earthquake devices and shake 30s mixing, now solution is uniform milkiness shape.Centrifugal 10 minutes of room temperature 12000g, two is alternate with cytoclasis thing thick for the 5-10mm that has an appointment.650 μ L supernatant liquors are transferred in another clean 1.5mL plastic centrifuge tube.Add isopyknic rinsing liquid, fully put upside down mixing.Then joined by mixture in a centrifugal adsorbing column and (if can not once join in adsorption column by complete soln, please join in adsorption column at twice, be less than 700 μ L at every turn), centrifugal 1 minute of 12000g room temperature, abandons and penetrates liquid.Add 500 μ L and wash post liquid, centrifugal 1 minute of 12000g room temperature, abandons and penetrates liquid.Add 500 μ L again and wash post liquid, come again.And then centrifugal 1 minute of room temperature 12000g is to remove residual liquid.The RNase-freeDNaseI of 5 μ L is joined in 45 μ LDNasebuffer and mixes, join in centrifugal adsorbing column.Room temperature places 15 minutes.What in centrifugal adsorbing column, directly add 0.5mL removes enzyme liquid, and after closing the lid, to mixing for several times, centrifugal 1 minute of 12000g room temperature, abandons and penetrate liquid point.What add 0.5mL again removes enzyme liquid, and centrifugal 1 minute of 12000g room temperature, abandons and penetrate liquid.Empty centrifugal 2 minutes of room temperature.Transferred to by centrifugal adsorbing column in the 1.5mL centrifuge tube without RNA enzyme, add 50 μ LRNA elutriants, room temperature places 2 minutes, centrifugal 1 minute of 12000g room temperature.Add 50 μ LRNA elutriants again, room temperature places 2 minutes, and centrifugal 1 minute of 12000g room temperature, in centrifuge tube, solution is total serum IgE crude extract.Gained crude extract can use immediately or deposit in-80 DEG C stand-by.The method agents useful for same all comes from CHMC's ocean test kit.
comparative example
The method described in operation instruction respectively according to QIAGEN test kit extracts the total serum IgE of Strawberry ripening blade.
Respectively Example 1, each 2 μ L of 3 kinds of total rna solutions that described in embodiment 2 and this comparative example, method obtains, use ultramicron microplate spectrophotometer Epoch(BIO-TEK, the U.S.) detect the concentration of RNA.
Result is as shown in Figure 1: approximately 0.1g mature leaf is parent material, and the average core acid concentration that three kinds of extracting method obtain is 171ng/ μ L(embodiment 1), 53ng/ μ L(QIAGEN RNA isolation kit) and 288ng/ μ L(embodiment 2).The total rna concentration that method described in comparative example is extracted is lower, is unfavorable for carrying out follow-up pcr amplification reaction efficiently.And the total serum IgE that method described in embodiment 1 and 2 is extracted all has higher concentration, and the needs of subsequent PCR amplification reaction can be met.
embodiment 3purifying
Get in the total serum IgE crude extract obtained in 100 μ L embodiments 1 or 2, add 350 μ L solution RK, fully mix.Add 250 μ L dehydrated alcohols, fully mix, carry out next step immediately.Proceed in adsorption column by the solution of last gained together with precipitation, the centrifugal 30s of 12000rpm, discards the waste liquid in collection tube.500 μ L rinsing liquid RW are added in adsorption column CR2, after room temperature places 2min, 12000rpm, centrifugal 30s.Repeat above-mentioned rinse cycle once.Finally, the centrifugal 5min of 12000rpm, removes residual liquid.Proceeded to by adsorption column CR2 in a new centrifuge tube, add 25 μ LRNase-FreeddH2O, room temperature places 2min, 12000rpm, centrifugal 2min.Add again 25 μ LRNase-FreeddH2O, room temperature places 2min, repeats 12000rpm, centrifugal 2min.Merge the solution obtained for twice and namely obtain purified total serum IgE.Further, RNA solution 2 μ L can also be got, use ultramicron microplate spectrophotometer Epoch(BIO-TEK, the U.S.) detect concentration and the purity of RNA.Agents useful for same is purchased from TIANGEN Biotech (Beijing) Co., Ltd..
