CN105463115B - For detecting probe, primer and the kit of 7 kinds of mankind RET gene mutation - Google Patents
For detecting probe, primer and the kit of 7 kinds of mankind RET gene mutation Download PDFInfo
- Publication number
- CN105463115B CN105463115B CN201610025142.2A CN201610025142A CN105463115B CN 105463115 B CN105463115 B CN 105463115B CN 201610025142 A CN201610025142 A CN 201610025142A CN 105463115 B CN105463115 B CN 105463115B
- Authority
- CN
- China
- Prior art keywords
- seq
- probe
- primer
- mutation
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses probe, primer and the kits for detecting 7 kinds of mankind RET gene mutation, wherein 7 groups of primer and probes of RM1~RM7, the its corresponding mutant nucleotide sequence specific binding of upstream ARMS primer energy is mutated in every group, mutant nucleotide sequence is expanded, mutation downstream primer can be in conjunction with RET gene conserved sequence；Detection probe can in conjunction with amplified fragments, block probe can the specific binding of corresponding with mutational site wild-type sequence, inhibit wild type non-specific amplification.The present invention uses specific mutation primers and probe interrupter technique, can accurately detect 7 kinds of mutation types of RET gene；The convenient quick detection to RET gene mutation of the kit of the real-time fluorescent PCR amplification reaction system of foundation, it is easy to operate, it is as a result readable；Detection method high sensitivity, 50 copy mutation can stablize detection；Specificity is good, and for 20ng wild type gene group DNA without non-specific amplification, detectability is up to 1%.
Description
Technical field
The present invention relates to field of biotechnology, more particularly to a kind of for detecting the spy of 7 kinds of mankind RET gene mutation
Needle, primer and kit.
Background technique
Medullary carcinoma of thyroid gland (med μ Llary thyroid carcinoma) is not actually thyroid cancer, it is derived from
The parafollicular cell (also known as C cell) for secreting calcitonin is neuroendocrine cell and thyroid follicular cells without
It closes.Nineteen fifty-nine proposes that it only accounts for thyroid tumors sub-fraction as a separate clinic histological type by Hazand etc. first
(accounting for about 3~12%), morbidity, all unique feature of diagnosing and treating.According to whether having heredity, MTC can be divided into sporadic
With heredity two major classes: 1. sporadic MTC: it is clinically most common, account for about the 75~80% of MTC, mostly person in middle and old age, women is slightly
It is more；2. heredity MTC (MEN2): it is clinically more rare, account for about 20~25% (1~10/,100,000) of MTC, age of onset relatively dissipates
Hair property MTC shifts to an earlier date 10~20 years or so, men and women's disease incidence indifference, can have simultaneously or successively more people's illness in a family.
It is subdivided into following 3 seed type:
1, MTC, thermophilic can occur simultaneously for multiple endocrine neoplasia 2A (MEN2A): Zhan Suoyou heredity MTC 80%, this type
Chromium cytoma and parathyroid hyperplasia；2, multiple endocrine neoplasia 2B (MEN2B): multiple with mucous membrane without disease of parathyroid glands
It is that the highest type of grade malignancy in heredity MTC is (normal with the characteristics of nerve tumor is with MTC and (or) Adrenal Pheochromocytoma
Occurred before 5 years old；5%ofMEN2)；3, the non-multiple endocrine neoplasia MTC (FMTC) of family: this type is considered as
A kind of variation type of MEN2A, MTC are its unique features, are the types that grade malignancy is minimum in heredity MTC.
2 type of MEN,muitiple endocrine neoplasms (MEN2), also known as Sipple syndrome, by U.S. clinical doctor Sipple in 1961
Year describes first, is autosomal dominant disease, genepenetrance is high, disease incidence about 1/30000, according to different clinical tables
It is existing, it is clinical to divide MEN2 for 3 kinds of hypotypes: MEN2A, MEN2B and familial medullary thyroid cancer (FMTC, Familiar Med μ
Llary Thyroid Carcinoma).Wherein that the most common is MEN2A, accounts for about the 75% of MEN2, with medullary carcinoma of thyroid gland
It (MTC) is main clinical manifestation, medullary carcinoma of thyroid gland occurs in about 90% MEN2A carrier, and about 50% with pheochromocytoma
(PCC, Pheochromocytoma), 20%~30% there is parathyroid hyperplasia or adenoma；MEN2B is the three types of MEN2
PHPT does not occur for middle grade of malignancy highest and most rare type, MEN2B, but has special developmental defect: as muscle skeleton is abnormal
Shape (all figures of horse, talipes cavus, chonechondrosternon, muscle weakness proximal), lip portion mucosal neuroma, Die Gastrointestinale Manifestation such as vomiting, dehydration,
Difficulty with feeding, intestinal obstruction etc..
Caused by the pathogenesis system ret proto-oncogene (RET) of MEN2 mutates.RET is a single-stranded film of wearing containing tyrosine
The albumen of kinases, the expression in many cells (such as thyroid gland, adrenal gland, enteral portion nerveous system) originating from neural crest,
Body developmentally plays an important role.It is characterized in being populated with multiple half at its extracellular part closely cell membrane in RET structure
Cystine, a tyrosine kinase section is then contained in part in the cell.
MEN 2A patient RET gene is predominantly located at cysteine at extracellular nearly film with the presence of mutation, can be prominent for missense
The missing or insertion of change or small DNA fragmentation, all involve cysteine above-mentioned.Familial medullary thyroid cancer patient is often
Cysteine mutation in MEN 2A can be detected, in addition there are some other amino acid mutations.The RET gene mutation of MEN 2B patient
The amino acid not being related in the cysteine and familial medullary thyroid cancer in MEN 2A, the above are first sulphur for 95% be mutated
Propylhomoserin Met 918 becomes threonine (M918T).
For detection genotype patient earlier, American Thyroid Association (ATA) recommends to suffer from all medullarys carcinoma of thyroid gland
Person carries out RET genetic test, to distinguish heredity or sporadic patient, so that heredity MTC patient is found ahead of time, controls in early days
It treats, so that patient is more benefited.
The method of detection gene mutation at present mainly has PCR sequencing PCR, solubility curve method and Luminex.Direct Sequencing
Sensitivity is low, and detection sensitivity only has 20~30%；Experimental implementation is complicated, and detection efficiency is low, sample is easy to pollute, usually wants 1-2
Talent can go out testing result.Especially for the detection of small sample, the method for direct Sequencing almost cannot achieve its accurate detection,
It will lead to a large amount of missing inspections and the generation of false negative.But regardless of being dyestuff solubility curve or probe solubility curve method, can not all have
Effect distinguishes the various mutations type in same site.Luminex operating process is complicated, and is easy pollution, and false positive rate is high.
Summary of the invention
In order to solve, existing RET detection method of gene mutation detection efficiency is low, sample is easy to pollute, detection time is long, quasi-
The problems such as really property is poor, discrimination is difficult, the present invention provides the primer and probes for detecting 7 kinds of mankind RET gene mutation.This
Invention additionally provides the kit containing the primer and probe, realizes the quick and precisely detection in unlimited place.