embodiment 4reverse transcription
In 1.5mLEP pipe, add the total serum IgE (about 1000ng) of preparation in about 10 μ L embodiments 3 respectively, 8 μ LRNase-FreeddH2O and the hexabasic base random primer of 6 μ L (TaKaRa, Japan), EP pipe is in 95 ° of C water-bath 5min; Ice bath 2min immediately.Add respectively in clean 1.5mLEP pipe, 1 μ LMMLV ThermoScript II (TaKaRa, Japan), 10 μ L ThermoScript II buffer, 7.5 μ LRNase-FreeddH2O, 5 μ LdNTP(2.5mM) and 2.5 μ LDTT(50mM), after 37 ° of C water-bath 10min, transfer to 42 ° of C water-bath 60min immediately; Finally be transferred to 70 ° of C water-bath 5min deactivation, namely obtain the first chain cDNA.
embodiment 5
1) regular-PCR multiplex amplification strawberry
actinfor reference gene and SMYEV coat protein gene
The cp amplification system of SMYEV is: cDNA2.0 μ L, Buffer2.5 μ L, MgCl
22.0 μ L, FAactin-F1 upstream primer 0.25 μ L(tables 1), FAactin-R1 downstream primer 0.25 μ L, SMYEV-CP1 upstream primer 0.5 μ L, SMYEV-CP2 downstream primer 0.5 μ L, Taq polysaccharase 0.5 μ L, ddH2O16 μ L.
PCR(BIO-RAD, U.S.) amplification program comprises: 95 ° of C denaturation 5min; 95 ° of C sex change 30s, 64 ° of C renaturation 40s, 72 ° of C extend 50s, amount to 35 circulations; 72 ° of C extend 7min.After 2% Agarose horizontal electrophoresis, gel imaging instrument photographic recording.
Utilize above-mentioned regular-PCR multiplex amplification method, respectively SMYEV amplification has been carried out to the total serum IgE of the mature leaf of different varieties sample (see table 1).As shown in Figure 2, M in figure, 1,2 and 3 represents DL500marker to partial results respectively, sample 25-3,3-1 and negative control.The virus amplification target stripe (380bp) shown in arrow by the top in figure, namely sample 3-1 has infected this virus.In addition, sample 25-3 only obtains strawberry actin reference gene amplified fragments (120bp) (band shown in arrow locations on the lower), and namely sample 25-3 does not infect SMYEV.Visible regular-PCR augmentation detection technology can only detect sample qualitatively and whether infect virus, or carries out relative quantification by the brightness of the target stripe that increases, and cannot realize absolute quantitation accurately and detect.
Table 1
| Sample number into spectrum | Sample description |
| Sample 25-2 | Infect strawberry " beauty " kind of a small amount of virus, be colonizated in base, new capital, academy of agricultural sciences |
| Sample 25-3 | Strawberry " beauty " kind of uninfecting virus, is colonizated in base, new capital, academy of agricultural sciences |
| Sample 3-1 | Strawberry " a chapter Ji " kind, is colonizated in base, new capital, academy of agricultural sciences |
| Sample 1-8 | Strawberry " Feng Xiang " kind, is colonizated in base, new capital, academy of agricultural sciences |
2) strawberry SMYEV coat protein gene phyletic evolution research
Utilize gel recovery test kit (OMEGA, the U.S.) to reclaim the amplified fragments of about 400bp of SMYEV respectively, and be connected into cloning vector pMD-19T(TaKaRa, Dalian).Universal primer checks order and uses DNAStar software to carry out sequential analysis, obtains the part enclosure protein gene sequence of SMYEV, as shown in SEQIDNO.1.DNAMAN analyzes the virus isolated strain nucleic acid sequence homology of different geographic origin.Mega3.1 (CenterforEvolutionaryFunctionalGenomics) software adopts adjacent method (Neighbor-Joining) and sets the confidence level of the bootstrap assessment genetic distance branch of 1000 repetition values, builds the systematic evolution tree of different geographic origin strain isolated.The SMYEV Coat protein gene sequence (AJ577359, D12517, N003794 and Y13938) that U.S.'s Biotechnology Information center (NCBI) nucleic acid database downloads different geographical isolates carries out the systematic evolution tree research of virus sequence.Result is as shown in Figure 3: cloned by the amplified production of the part enclosure protein gene to SMYEV virus Sichuan strain isolated (YE8-3).Respectively multiple ratio pair is carried out to the coat protein gene partial nucleic acid sequence of the SMYEV virus of different geographic origin, between each strain isolated, there is high homology, SMYEV Sichuan strain isolated and AJ577359 and Y13938(Germany strain isolated) in a cluster group (Fig. 3), there is between 5 strain isolateds the similarity of 93.49%.Therefore, the part enclosure protein gene sequence (SEQIDNO.1) of SMYEV of the present invention may be used for the detection of the SMYEV virus with different geographical source as target gene to be amplified, applied widely.
embodiment 6
The cDNA of 1-8 sample (strawberry " Feng Xiang " kind is colonizated in base, new capital, academy of agricultural sciences) is diluted 10 respectively
-1, 10
-2, 10
-3, 10
-4, 10
-5, 10
-6doubly, the template cDNA after often kind of dilution carries out real-time fluorescence quantitative PCR amplification and the regular-PCR amplification of SMYEV coat protein gene respectively.
Described real-time fluorescence quantitative PCR amplification and detecting step are specially:
Amplification system: SYBR fluorescence dye 10 μ L, upstream primer SMYEVcp-F30.18 μ L, downstream primer SMYEVcp-R60.18 μ L, cDNA template 2 μ L, sterilizing ultrapure water 7.64 μ L;
Amplification program: 95 ° of C sex change 5min; 95 ° of C sex change 10s, 57 ° of C renaturation 10s, 72 ° of C renaturation 15s(collect fluorescent signal), 35 circulations; 95 ° of C sex change 1s, 60 ° of C renaturation 1s, 95 ° of C persistent collection fluorescent signals; 40 ° of C preserve 30s;
Adopt LightCycler 480 software (also can adopt other PCR quantitative analysis softwares) to carry out sample analyzing the amplification curve obtaining each sample, result as shown in Figure 4 A.
Described regular-PCR increases to SMYEV coat protein gene and the step that detects is specially:
Amplification system is: cDNA2.0 μ L, Buffer2.5 μ L, MgCl22.0 μ L, SMYEV-CP1 upstream primer 0.5 μ L, SMYEV-CP2 downstream primer 0.5 μ L, Taq polysaccharase 0.5 μ L, ddH2O16 μ L;
Amplification program comprises: 95 ° of C denaturation 5min; 95 ° of C sex change 30s, 64 ° of C renaturation 40s, 72 ° of C extend 50s, amount to 35 circulations; 72 ° of C extend 7min; After 2% Agarose horizontal electrophoresis, gel imaging instrument photographic recording, result as shown in Figure 4 B.
Dilution 10
-1(in Fig. 4 A 1), 10
-2(in Fig. 4 A 2) sample cDNA is doubly template, and fluorescent quantitative PCR curve, in 35 circulations, take-off occurs.In addition, 10 are diluted
-3cDNA is doubly that faint take-off (Fig. 4 A) occurs template.By comparison comparatively, regular-PCR amplification SMYEV coat protein gene, in 35 circulations, only has dilution 10
-1sample is doubly template, and amplification obtains the fragment (Fig. 4 B) of expection molecular size.This illustrates that the detection sensitivity of quantitative fluorescent PCR is greater than regular-PCR and detects more than 10 times.
embodiment 7
Build the recombinant plasmid pMD-19-SMYEVcp of the part enclosure protein gene sequence (SEQIDNO.1) of the SMYEV of Sichuan strain isolated.Respectively to be diluted to the standard substance of 1.57pg/uL, 0.79pg/uL, 0.39pg/uL and 0.20pg/uL for amplification template, RealtimePCR amplification SMYEV coat protein gene.Finally, obtaining the Ct value of four standard substance is respectively: 24.61,25.84,27.41 and 28.71(Fig. 5 A).The linear regression analysis of EXCEL software, obtains Y=-0.3229X+9.3399, R2=0.91(Fig. 5 B).1-8 sample cDNA is template, and obtaining its Ct value is 26.18.No. 1-8 can be calculated by regression equation and infect SMYEV concentration 0.886378pg/uL, i.e. 288022 copy/uL((SMYEV concentration/5699*324) * 6*10
11).The detection virus concentration that can be calculated Ct value=28.71 correspondence by regression equation and reduction formula is 22564 copy/uL.Theoretically, as long as strawberry has infected the SMYEV virus more than 20000 copy/uL, present method can be utilized to carry out accurate quantitative analyses (to be greater than and the Ct value equaling 30 is all defaulted as 30, the ultimate value that therefore accurate quantification to template concentrations of Roche fluorescent PCR instrument detects is Ct=29 to LightCycler 480 software).As long as the take-off in 35 circulations of sample to be tested hiv target gene amplification Ct value is all considered to infected positive plant.