Provided by the present invention for the primer and probe of 7 kinds of mankind RET gene mutation of detection, nucleotide sequence is as follows:
RM1:M918T mutation
It is mutated upstream ARMS primer RM1-F:SEQ ID NO:1,
It is mutated downstream primer RW1-R:SEQ ID NO:2,
Detection probe RW1-P:SEQ ID NO:3,
Block probe RW1-B:SEQ ID NO:4；
RM2:C634R mutation
It is mutated upstream ARMS primer RM2-F:SEQ ID NO:5,
It is mutated downstream primer RW2-R:SEQ ID NO:11,
Detection probe RW2-P:SEQ ID NO:12,
Block probe RW2-B:SEQ ID NO:13；
RM3:C634G mutation
It is mutated upstream ARMS primer RM3-F:SEQ ID NO:6,
It is mutated downstream primer RW2-R:SEQ ID NO:11,
Detection probe RW2-P:SEQ ID NO:12,
Block probe RW2-B:SEQ ID NO:13；
RM4:C634S mutation
It is mutated upstream ARMS primer RM4-F:SEQ ID NO:7,
It is mutated downstream primer RW2-R:SEQ ID NO:11,
Detection probe RW2-P:SEQ ID NO:12,
Block probe RW2-B:SEQ ID NO:13；
RM5:C634F mutation
It is mutated upstream ARMS primer RM5-F:SEQ ID NO:8,
It is mutated downstream primer RW2-R:SEQ ID NO:11,
Detection probe RW2-P:SEQ ID NO:12,
Block probe RW2-B:SEQ ID NO:13；
RM6:C634Y mutation
It is mutated upstream ARMS primer RM6-F:SEQ ID NO:9,
It is mutated downstream primer RW2-R:SEQ ID NO:11,
Detection probe RW2-P:SEQ ID NO:12,
Block probe RW2-B:SEQ ID NO:13；
RM7:C634W mutation
It is mutated upstream ARMS primer RM7-F:SEQ ID NO:10,
It is mutated downstream primer RW2-R:SEQ ID NO:11,
Detection probe RW2-P:SEQ ID NO:12,
Block probe RW2-B:SEQ ID NO:13；
Wherein, the end of nucleotide sequence 5 ' of the detection probe is marked with fluorophor, and 3 ' ends are marked with quenching group；Resistance
The end of nucleotide sequence 5 ' of disconnected probe is modified by double deoxidation, and 3 ' ends are marked with quenching group.
Preferably, above-mentioned for detecting the primer and probe of 7 kinds of mankind RET gene mutation, the fluorophor is FAM,
The quenching group is MGB.MGB (Minor Groove Binder) group can with DNA spiral minor groove binding, and then improve MGB
The hybridization stability of probe and corresponding templates (Tm value improves about 10 DEG C).Relative to general T aqMan probe, MGB probe sequence can
It is designed shorter, specificity is stronger.
17 kinds of hot spot mutations of mankind RET gene of table
Above-mentioned primer is to be mutated the specific primer detected for 7 kinds listed by table 1, wherein mutation upstream ARMS
Primer, can its corresponding mutational site sequence-specific combine, selective amplification mutant nucleotide sequence；Being mutated downstream primer can
In conjunction with RET gene conserved sequence；Detection probe can block probe can open country corresponding with mutational site in conjunction with amplified fragments
Raw type sequence-specific combines, and inhibits wild type non-specific amplification.
Provided by the present invention for the kit of 7 kinds of mankind RET gene mutation of detection, it is used for including any description above
The primer and probe of 7 kinds of mankind RET gene mutation of detection.
Preferably, above-mentioned for detecting the kit of 7 kinds of mankind RET gene mutation, it further include external control primer and probe, core
Nucleotide sequence is as follows:
External control upstream primer RR-F:SEQ ID NO:14,
External control downstream primer RR-R:SEQ ID NO:15,
5 ' the ends of external control detection probe RR-P:SEQ ID NO:16, external control detection probe nucleotide sequence are marked with FAM,
3 ' ends are marked with MGB.Wherein, RR-F and RR-R be used to expand RET gene conserved sequence (this section of conserved sequence base section be >
gi|568815588:43128101-43128500)；RR-P is the detection probe that 5 ' ends are marked with the end of FAM signal 3 ' label MGB,
It can be in conjunction with amplified fragments.
Preferably, above-mentioned for detecting the kit of 7 kinds of mankind RET gene mutation, it further include internal control primer and probe, core
Nucleotide sequence is as follows:
Internal control upstream primer IC-F:SEQ ID NO:17,
Internal control downstream primer IC-R:SEQ ID NO:18,
5 ' the ends of internal control detection probe IC-P:SEQ ID NO:19, internal control detection probe nucleotide sequence are marked with JOE,
3 ' ends are marked with BHQ1.
Wherein, IC-F and IC-R is internal control upstream and downstream primer, expands matK gene conserved sequence；IC-P is that 5 ' ends are marked with
The detection probe of the end of JOE signal 3 ' label BHQ1, can be in conjunction with amplified fragments.
Preferably, above-mentioned for detecting the kit of 7 kinds of mankind RET gene mutation, it further include positive reference substance and internal control
Product, positive reference substance include plasmid RM1 plasmid~RM7 plasmid containing 7 kinds of mutant nucleotide sequence genes, containing the conservative sequence of RET gene
Column > gi | the external control plasmid of 568815588:43128101-43128500 sections of bases and contain matK gene conserved sequence > gi |
The internal control plasmid of 11994090:c2400-2001 sections of bases, wherein RM1 plasmid contains RET gene > gi | and 568815588:
43121771-43122170 sections of base sequences, RM2 plasmid~RM7 plasmid contain RET gene > gi | and 568815588:
43114301-43114700 sections of base sequences；Internal control product are to contain matK gene conserved sequence > gi | 11994090:c2400-
The internal control plasmid of 2001 sections of bases.
RET gene > gi in RM1 plasmid | 568815588:43121771-43122170 sections of base sequences contain mutation position
Point c.2753T > C；RET gene > gi in RM2 plasmid~RM7 plasmid | 568815588:43114301-43114700 sections of bases
Sequence contain respective mutational site mutating alkali yl (successively are as follows: c.1900T > C, c.1900T > G, c.1900T > A, c.1901G >
T, c.1901G > A, c.1902C > G).
Preferably, above-mentioned for detecting the kit of 7 kinds of mankind RET gene mutation, the reaction system in kit is divided into 8
It is a:
7 detection reaction systems include for detecting a kind of mutation of mankind's RET gene in every 1 detection reaction system
Primer and probe, internal control primer and probe, AB premix, 10 × buffer and ddH2O；
Quality Control reaction system: including external control primer and probe, internal control primer and probe, AB premix, 10 × buffer and
ddH2O；
The AB premix is Applied biosystems' productFast Advanced Master
Mix；10 × the buffer is the buffer of 10 times of concentration, contains Mg in buffer2+。
The present invention also provides described above for detecting the application method of the kit of 7 kinds of mankind RET gene mutation, first
The genomic DNA for first extracting measuring samples, is added separately to each detection reaction system and Quality Control reaction system, carries out fluorescent quantitation
PCR reaction；In addition setting non-template, which is compareed, is mutated corresponding positive control with each, carries out with the genomic DNA of measuring samples same
The operation of sample；According to Ct value analysis detection result；
Firstly the need of value≤25 JOE signal Ct are met, initial line, the FAM of positive control do not believe the FAM signal of non-template control
Number value≤22 Ct；9<CtQuality Control≤18；Then according to △ Ct=CtDetection-CtQuality ControlDetermine:
The detection reaction system and Quality Control reaction system of primer and probe containing RM1:M918T (c.2753T > C) mutation
It is wild type that middle FAM signal Ct value difference value △ Ct, which is greater than 9, and it is positive for M918T (c.2753T > C) saltant type to be less than or equal to 9；
The detection reaction system and Quality Control reaction system of primer and probe containing RM2:C634R (c.1900T > C) mutation
It is wild type that middle FAM signal Ct value difference value △ Ct, which is greater than 9, and it is positive for C634R (c.1900T > C) saltant type to be less than or equal to 9；
The detection reaction system and Quality Control reaction system of primer and probe containing RM3:C634G (c.1900T > G) mutation
It is wild type that middle FAM signal Ct value difference value △ Ct, which is greater than 9, and it is positive for C634G (c.1900T > G) saltant type to be less than or equal to 9；
The detection reaction system and Quality Control reaction system of primer and probe containing RM4:C634S (c.1900T > A) mutation
It is wild type that middle FAM signal Ct value difference value △ Ct, which is greater than 9, and it is positive for C634S (c.1900T > A) saltant type to be less than or equal to 9；
The detection reaction system and Quality Control reaction system of primer and probe containing RM5:C634F (c.1901G > T) mutation
It is wild type that middle FAM signal Ct value difference value △ Ct, which is greater than 9, and it is positive for C634F (c.1901G > T) saltant type to be less than or equal to 9；
The detection reaction system and Quality Control reaction system of primer and probe containing RM6:C634Y (c.1901G > A) mutation
It is wild type that middle FAM signal Ct value difference value △ Ct, which is greater than 9, and it is positive for C634Y (c.1901G > A) saltant type to be less than or equal to 9；
The detection reaction system and Quality Control reaction system of primer and probe containing RM7:C634W (c.1902C > G) mutation
It is wild type that middle FAM signal Ct value difference value △ Ct, which is greater than 7, and it is positive for C634W (c.1902C > G) saltant type to be less than or equal to 7；
The CtDetectionFor the genomic DNA of measuring samples quantitative fluorescent PCR is carried out in above-mentioned 7 kinds of detections reaction system obtain
The Ct value obtained, the CtQuality ControlThe Ct of quantitative fluorescent PCR acquisition is carried out in Quality Control reaction system for the genomic DNA of measuring samples
Value.
Preferably, above-described for detecting the application method of the kit of 7 kinds of mankind RET gene mutation, fluorescence is fixed
Measure the condition of PCR reaction are as follows:
95℃10min；
92 DEG C of 15sec, 58 DEG C of 1min, totally 15 recycle；
92 DEG C of 15sec, 60 DEG C of 1min, totally 30 recycle；The collecting signal at 60 DEG C.
Compared with prior art, the invention has the following advantages:
(1) present invention employs specific mutation primers and probe interrupter technique, can detecte 7 kinds of mankind RET gene and dash forward
Become type.Wherein, specific mutation primers are higher than corresponding wild-type sequence with mutant nucleotide sequence matching degree；On this basis, it hinders
Disconnected probe and wild-type sequence are specifically bound, and are effectively inhibited the non-specific amplification of wild type, are further increased system
Specificity levels, to realize the detection under high wild type gene background to low content mutant nucleotide sequence.
(2) present invention establishes quick detection of the real-time fluorescent PCR amplification reaction system realization to RET gene mutation；And
It is easy to operate, it is as a result readable.Its JOE signal Ct value has reacted the relevant information of real-time fluorescent PCR amplification reaction system, and (PCR is anti-
Should whether normal, whether operating process is accurate).
(3) this method high sensitivity is, it can be achieved that 50 copy mutated genes stablize detection；Specific good, 20ng wild type
Genomic DNA is up to 1% without non-specific amplification, detectability.
Detailed description of the invention
Fig. 1 is internal control (IC) experimental result in embodiment 1；
Fig. 2 is that non-template compares (NTC) experimental result in embodiment 1；
Fig. 3 is positive control (STD) sample results in embodiment 1；
Fig. 4 is 1 medium sensitivity of embodiment (M918T detection hole) experimental result；
Fig. 5 is precision (external control detection hole) experimental result in embodiment 1；
Fig. 6 is negative (wild type) sample experimental result in embodiment 2；
Fig. 7 is positive (C634W mutation) sample experimental result in embodiment 2.
Specific embodiment
The present invention is further explained in the light of specific embodiments, so that those skilled in the art can be better
Understand the present invention and can be practiced, but illustrated embodiment is not as a limitation of the invention.
Embodiment 1
1, for detecting the primer and probe of the detection kit of 7 kinds of mankind RET gene mutation:
The RET gene (NCBI Reference Sequence:NM_020975.4) announced according to ncbi database is wild
Type sequence, with 16 mutational sites exon M918T (RM1), 11 exon C634R (RM2), C634G (RM3), C634S
(RM4), C634F (RM5), C634Y (RM6) and the mutational site (RM7) C634W are reference, design specificity M918T mutant primer
It is mutated with probe (being shown in Table 2), C634R mutant primer and probe (being shown in Table 3), C634G mutant primer and probe (being shown in Table 4), C634S
Primer and probe (being shown in Table 5), C634F mutant primer and probe (being shown in Table 6), C634Y mutant primer and probe (being shown in Table 7) and
C634W mutant primer and probe (being shown in Table 8).Using the mutant plasmid of genetic engineering building and wild plasmid as template, establish
Real-time fluorescence PCR is mutated (Mutation) detection architecture, realizes and detects to the high sensitivity and high specific of RET gene mutation.
(1) specific primer and probe sequence of mankind RET gene M 918T (RM1) abrupt climatic change are used for:
Table 2 is used to detect the specific primer and probe combinations in the site M918T (RM1)
| SEQIDNO: | Title | Sequence (5 ' → 3 ') | It is end modified |
| 1 | RM1-F | CGTCGGATTCCAGTTAGATGAAC | Nothing |
| 2 | RW1-R | CCACCCCAAGAGAGCAACAC | Nothing |
| 3 | RW1-P | TCCCTTTTTGATCATATCT | 5 ' end FAM, 3 ' end MGB |
| 4 | RW1-B | AGTTAAATGGATGGCAATTG | 5 ' end double deoxidation modifications, 3 ' end MGB |
Wherein, RM1-F is mutation upstream ARMS primer, with M918T (c.2753T > C) site mutation sequence-specific knot
It closes, selective amplification mutant nucleotide sequence；RW1-R is mutation downstream primer, in conjunction with RET gene conserved sequence；RW1-P is 5 ' end marks
Note has the detection probe of the end of FAM signal 3 ' label MGB, can be in conjunction with amplified fragments；RW1-B is 5 ' end double deoxidation modification, 3 ' end
The blocking probe of MGB label, can specifically bind with the site M918T wild-type sequence, inhibit wild type non-specific amplification.
(2) specific primer and probe sequence of mankind RET gene C 634R (RM2) abrupt climatic change are used for:
Table 3 is used to detect the specific primer and probe combinations in the site C634R (RM2)
| SEQIDNO: | Title | Sequence (5 ' → 3 ') | It is end modified |
| 5 | RM2-F | TTCACTGTGCGACGAGATGC | Nothing |
| 11 | RW2-R | TGTGGGCAAACTTGTGGTAGC | Nothing |
| 12 | RW2-P | CTGTCCTCTTCTCCTTC | 5 ' end FAM, 3 ' end MGB |
| 13 | RW2-B | ACGAGCTGTGCCGCA | 3 ' end double deoxidation modifications, 3 ' end MGB |
Wherein, RM2-F is mutation upstream ARMS primer, with C634R (c.1900T > C) site mutation sequence-specific knot
It closes, selective amplification mutant nucleotide sequence；RW2-R is mutation downstream primer, in conjunction with RET gene conserved sequence；RW2-P is 5 ' end marks
Note has the detection probe of the end of FAM signal 3 ' label MGB, can be in conjunction with amplified fragments；RW2-B is 5 ' end double deoxidation modification, 3 ' end
The blocking probe of MGB label, can specifically bind with the site C634R wild-type sequence, inhibit wild type non-specific amplification.