embodiment 8
Two, by the strawberry sample of SMYEV virus infection, utilize regular-PCR and real-time fluorescence quantitative PCR to detect respectively.Fig. 6 A regular-PCR amplification show two samples reference gene (
actin) amplification concentration consistent, and in 25-2 sample viral template concentration lower than 1-8 sample (the coat protein gene amplified band concentration of SMYEV has significant difference).RealtimePCR detected result shows that the goal gene (SMYEV coat protein gene) of 1-8 sample is for amplification template first take-off (Ct=26.18) (in Fig. 6 B 2), 25-2 sample of comparing is that the Ct value of the fluorescent quantitation amplification of template to be greater than in 30(Fig. 6 B 1), namely the accumulation volume of 1-8 sample inner virus is higher than 25-2 sample (Fig. 6 B).Can calculate No. 1-8 infection SMYEV concentration by regression equation is probably: 288022 copy/uL.This also demonstrates the result of regular-PCR Fig. 6 A.Therefore, the accuracy that real-time fluorescence quantitative PCR detects is the same with regular-PCR, but sensitivity wants high more than 10 times, simultaneously can the content of virus in detection by quantitative sample.
embodiment 9reference gene is verified
Especially adopt above-mentioned real-time fluorescence quantitative PCR detected result to be negative sample for testing sample, following reference gene verification operation can also be carried out.
Reference gene verification step, is specially: with the cDNA of the same batch of sample obtained for template, with strawberry
actinas reference gene, add the upstream and downstream primer corresponding with reference gene, adopt regular-PCR or real-time fluorescence quantitative PCR to increase, the described upstream and downstream primer corresponding with reference gene is respectively:
Upstream primer FAactin-F1:GTATGGTCAAGGCTGGGTTTGCTGG;
Downstream primer FAactin-R1:CGTCACCGACATAAGCATCTTTCTG.
When adopting regular-PCR to carry out reference gene checking, the regular-PCR multiplex amplification method described in embodiment 5 can be adopted, namely in amplification system, add reference gene primer pair and virus coat protein gene primer pair simultaneously; Or also in amplification system, only can add reference gene primer pair.
When adopting real-time fluorescence quantitative PCR to carry out reference gene checking, preferably identical with when adopting real-time fluorescence quantitative PCR to carry out increasing to coat protein gene amplification system and amplification program, only need replace to the corresponding primer pair of reference gene by the primer pair in amplification system.
Above in each embodiment the amplimer of different goal gene to as shown in table 2.
The amplimer pair of the different goal gene of table 2
The foregoing is only the preferred embodiments of the present invention, is only illustrative for the purpose of the present invention, and nonrestrictive; Those of ordinary skill in the art understand, and can carry out many changes in the spirit and scope that the claims in the present invention limit to it, amendment, and even equivalence is changed, but all will fall into protection scope of the present invention.
<110> Horticultural Research Institute, Sichuan Academy of Agricultural Sciences
The quantitative detecting method of a <120> strawberry virus
<130>2014
<160>5
<170>PatentInversion3.3
<210>1
<211>378
<212>DNA
The nucleotide sequence of the part enclosure protein gene of the SMYEV of <213> Sichuan strain isolated
<400>1
aatgggctctacaccgccggtcttgcccggccgcaccctgaatccgaatgtgaacgtcgc60
caatcaagttggtgaccctttccgggtgctcactcctgaggaacttgctgctccgatcgc120
tgctgccagtaataaggtggccacccgcgagcagataatccaaattgtcgctgatctgaa180
cgccttgggcttcgtcggggatccagctctgggtctcttcgacttagccttccactgcta240
cgacattggttcctcgccctcggcacaacctgttggtgcttccccttttggctgctcgcg300
catgcaagttgccgccgtcgtccgaaatcattgcacgcttcgccagctctgcatgttcta360
cgccccaagcgtctggaa378
Claims (10)
1. a quantitative detecting method for strawberry virus, is characterized in that, comprises the following steps:
(1) strawberry total serum IgE is extracted;
(2) purification process is carried out to the RNA extracted in step (1);
(3) the first chain cDNA is synthesized in reverse transcription;
(4) with the cDNA obtained in step (3) for template, add the upstream and downstream primer corresponding with the coat protein gene of virus to be detected, Real-Time Fluorescent Quantitative PCR Technique is adopted to carry out increasing and obtain hiv target gene amplification Ct value in testing sample, reference standard curve, can in the hope of the infected virus concentration of testing sample.