(3) specific primer and probe sequence of mankind RET gene C 634G (RM3) abrupt climatic change are used for:
Table 4 is used to detect the specific primer and probe combinations in the site C634G (RM3)
| SEQIDNO: | Title | Sequence (5 ' → 3 ') | It is end modified |
| 6 | RM3-F | TTACTGTGCGACGGGTTGG | Nothing |
| 11 | RW2-R | TGTGGGCAAACTTGTGGTAGC | Nothing |
| 12 | RW2-P | CTGTCCTCTTCTCCTTC | 5 ' end FAM, 3 ' end MGB |
| 13 | RW2-B | ACGAGCTGTGCCGCA | 3 ' end double deoxidation modifications, 3 ' end MGB |
Wherein, RM3-F is mutation upstream ARMS primer, with C634G (c.1900T > G) site mutation sequence-specific knot
It closes, selective amplification mutant nucleotide sequence；RW2-R is mutation downstream primer, in conjunction with RET gene conserved sequence；RW2-P is 5 ' end marks
Note has the detection probe of the end of FAM signal 3 ' label MGB, can be in conjunction with amplified fragments；RW2-B is 5 ' end double deoxidation modification, 3 ' end
The blocking probe of MGB label, can specifically bind with the site C634G wild-type sequence, inhibit wild type non-specific amplification.
(4) specific primer and probe sequence of mankind RET gene C 634S (RM4) abrupt climatic change are used for:
Table 5 is used to detect the specific primer and probe combinations in the site C634S (RM4)
| SEQIDNO: | Title | Sequence (5 ' → 3 ') | It is end modified |
| 7 | RM4-F | TCCAATGTGCGACGATCTGA | Nothing |
| 11 | RW2-R | TGTGGGCAAACTTGTGGTAGC | Nothing |
| 12 | RW2-P | CTGTCCTCTTCTCCTTC | 5 ' end FAM, 3 ' end MGB |
| 13 | RW2-B | ACGAGCTGTGCCGCA | 3 ' end double deoxidation modifications, 3 ' end MGB |
Wherein, RM4-F is mutation upstream ARMS primer, with C634S (c.1900T > A) site mutation sequence-specific knot
It closes, selective amplification mutant nucleotide sequence；RW2-R is mutation downstream primer, in conjunction with RET gene conserved sequence；RW2-P is 5 ' end marks
Note has the detection probe of the end of FAM signal 3 ' label MGB, can be in conjunction with amplified fragments；RW2-B is 5 ' end double deoxidation modification, 3 ' end
The blocking probe of MGB label, can specifically bind with the site C634S wild-type sequence, inhibit wild type non-specific amplification.
(5) specific primer and probe sequence of mankind RET gene C 634F (RM5) abrupt climatic change are used for:
Table 6 is used to detect the specific primer and probe combinations in the site C634F (RM5)
| SEQIDNO: | Title | Sequence (5 ' → 3 ') | It is end modified |
| 8 | RM5-F | AATGTGCGACGAGCGGTT | Nothing |
| 11 | RW2-R | TGTGGGCAAACTTGTGGTAGC | Nothing |
| 12 | RW2-P | CTGTCCTCTTCTCCTTC | 5 ' end FAM, 3 ' end MGB |
| 13 | RW2-B | ACGAGCTGTGCCGCA | 3 ' end double deoxidation modifications, 3 ' end MGB |
Wherein, RM5-F is mutation upstream ARMS primer, with C634F (c.1901G > T) site mutation sequence-specific knot
It closes, selective amplification mutant nucleotide sequence；RW2-R is mutation downstream primer, in conjunction with RET gene conserved sequence；RW2-P is 5 ' end marks
Note has the detection probe of the end of FAM signal 3 ' label MGB, can be in conjunction with amplified fragments；RW2-B is 5 ' end double deoxidation modification, 3 ' end
The blocking probe of MGB label, can specifically bind with the site C634F wild-type sequence, inhibit wild type non-specific amplification.
(6) specific primer and probe sequence of mankind RET gene C 634Y (RM6) abrupt climatic change are used for:
Table 7 is used to detect the specific primer and probe combinations in the site C634Y (RM6)
| SEQIDNO: | Title | Sequence (5 ' → 3 ') | It is end modified |
| 9 | RM6-F | TAACTGTGCGACGGGCTCTA | Nothing |
| 11 | RW2-R | TGTGGGCAAACTTGTGGTAGC | Nothing |
| 12 | RW2-P | CTGTCCTCTTCTCCTTC | 5 ' end FAM, 3 ' end MGB |
| 13 | RW2-B | ACGAGCTGTGCCGCA | 3 ' end double deoxidation modifications, 3 ' end MGB |
Wherein, RM6-F is mutation upstream ARMS primer, with C634Y (c.1901G > A) site mutation sequence-specific knot
It closes, selective amplification mutant nucleotide sequence；RW2-R is mutation downstream primer, in conjunction with RET gene conserved sequence；RW2-P is 5 ' end marks
Note has the detection probe of the end of FAM signal 3 ' label MGB, can be in conjunction with amplified fragments；RW2-B is 5 ' end double deoxidation modification, 3 ' end
The blocking probe of MGB label, can specifically bind with the site C634Y wild-type sequence, inhibit wild type non-specific amplification.
(7) specific primer and probe sequence of mankind RET gene C 634W (RM7) abrupt climatic change are used for:
Table 8 is used to detect the specific primer and probe combinations in the site C634W (RM7)
| SEQIDNO: | Title | Sequence (5 ' → 3 ') | It is end modified |
| 10 | RM7-F | ATGTGCGACGAACTGGGG | Nothing |
| 11 | RW2-R | TGTGGGCAAACTTGTGGTAGC | Nothing |
| 12 | RW2-P | CTGTCCTCTTCTCCTTC | 5 ' end FAM, 3 ' end MGB |
| 13 | RW2-B | ACGAGCTGTGCCGCA | 3 ' end double deoxidation modifications, 3 ' end MGB |
Wherein, RM7-F is mutation upstream ARMS primer, with C634W (c.1902C > G) site mutation sequence-specific knot
It closes, selective amplification mutant nucleotide sequence；RW2-R is mutation downstream primer, in conjunction with RET gene conserved sequence；RW2-P is 5 ' end marks
Note has the detection probe of the end of FAM signal 3 ' label MGB, can be in conjunction with amplified fragments；RW2-B is 5 ' end double deoxidation modification, 3 ' end
The blocking probe of MGB label, can specifically bind with the site C634W wild-type sequence, inhibit wild type non-specific amplification.
2, Quality Control primer (external control and internal control) primer and probe
(1) it is used for the external control primer and probe sequence of mankind RET detection in Gene Mutation sample Quality Control:
The RET gene (NCBI Reference Sequence:NM_020975.4) 20 announced according to ncbi database
Exon conserved sequence is drawn with Primer Premier 5 and 3.0 bioinformatics software of Primer Express design external control
Object and probe (being shown in Table 9).Using the external control plasmid of genetic engineering building as template, real-time fluorescence PCR external control is established
(ExternalControl) detection architecture is monitored the quality and applied sample amount of sample to be tested genomic DNA.