2. quantitative detecting method according to claim 1, it is characterized in that, described virus to be detected is strawberry light yellow edge virus (SMYEV), and the upstream and downstream primer sequence corresponding with the coat protein gene of this virus used in described real-time fluorescence quantitative PCR amplification is respectively:
Upstream primer SMYEVcp-F3:CGCTGCTGCCAGTAATAAGG;
Downstream primer SMYEVcp-R6:CGAGGGCGAGGAACCAAT.
3. quantitative detecting method according to claim 2, is characterized in that, the regression equation of described typical curve is Y=-0.3229X+9.3399, R
2=0.91, wherein X represents Ct value, and Y represents the mass concentration of virus, and its unit is pg/uL.
4. quantitative detecting method according to claim 1, it is characterized in that, described typical curve preparation method be respectively with at least four kinds of concentration known containing virus coat protein gene recombinant plasmid for template, adopt the upstream and downstream primer identical with step (4) and identical real-time fluorescence quantitative PCR amplification condition, obtain Ct value corresponding to different templates concentration respectively, then make Ct value-virus concentration typical curve.
5. quantitative detecting method according to claim 1, is characterized in that, also comprises reference gene verification step, be specially in described method: with the cDNA obtained in step (3) for template, with strawberry
actinas reference gene, add the upstream and downstream primer corresponding with reference gene, adopt regular-PCR or real-time fluorescence quantitative PCR to carry out increasing and detecting, the upstream and downstream primer that described reference gene is corresponding is respectively:
Upstream primer FAactin-F1:GTATGGTCAAGGCTGGGTTTGCTGG;
Downstream primer FAactin-R1:CGTCACCGACATAAGCATCTTTCTG.
6. quantitative detecting method according to claim 1, is characterized in that, described step (1) is specially: get Strawberry ripening blade, after grinding, adds grinding buffer solution and beta-mercaptoethanol, fully grinds in liquid nitrogen; Grinding mixture to be transferred in EP pipe and to add 10% sarcosyl; 70 ° of C water-bath 10min, turn upside down for several times therebetween; Ice bath 5min immediately; Centrifugal under room temperature; Dehydrated alcohol, NaI and heavy molten silicon dioxde solution is added in transfer supernatant liquor to clean EP pipe; Room temperature leaves standstill 30min, and period turns upside down for several times, centrifugal under room temperature; Abandon supernatant solution, add lavation buffer solution washing precipitation; Repeated washing once; Dry 4min under being deposited in room temperature, is heavily dissolved in sterilizing DEPC process water, adds DNA enzymatic I(RNase-freeDNaseI) and DNA enzymatic damping fluid, 25 ° of C water-bath 10min, obtain total serum IgE crude extract.
7. quantitative detecting method according to claim 1, is characterized in that, described step (1) is specially: strawberry plants is organized in rapid grind into powder in liquid nitrogen, adds cell pyrolysis liquid, make its abundant cracking; The mixture of above-mentioned cell pyrolysis liquid and tissue grinder thing is transferred in clean centrifuge tube; Protein liquid removal and chloroform mixing is added in centrifuge tube; Room temperature is centrifugal, is transferred to by supernatant liquor in another clean centrifuge tube; Add isopyknic rinsing liquid, fully mix; Then joined by mixture in a centrifugal adsorbing column, room temperature is centrifugal, abandons and penetrates liquid; Add and wash post liquid, room temperature is centrifugal, abandons and penetrates liquid; Repeat to wash column operation one time; And then room temperature is empty centrifugal to remove residual liquid; RNase-freeDNaseI is joined in DNA enzymatic damping fluid and mix, join in centrifugal adsorbing column; Room temperature places 15 minutes; Directly in centrifugal adsorbing column, add enzyme liquid, mixing, room temperature is centrifugal, abandons and penetrates liquid; Add enzyme liquid again, room temperature is centrifugal, abandons and penetrates liquid; Room temperature sky is centrifugal; Transferred to by centrifugal adsorbing column in the centrifuge tube without RNA enzyme, add RNA elutriant, room temperature places 2 minutes, and room temperature is centrifugal; Add RNA elutriant again, room temperature places 2 minutes, and room temperature is centrifugal, merges the solution that twice wash-out obtain and is total serum IgE crude extract.
8., for the strawberry method for extracting total RNA that strawberry Viral Quantification detects, it is characterized in that, concrete steps are as follows: get Strawberry ripening blade, after grinding, add grinding buffer solution and beta-mercaptoethanol, fully grind in liquid nitrogen; Grinding mixture to be transferred in EP pipe and to add 10% sarcosyl; 70 ° of C water-bath 10min, turn upside down for several times therebetween, 1 time/2min; Ice bath 5min immediately; The centrifugal 3min of room temperature 13000rpm; Dehydrated alcohol, NaI and heavy molten silicon dioxde solution is added in transfer supernatant liquor to clean EP pipe; Room temperature leaves standstill 30min, and period turns upside down for several times, 1 time/5min, room temperature centrifugal 6000rpm, 1min; Abandon supernatant solution, add lavation buffer solution washing precipitation; Repeated washing once; Dry 4min under being deposited in room temperature, is heavily dissolved in sterilizing DEPC water, adds DNA enzymatic I(RNase-freeDNaseI) and DNA enzymatic damping fluid, 25 ° of C water-bath 10min, obtain total serum IgE crude extract.
9., for the virus coat protein gene primer sequence that strawberry Viral Quantification detects, it is characterized in that, comprise upstream primer and downstream primer, its sequence is respectively:
Upstream primer SMYEVcp-F3:CGCTGCTGCCAGTAATAAGG;
Downstream primer SMYEVcp-R6:CGAGGGCGAGGAACCAAT.
10. the strawberry detected for strawberry Viral Quantification
actinreference gene primer sequence, is characterized in that, comprises upstream primer and downstream primer, and its sequence is respectively:
Upstream primer FAactin-F1:GTATGGTCAAGGCTGGGTTTGCTGG;
Downstream primer FAactin-R1:CGTCACCGACATAAGCATCTTTCTG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410594988.9A CN105463128A (en) | 2014-10-30 | 2014-10-30 | Quantitative detection method for strawberry viruses |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410594988.9A CN105463128A (en) | 2014-10-30 | 2014-10-30 | Quantitative detection method for strawberry viruses |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105463128A true CN105463128A (en) | 2016-04-06 |
Family
ID=55601281
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410594988.9A Pending CN105463128A (en) | 2014-10-30 | 2014-10-30 | Quantitative detection method for strawberry viruses |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105463128A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113073145A (en) * | 2021-03-26 | 2021-07-06 | 山西巨鑫伟业农业科技开发有限公司 | Method for rapidly judging whether strawberry plants are infected with main viruses or not |
| CN113684319A (en) * | 2021-09-18 | 2021-11-23 | 上海市农业科学院 | Specific nucleic acid sequence for rapidly detecting strawberry mild yellow edge virus, and amplification primer, kit and method thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009061215A1 (en) * | 2007-11-05 | 2009-05-14 | The New Zealand Institute For Plant And Food Research Limited | Compositions and methods for altering pigment production in plants |
| CN101638651A (en) * | 2009-07-09 | 2010-02-03 | 昆明理工大学 | Method for extracting total RNA from plant tissue rich in polysaccharides and polyphenols and secondary metabolites |
| WO2012032785A1 (en) * | 2010-09-10 | 2012-03-15 | 独立行政法人農業・食品産業技術総合研究機構 | Method for detecting pathogen candidatus phlomobacter fragariae causative of strawberry marginal chlorosis |
-
2014
- 2014-10-30 CN CN201410594988.9A patent/CN105463128A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009061215A1 (en) * | 2007-11-05 | 2009-05-14 | The New Zealand Institute For Plant And Food Research Limited | Compositions and methods for altering pigment production in plants |
| CN101638651A (en) * | 2009-07-09 | 2010-02-03 | 昆明理工大学 | Method for extracting total RNA from plant tissue rich in polysaccharides and polyphenols and secondary metabolites |