External control primer and probe of the table 9 for sample Quality Control combines
| SEQIDNO: | Title | Sequence (5 ' → 3 ') | It is end modified |
| 14 | RR-F | CAGGTTTGTTCTCAGGAGGGTAAG | Nothing |
| 15 | RR-R | CGCAGGAGTAGACCATTAGGTTATT | Nothing |
| 16 | RR-P | CCAGTGATGGGGAATT | 5 ' end FAM, 3 ' end MGB |
Wherein, RR-F and RR-R be external control upstream and downstream primer, amplification RET gene conserved sequence (> gi | 568815588:
43128101-43128500)；RR-P is the detection probe that 5 ' ends are marked with the end of FAM signal 3 ' label MGB, energy and amplified fragments
In conjunction with.
(2) it is used for the internal control primer and probe sequence of real-time fluorescent PCR amplification reaction system inner quality control:
The matK gene (NCBI Reference Sequence:NC_001666.2) announced according to ncbi database is conservative
Sequence (non-human DNA) is designed with Primer Premier 5 and 3.0 bioinformatics software of Primer Express
Internal control primer and probe (is shown in Table 10).Using the internal control plasmid of genetic engineering building as template, real-time fluorescence PCR internal control is established
(Internal Control) detection architecture carries out Quality Control to real-time fluorescence PCR reaction system and experimental implementation process.
Table 10 is used for the internal control primer of inner quality control, probe combinations
| SEQIDNO: | Title | Sequence (5 ' → 3 ') | It is end modified |
| 17 | IC-F | TCGTAAGGAATCAAATGCTGGAG | Nothing |
| 18 | IC-R | CAACGGGTTTACTAATAGGATGCC | Nothing |
| 19 | IC-P | TCGATACCACAGTCCTTGCAACTCCCC | 5 ' end JOE, 3 ' end BHQ1 |
Wherein, IC-F and IC-R be internal control upstream and downstream primer, amplification matK gene conserved sequence (be located at > gi |
11994090:c2400-2001)；IC-P is the detection probe that 5 ' ends are marked with the end of JOE signal 3 ' label BHQ1, can be with amplification piece
Section combines.
3, the detection kit of 7 kinds of mankind RET gene mutation of detection of the invention
The setting of real-time fluorescent PCR amplification reaction system: the method for the present invention is reacted with 8 hole real-time fluorescent PCR amplifications carries out RET
The detection of 7 kinds of gene mutation.Reaction system 1~7 (being shown in Table 12) includes real-time fluorescence PCR abrupt climatic change system and real-time fluorescence
PCR internal control detection architecture, reaction system 8 (being shown in Table 12) include real-time fluorescence PCR external control detection architecture and real-time fluorescence PCR internal control
Detection architecture.
It is as follows that kit respectively manages interior constituent:
11 kit forms ingredient of table
Wherein, RM1 plasmid contain occur M918T (c.2753T > C) base variation RET genetic fragment (> gi |
568815588:43121771-43122170), RM2 plasmid contains the RET gene that the variation of C634R (c.1900T > C) base occurs
Segment (> gi | 568815588:43114301-43114700), RM3 plasmid, which contains, occurs the variation of C634G (c.1900T > G) base
RET genetic fragment (> gi | 568815588:43114301-43114700), RM4 plasmid contain occur C634S (c.1900T >
A) the RET genetic fragment (> gi | 568815588:43114301-43114700) of base variation, RM5 plasmid, which contains, occurs C634F
The RET genetic fragment (> gi | 568815588:43114301-43114700) of (c.1901G > T) base variation, RM6 plasmid contains
The RET genetic fragment (> gi | 568815588:43114301-43114700) of C634Y (c.1901G > A) base variation occurs,
RM7 plasmid contain occur C634W (c.1902C > G) base variation RET genetic fragment (> gi | 568815588:43114301-
43114700)；RR plasmid (i.e. external control plasmid) containing RET gene conserved sequence (> gi | 568815588:43128101-
43128500)；IC plasmid (i.e. internal control plasmid) contains matK gene conserved sequence (> gi | 11994090:c2400-2001).
Reaction system composition is as follows:
12 real-time fluorescent PCR amplification reaction system of table composition
Note: AB premix full nameFast Advanced Master Mix is purchased from U.S.A. applied biosystem
Company；10×buffer(Mg2+Plus) purchased from precious bioengineering (Dalian) Co., Ltd.
The detection template of PCR reaction 25 μ L of total volume, the reaction system containing 19 μ L, the IC template of 1 μ L and 5 μ L are (positive right
According to the control of, non-template, plasmid template or sample gene to be tested group DNA), IC template and detection template can premix.
Reaction system 1 is used for the detection of mankind RET gene M 918T (RM1) mutation.System includes for being mutated aim sequence
The specific mutation primers and probe combinations (being shown in Table 2) of amplification and for internal control gene magnification internal control primer and probe combine
(being shown in Table 10).
Reaction system 2 is used for the detection of mankind RET gene C 634R (RM2) mutation.System includes for being mutated aim sequence
The specific mutation primers and probe combinations (being shown in Table 3) of amplification and for internal control gene magnification internal control primer and probe combine
(being shown in Table 10).
Reaction system 3 is used for the detection of mankind RET gene C 634G (RM3) mutation.System includes for being mutated aim sequence
The specific mutation primers and probe combinations (being shown in Table 4) of amplification and for internal control gene magnification internal control primer and probe combine
(being shown in Table 10).
Reaction system 4 is used for the detection of mankind RET gene C 634S (RM4) mutation.System includes for being mutated aim sequence
The specific mutation primers and probe combinations (being shown in Table 5) of amplification and for internal control gene magnification internal control primer and probe combine
(being shown in Table 10).
Reaction system 5 is used for the detection of mankind RET gene C 634F (RM5) mutation.System includes for being mutated aim sequence
The specific mutation primers and probe combinations (being shown in Table 6) of amplification and for internal control gene magnification internal control primer and probe combine
(being shown in Table 10).
Reaction system 6 is used for the detection of mankind RET gene C 634Y (RM6) mutation.System includes for being mutated aim sequence
The specific mutation primers and probe combinations (being shown in Table 7) of amplification and for internal control gene magnification internal control primer and probe combine
(being shown in Table 10).
Reaction system 7 is used for the detection of mankind RET gene C 634W (RM7) mutation.System includes for being mutated aim sequence
The specific mutation primers and probe combinations (being shown in Table 8) of amplification and for internal control gene magnification internal control primer and probe combine
(being shown in Table 10).
Reaction system 8 is used for the Quality Control of sample to be tested.System includes the external control primer and probe for external control gene magnification
It combines (being shown in Table 9) and the internal control primer and probe for internal control gene magnification combines (being shown in Table 10).
4, kit test method:
(1) sample gene to be tested group DNA is obtained
The extraction of blood sample has into poba gene group DNA extraction kit (KR008F) using Ningbo.By specification mentions
Medullary carcinoma of thyroid gland and multiple endocrine neoplasia type 2 patient whole blood's genomic DNA are taken, operating procedure is summarized as follows:
It takes 200 μ L of blood sample to centrifuge tube, 50 μ LProteinase K is added, (2s is each, concussion for the concussion mixing that is vortexed
5 times)；250 μ L lysate BL are added, the concussion that is vortexed mixes, and is stored at room temperature the abundant lytic cell of 10min；The 200 anhydrous second of μ L are added
Alcohol, vortex oscillation mix；Above-mentioned solution is transferred completely into DNA adsorption column, 13000rpm is centrifuged 1min, abandons collecting pipe；It will
Adsorption column is placed in cleaning solution BWB1,13000rpm the centrifugation 1min that 500 μ L in new 2mL collecting pipe and are added, and abandons filtrate；It is added
500 μ L cleaning solution BWB2,13000rpm are centrifuged 1min, abandon collecting pipe；Adsorption column is placed in the centrifugation of the nuclease pollution of 1.5mL
Guan Zhong, being stored at room temperature in 10min or superclean bench air-dried 5min makes ethyl alcohol thoroughly volatilize；It is carefully added into adsorbed film center
50-100 μ L eluent BE, is stored at room temperature 5min；13000rpm is centrifuged 1min, collects filtrate, -20 DEG C of preservations.
The DNA sample that will have been extracted, with UV spectrophotometer measuring concentration and DNA mass, the concentration of DNA requires >=
The quality OD260/280 of 10ng/ μ L, DNA are between 1.8~2.0.After quantitative, -20 DEG C of mother liquor preservations.
(2) real-time fluorescent PCR amplification is reacted:
The setting of real-time fluorescent PCR amplification reaction system: the method for the present invention is reacted with 8 hole real-time fluorescent PCR amplifications carries out RET
The detection of 7 kinds of gene mutation.System 1-7 (being shown in Table 12) includes real-time fluorescence PCR abrupt climatic change system and real-time fluorescence PCR internal control
Detection architecture, system 8 (being shown in Table 12) include real-time fluorescence PCR external control detection architecture and real-time fluorescence PCR internal control detection architecture.
Real-time fluorescent PCR amplification reacts basic principle: above-mentioned detection probe sequence 5 ' end connection fluorophor (FAM,
JOE), 3 ' end connection quenching group (MGB, BHQ1).Before not carrying out pcr amplification reaction, detection probe 5 ' holds fluorophor and 3 '
The quenching group at end is close to each other, and due to the effect of fluorescence resonance energy transfer, fluorophor cannot issue fluorescence.With PCR
The progress of amplified reaction, detection probe hydrolyze under the action of archaeal dna polymerase, 5 ' end fluorophors fall off and with base is quenched
Group is separated from each other, and then can issue fluorescence.It can reflect template target fragment to be measured by the accumulation that instrument detects fluorescence signal
Initial concentration.In abrupt climatic change probe, external control detection probe and 3 ' ends of probe is blocked to be connected with MGB (Minor Groove
Binder) group.MGB group can with DNA spiral minor groove binding, and then improve MGB probe and corresponding templates hybridization stability
(Tm value improves about 10 DEG C).Relative to general T aqMan probe, MGB probe sequence can be designed shorter, and specificity is stronger.
(1) in real-time fluorescence PCR abrupt climatic change system of the present invention, PCR amplification is carried out to target gene sudden change region.Its
In, specific mutation primers are higher than corresponding wild-type sequence with mutant nucleotide sequence matching degree；On this basis, probe and open country are blocked
Raw type sequence-specific combines, and effectively inhibits the non-specific amplification of wild type, further increases the specificity levels of system,
To realize the detection under high wild type gene background to low content mutant nucleotide sequence.(2) outside real-time fluorescence PCR of the present invention
It controls in detection architecture, PCR amplification is carried out to target gene conservative region.Its FAM signal Ct value reflects sample gene to be tested group
The relevant information (DNA mass, purity and applied sample amount) of DNA.(3) in real-time fluorescence PCR internal control detection architecture of the present invention, to non-
Human gene conserved region carries out PCR amplification.Its JOE signal Ct value has reacted the related letter of real-time fluorescent PCR amplification reaction system
Breath (whether PCR reaction is normal, and whether operating process is accurate).
Real-time fluorescent PCR amplification reaction:
The genomic DNA of sample TE (10mmol/L, pH8.0) is diluted to 2~10ng/ μ L as template, is added to
(12 are shown in Table) in real-time fluorescent PCR amplification reaction system to be expanded.
The setting of real-time fluorescent PCR amplification reaction condition:
13 real-time fluorescent PCR amplification reaction condition of table
Optimal, in Stage2 stage (15 circulations), 58 DEG C of annealing elongating temperature is conducive to the richness of mutagenesis template
Collection.In Stage3 stage (30 circulations), 60 DEG C of annealing elongating temperature can guarantee better specific amplification.
(3) Analysis of test results
According to fluorescent quantitative PCR instrument Ct value analysis detection result: using JOE signal Ct value as PCR reaction whether at
The criterion (value≤25 JOE signal Ct, amplification are normal) of function, with non-template control (NTC) and positive control (STD) FAM letter
(non-template compares FAM signal not initial line, positive control FAM signal as the whether effective criterion of experimental data for number Ct value
Value≤22 Ct, system is functional, as a result effectively)；Using external control detection hole FAM signal Ct value as applied sample amount quality control standard (9 <
CtQuality Control≤ 18, CtQuality Control≤ 9, illustrate the genomic DNA excessive concentration being added, detects the sample after should diluting again；CtQuality Control> 18 or
Without amplification curve, illustrates that the genomic DNA concentration being added is too low or there is degradation, it is proposed that extract the sample genomic dna again
After detected), with △ Ct value (the △ Ct=Ct in sample to be tested abrupt climatic change hole and external control detection hole FAM signalDetection-CtQuality Control)
As yin and yang attribute criterion (being shown in Table 14).
14 pattern detection result judgement of table
Detection need to carry out non-template control (NTC) experiment and positive control (STD) experiment simultaneously every time.
(4) kit performance evaluation experiment (sensitivity and precision)
Detection need to carry out non-template control (NTC) experiment and positive control (STD) experiment simultaneously every time.Fig. 1 is IC detection
As a result, CtInternal control≤ 25, it meets the requirements；Fig. 2 is NTC testing result, and 1~8FAM of reaction system not initial line meets the requirements；Fig. 3
For STD testing result, the equal initial line of reaction system 1~8FAM signal and Ct≤22 meet the requirements.
(1) sensitivity experiment
The 7 kinds of recombinant plasmid dna dry powder TE containing RET gene mutation sequence that will be synthesized with existing technique for gene engineering
(10mmol/L, pH8.0) redissolves, and dilutes after quantitative.Take 1 × 1037 kinds of mutant plasmid DNA of copy/μ L carry out respectively 10 times it is dilute
It releases, dilutes 2 gradients, then with 3 kinds of concentration gradients (1 × 103Copy/μ L, 1 × 102Copy/μ L and 1 × 101Copy/μ L)
Mutant plasmid DNA is template, is carried out real-time fluorescent PCR amplification reaction (see Fig. 4).Fluorescence PCR method of the invention as seen from Figure 4
High sensitivity, 10 copies/μ L mutated gene can detect.
(2) Precision Experiment
The 7 kinds of recombinant plasmid dna dry powder TE containing RET gene mutation sequence that will be synthesized with existing technique for gene engineering
(10mmol/L, pH8.0) redissolves, and dilutes after quantitative.With 5 × 1017 kinds of mutant plasmid DNA of copy/μ L are template, are carried out real
When fluorescent PCR amplified reaction (see Fig. 5).Real-time fluorescent PCR amplification of the invention reacts reproducible (20 weights as seen from Figure 5
Multiple experimental result is stablized, CV < 5%).
Embodiment 2
The tissue samples of clinical acquisitions are detected with 7 kinds of mutation detection kits of mankind RET gene in the present invention.