| WO2012032785A1 (en) * | 2010-09-10 | 2012-03-15 | 独立行政法人農業・食品産業技術総合研究機構 | Method for detecting pathogen candidatus phlomobacter fragariae causative of strawberry marginal chlorosis |
Non-Patent Citations (2)
| Title |
|---|
| J.CUBERO ET AL: "Detection of Strawberry Pathogens by Real-Time PCR", 《ACTA HORTIC》 * |
| 于翠梅等: "草莓轻型黄边病毒CP基因的克隆、序列分析及原核表达", 《华北农学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113073145A (en) * | 2021-03-26 | 2021-07-06 | 山西巨鑫伟业农业科技开发有限公司 | Method for rapidly judging whether strawberry plants are infected with main viruses or not |
| CN113073145B (en) * | 2021-03-26 | 2023-06-30 | 山西巨鑫伟业农业科技开发有限公司 | Method for rapidly judging whether strawberry plants are infected with main viruses |
| CN113684319A (en) * | 2021-09-18 | 2021-11-23 | 上海市农业科学院 | Specific nucleic acid sequence for rapidly detecting strawberry mild yellow edge virus, and amplification primer, kit and method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Muller et al. | High molecular variability of sugarcane bacilliform viruses in Guadeloupe implying the existence of at least three new species | |
| CN102230027B (en) | Method for synchronous detection of sweet potato feathery mottle virus (SPFMV), sweet potato virus C (SPVC), sweet potato virus G (SPVG) and sweet potato virus 2 (SPV2) | |
| CN103409547B (en) | The Real-time detection method of abundance of nirK gene and application thereof in fluitante root system surface attachment denitrifying bacteria | |
| Cosseddu et al. | Characterization of peste des petits ruminants virus, Eritrea, 2002–2011 | |
| CN104928397B (en) | Cowpea phytophthora PCR detection primers and its detection method | |
| Bruisson et al. | Comparative detection of a large population of grapevine viruses by TaqMan® RT-qPCR and ELISA | |
| Rana et al. | Molecular variability analyses of Apple chlorotic leaf spot virus capsid protein | |
| CN101643788B (en) | Detection primer of potato late blight bacterium molecules and use method thereof | |
| Komatsu et al. | Isolation and characterization of a novel mycovirus infecting an edible mushroom, Grifola frondosa | |
| CN104178585A (en) | Potato virus detection primers and potato virus detection method | |
| CN105463128A (en) | Quantitative detection method for strawberry viruses | |
| Lan et al. | Complete genome sequence of a divergent strain of Japanese yam mosaic virus from China | |
| CN107130057B (en) | Detect rice black-streaked dwarf virus and the RT PCR of southern rice black-streaked dwarf virus and its application | |
| CN106282415A (en) | A kind of method utilizing molecular marker quickly to detect Summer squash virus | |
| Alvarez-Quinto et al. | Evidence that an unnamed isometric virus associated with potato rugose disease in Peru is a new species of genus Torradovirus | |
| CN103849691A (en) | Sweet potato virus detection primers and method | |
| CN105695626A (en) | RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primer and method for detecting pepper vein yellows virus (PeVYV) | |
| CN110951917A (en) | RNA-RP RT-PCR method for rapidly detecting melon viruses | |
| Pordel et al. | A reappraisal of the Pyriculariaceae in Iran | |
| Shevchenko et al. | The first evidence of subgroup IB isolates of Cucumber mosaic virus in Ukraine | |
| Terlizzi et al. | Detection and molecular characterization of Italian Grapevine rupestris stem pitting‐associated virus isolates | |
| Budzanivska et al. | Epidemiology of sharka disease in Ukraine | |
| CN106434879A (en) | Method for quickly and efficiently detecting different strain mating types of cordyceps militaris | |
| CN101487059A (en) | PCR primer for banana streak virus detection method and detection kit thereof | |
| CN105256047A (en) | Locked nucleotide sensitized real-time fluorescent quantitative PCR (polymerase chain reaction) detection method for detecting colonization quantity of phytophthora parasitica in tobacco planting soil |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160406 |
|
| RJ01 | Rejection of invention patent application after publication |