Patient's blood that Clinicopathologic Diagnosis is medullary carcinoma of thyroid gland and multiple endocrine neoplasia type 2 is collected in the present embodiment
Liquid sample, and therefrom extract genomic DNA.It is prominent with RET gene in 7 kinds of mutation detection kit detection samples to be tested of RET gene
Change state.Specific step is as follows:
(1) sample genomic dna extracts
The extraction of blood sample has into poba gene group DNA extraction kit (KR008F) using Ningbo, and by specification mentions
Take sample gene to be tested group DNA, the DNA sample that will have been extracted, with UV spectrophotometer measuring concentration and DNA mass, DNA's
Concentration requirement >=10ng/ μ L, DNA quality OD260/280 is between 1.8~2.0.By satisfactory genomic DNA TE
(10mmol/L, pH8.0) is diluted to 2~10ng/ μ L as pcr template, carries out real-time fluorescent PCR amplification reaction.
(2) real-time fluorescent PCR amplification is reacted
Real-time fluorescent PCR amplification reaction condition is shown in Table 13, according to 7 kinds of mutation detection kit specifications of mankind RET gene
Carry out pattern detection.
(3) result judgement
According to fluorescent quantitative PCR instrument Ct value analysis detection result: using JOE signal Ct value as PCR reaction whether at
The criterion (JOE signal Ct value Ct≤25, amplification are normal) of function, compares (NTC) and positive control (STD) FAM with non-template
As the whether effective criterion of experimental data, (non-template compares FAM signal not initial line, positive control FAM letter to signal Ct value
Number Ct value Ct≤22, system is functional, as a result effectively)；With sample to be tested abrupt climatic change hole and external control detection hole FAM signal △
Ct value (△ Ct=CtDetection-CtQuality Control) it is used as yin and yang attribute criterion (being shown in Table 14).
In Fig. 6, CtQuality Control=13.9, it meets the requirements；FAM signal non-initial line in abrupt climatic change hole shows pattern detection result
For feminine gender.
In Fig. 7, CtQuality Control=12.9, it meets the requirements；RM7 abrupt climatic change hole FAM signal initial line and RM1~RM6 abrupt climatic change
The non-initial line of hole FAM signal, and CtIt detects (RM7)=18.1, △ Ct=5.2, display pattern detection result are RM7 (C634W) positive.
Embodiment described above is only to absolutely prove preferred embodiment that is of the invention and being lifted, protection model of the invention
It encloses without being limited thereto.Those skilled in the art's made equivalent substitute or transformation on the basis of the present invention, in the present invention
Protection scope within.Protection scope of the present invention is subject to claims.
SEQUENCE LISTING
<110>Wuhan Hygiea Bioscience Co., Ltd.
<120>for detecting probe, primer and the kit of 7 kinds of mankind RET gene mutation
<130>
<160> 19
<170> PatentIn version 3.3
<210> 1
<211> 23
<212> DNA
<213>artificial sequence
<400> 1
cgtcggattc cagttagatg aac 23
<210> 2
<211> 20
<212> DNA
<213>artificial sequence
<400> 2
ccaccccaag agagcaacac 20
<210> 3
<211> 19
<212> DNA
<213>artificial sequence
<400> 3
tccctttttg atcatatct 19
<210> 4
<211> 20
<212> DNA
<213>artificial sequence
<400> 4
agttaaatgg atggcaattg 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 5
ttcactgtgc gacgagatgc 20
<210> 6
<211> 19
<212> DNA
<213>artificial sequence
<400> 6
ttactgtgcg acgggttgg 19
<210> 7
<211> 20
<212> DNA
<213>artificial sequence
<400> 7
tccaatgtgc gacgatctga 20
<210> 8
<211> 18
<212> DNA
<213>artificial sequence
<400> 8
aatgtgcgac gagcggtt 18
<210> 9
<211> 20
<212> DNA
<213>artificial sequence
<400> 9
taactgtgcg acgggctcta 20
<210> 10
<211> 18
<212> DNA
<213>artificial sequence
<400> 10
atgtgcgacg aactgggg 18
<210> 11
<211> 21
<212> DNA
<213>artificial sequence
<400> 11
tgtgggcaaa cttgtggtag c 21
<210> 12
<211> 17
<212> DNA
<213>artificial sequence
<400> 12
ctgtcctctt ctccttc 17
<210> 13
<211> 15
<212> DNA
<213>artificial sequence
<400> 13
acgagctgtg ccgca 15
<210> 14
<211> 24
<212> DNA
<213>artificial sequence
<400> 14
caggtttgtt ctcaggaggg taag 24
<210> 15
<211> 25
<212> DNA
<213>artificial sequence
<400> 15
cgcaggagta gaccattagg ttatt 25
<210> 16
<211> 16
<212> DNA
<213>artificial sequence
<400> 16
ccagtgatgg ggaatt 16
<210> 17
<211> 23
<212> DNA
<213>artificial sequence
<400> 17
tcgtaaggaa tcaaatgctg gag 23
<210> 18
<211> 24
<212> DNA
<213>artificial sequence
<400> 18
caacgggttt actaatagga tgcc 24
<210> 19
<211> 27
<212> DNA
<213>artificial sequence
<400> 19
tcgataccac agtccttgca actcccc 27
Claims (7)
1. the primer and probe for detecting 7 kinds of mankind RET gene mutation, which is characterized in that nucleotide sequence is as follows:
RM1:M918T mutation
It is mutated upstream ARMS primer RM1-F:SEQ ID NO:1,
It is mutated downstream primer RW1-R:SEQ ID NO:2,
Detection probe RW1-P:SEQ ID NO:3,
Block probe RW1-B:SEQ ID NO:4；
RM2:C634R mutation
It is mutated upstream ARMS primer RM2-F:SEQ ID NO:5,
It is mutated downstream primer RW2-R:SEQ ID NO:11,
Detection probe RW2-P:SEQ ID NO:12,
Block probe RW2-B:SEQ ID NO:13；
RM3:C634G mutation
It is mutated upstream ARMS primer RM3-F:SEQ ID NO:6,
It is mutated downstream primer RW2-R:SEQ ID NO:11,
Detection probe RW2-P:SEQ ID NO:12,
Block probe RW2-B:SEQ ID NO:13；
RM4:C634S mutation
It is mutated upstream ARMS primer RM4-F:SEQ ID NO:7,
It is mutated downstream primer RW2-R:SEQ ID NO:11,
Detection probe RW2-P:SEQ ID NO:12,
Block probe RW2-B:SEQ ID NO:13；
RM5:C634F mutation
It is mutated upstream ARMS primer RM5-F:SEQ ID NO:8,
It is mutated downstream primer RW2-R:SEQ ID NO:11,
Detection probe RW2-P:SEQ ID NO:12,
Block probe RW2-B:SEQ ID NO:13；
RM6:C634Y mutation
It is mutated upstream ARMS primer RM6-F:SEQ ID NO:9,
It is mutated downstream primer RW2-R:SEQ ID NO:11,
Detection probe RW2-P:SEQ ID NO:12,
Block probe RW2-B:SEQ ID NO:13；
RM7:C634W mutation
It is mutated upstream ARMS primer RM7-F:SEQ ID NO:10,
It is mutated downstream primer RW2-R:SEQ ID NO:11,
Detection probe RW2-P:SEQ ID NO:12,
Block probe RW2-B:SEQ ID NO:13；
Wherein, the end of nucleotide sequence 5 ' of the detection probe is marked with fluorophor, and 3 ' ends are marked with quenching group；It blocks and visits
The end of nucleotide sequence 5 ' of needle is modified by double deoxidation, and 3 ' ends are marked with quenching group.
2. according to claim 1 for detecting the primer and probe of 7 kinds of mankind RET gene mutation, which is characterized in that institute
Stating fluorophor is FAM, and the quenching group is MGB.
3. the kit for detecting 7 kinds of mankind RET gene mutation, which is characterized in that including use of any of claims 1 or 2
In the primer and probe of 7 kinds of mankind RET gene mutation of detection.
4. according to claim 3 for detecting the kit of 7 kinds of mankind RET gene mutation, which is characterized in that further include
External control primer and probe, nucleotide sequence are as follows:
External control upstream primer RR-F:SEQ ID NO:14,
External control downstream primer RR-R:SEQ ID NO:15,
External control detection probe RR-P:SEQ ID NO:16,5 ' ends of external control detection probe nucleotide sequence are marked with FAM, 3 ' ends
It is marked with MGB.
5. according to claim 4 for detecting the kit of 7 kinds of mankind RET gene mutation, which is characterized in that further include
Internal control primer and probe, nucleotide sequence are as follows:
Internal control upstream primer IC-F:SEQ ID NO:17,
Internal control downstream primer IC-R:SEQ ID NO:18,
Internal control detection probe IC-P:SEQ ID NO:19,5 ' ends of internal control detection probe nucleotide sequence are marked with JOE, 3 ' ends
It is marked with BHQ1.
6. according to claim 5 for detecting the kit of 7 kinds of mankind RET gene mutation, which is characterized in that further include
Positive reference substance and internal control product, positive reference substance include plasmid RM1 plasmid~RM7 plasmid containing 7 kinds of mutant nucleotide sequence genes, contain
There is RET gene conserved sequence > gi | the external control plasmid of 568815588:43128101-43128500 sections of bases and contain matK base
Because of conserved sequence > gi | the internal control plasmid of 11994090:c2400-2001 sections of bases, wherein RM1 plasmid contains RET gene > gi |
568815588:43121771-43122170 sections of base sequences, RM2 plasmid~RM7 plasmid contain RET gene > gi |
568815588:43114301-43114700 sections of base sequences；Internal control product are to contain matK gene conserved sequence > gi |
The internal control plasmid of 11994090:c2400-2001 sections of bases.
7. according to claim 5 for detecting the kit of 7 kinds of mankind RET gene mutation, which is characterized in that kit
In reaction system be divided into 8:
7 detection reaction systems: including for detecting a kind of primer of mutation of mankind's RET gene in every 1 detection reaction system
And probe, internal control primer and probe, AB premix, 10 × buffer and ddH2O；
1 Quality Control reaction system: including external control primer and probe, internal control primer and probe, AB premix, 10 × buffer and
ddH2O；
The AB premix is Applied biosystems' productFast Advanced Master Mix；
10 × the buffer is the buffer of 10 times of concentration, contains Mg in buffer2+。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610025142.2A CN105463115B (en) | 2016-01-15 | 2016-01-15 | For detecting probe, primer and the kit of 7 kinds of mankind RET gene mutation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610025142.2A CN105463115B (en) | 2016-01-15 | 2016-01-15 | For detecting probe, primer and the kit of 7 kinds of mankind RET gene mutation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105463115A CN105463115A (en) | 2016-04-06 |
| CN105463115B true CN105463115B (en) | 2019-04-23 |
Family
ID=55601268
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610025142.2A Active CN105463115B (en) | 2016-01-15 | 2016-01-15 | For detecting probe, primer and the kit of 7 kinds of mankind RET gene mutation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105463115B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107385088A (en) * | 2017-09-04 | 2017-11-24 | 厦门飞朔生物技术有限公司 | A kind of multiple fluorescence PCR detection reagent box for being used to detect mankind's RET Gene Fusions |
| CN109439752B (en) * | 2018-11-16 | 2022-02-15 | 上海派森诺医学检验所有限公司 | Specific primer combination for identifying medullary thyroid carcinoma RET gene mutation, kit and application thereof |
| CN109517053B (en) * | 2018-11-28 | 2021-10-08 | 生命谷（海南）生物科技股份有限公司 | Tumor-related gene RET mutant short peptide and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103906848A (en) * | 2011-08-18 | 2014-07-02 | 雀巢产品技术援助有限公司 | Compositions and methods for detecting allelic variants |
| CN105002283A (en) * | 2015-07-30 | 2015-10-28 | 武汉海吉力生物科技有限公司 | QPCR composition used for detecting c-kit gene mutation of people and reagent kit |
-
2016
- 2016-01-15 CN CN201610025142.2A patent/CN105463115B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103906848A (en) * | 2011-08-18 | 2014-07-02 | 雀巢产品技术援助有限公司 | Compositions and methods for detecting allelic variants |
| CN105002283A (en) * | 2015-07-30 | 2015-10-28 | 武汉海吉力生物科技有限公司 | QPCR composition used for detecting c-kit gene mutation of people and reagent kit |
Non-Patent Citations (1)
| Title |
|---|
| 多发性内分泌肿瘤2型的诊断和外科处理;陈曦等;《中华普通外科杂志》;20061031;第21卷(第10期);721-723 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105463115A (en) | 2016-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110387421A (en) | DNA methylation qPCR kit and application method for lung cancer detection | |
| CN105671181B (en) | Gene marker, primer, probe and kit for detecting lung cancer | |
| CN105779587A (en) | Probe, primer and kit for detecting seven kinds of mutations of human NRAS genes | |
| CN105463111B (en) | For detecting probe, primer and the kit of 5 kinds of mankind PIK3CA gene mutation | |
| WO2017054325A1 (en) | Breast cancer combined diagnosis markers and detection kit | |
| CN105441573A (en) | Primer, probe and kit for detecting mutation of human JAK2 gene V617F | |
| CN105463115B (en) | For detecting probe, primer and the kit of 7 kinds of mankind RET gene mutation | |
| CN105441568B (en) | For detecting primer, probe and the kit of mankind BCR-ABL fusion T315I mutation | |
| CN113528672A (en) | Biomarker combination for early screening of bladder cancer, kit and application | |
| CN108531586A (en) | A kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer | |
| TWI571514B (en) | Method for accessing the risk of having colorectal cancer | |
| CN113699242A (en) | Primer probe, kit and method for detecting KRAS gene mutation, ADAMTS1 and BNC1 methylation | |
| CN111455053B (en) | Exosome RNA molecular marker combination for colorectal adenoma diagnosis and application thereof | |
| CN108950003A (en) | It is a kind of for the miRNA marker of Diagnosis of Breast cancer and its application of miRNA | |
| CN104450702B (en) | A kind of Serum miRNA biomarker composition and application | |
| CN105463114B (en) | For detecting probe, primer and the kit of 5 kinds of mankind TP53 gene mutation | |
| CN110452988A (en) | Detect primer sets, reagent, kit and the method for ESR1 gene mutation | |
| CN109295225A (en) | The optimization method and testing product of EGFR gene L858R mutation digital pcr detection architecture | |
| CN109295223A (en) | The optimization method and testing product of EGFR gene E19del mutation digital pcr detection architecture | |
| CN108424962A (en) | The miRNA detection markers and its diagnostic kit of mesangial proliferative glomerulonephritis | |
| CN107326092A (en) | Applications and colorectal cancer detection kit of the related miRNA of colorectal cancer as biomarker | |
| CN102027128A (en) | Colon cancer associated transcript 1 (CCAT-1) as a cancer marker | |
| CN113897434A (en) | Method and kit for identifying liver cancer status | |
| CN108165546A (en) | A kind of miRNA biomarker, composition and application thereof | |
| CN113278692A (en) | Method and kit for identifying pulmonary nodule status |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |