CN105463110A - Method for utilizing two-step amplification method for detecting MicroRNA(ribonucleic acid) - Google Patents
Method for utilizing two-step amplification method for detecting MicroRNA(ribonucleic acid) Download PDFInfo
- Publication number
- CN105463110A CN105463110A CN201610019896.7A CN201610019896A CN105463110A CN 105463110 A CN105463110 A CN 105463110A CN 201610019896 A CN201610019896 A CN 201610019896A CN 105463110 A CN105463110 A CN 105463110A
- Authority
- CN
- China
- Prior art keywords
- amplification
- rolling circle
- microrna
- template
- circle amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for utilizing a rolling ring amplification-ring mediating isothermal amplification two-step amplification method for detecting MicroRNA(ribonucleic acid). According to the method, at first, a linear rolling ring amplification template with target microRNA as a cyclized connecting probe is designed, rolling ring amplification is carried out with the linear rolling ring amplification template as a primer, and first-step amplification of signals is achieved; a rolling ring amplified product is cut into the same short single chains through restriction incision enzymes, ring mediating amplification is carried out with the short single chains as templates, and second-step amplification of the signals is achieved. The amplification process of ring mediating isothermal amplification is monitored through a real-time fluorescence quantification PCR(polymerase chain reaction), a DNA color developing agent is added into an amplified sample, when amplified DNA products are increased, fluorescence of the DNA color developing agent is enhanced, and the fluorescence signals are collected and output by the real-time fluorescence quantification PCR. By adopting the two-step amplification method for amplifying the signals of microRNA, the method for detecting microRNA is low in background and high in sensitivity.
Description
Technical field
The invention belongs to molecular biology and field of nucleic acid chemistry, relate to a kind of method utilizing rolling circle amplification-ring mediated isothermal amplification two-step amplification method to detect MicroRNA.
Background technology
Microrna (microRNAs) is a kind of endogenous non-coding tiny RNA of an about 21-23 base, and length is about 21-22 Nucleotide, and its length variations scope can from 19 to 25 Nucleotide not etc. yet.MicroRNA is produced by two step enzymolysis process, and that the most original is pri-microRNA, and length is approximately 300 ~ 1000 bases; Pri-microRNA, after time processing, becomes pre-microRNA and microRNA precursor, and length is approximately 70 ~ 90 bases; Pre-microRNA, again after Dicer enzyme enzyme is cut, becomes the ripe microRNA being about 20 ~ 24nt.Concrete principle is as follows: pri-microRNA obtains the pre-microRNA of a stem-ring structure through Drosha enzymic digestion, and Drosha enzyme is present in nucleus, and the enzyme of Drosha catalysis cuts through also be everlasting this region of cell of journey carries out.Pre-microRNA is transported to tenuigenin by Exportin5 albumen from core.Pre-microRNA is sheared by Dicer enzyme and obtains double-stranded RNA in tenuigenin subsequently, becomes ripe microRNA after unwinding.The effect of MicroRNA to target gene mRNA has three kinds of modes: (1) cuts off the mRNA molecule of target gene; (2) translation of target gene mRNA is suppressed; (3) suppression is combined.Research finds that microRNA can as important disease marker, and large quantity research confirms that itself and multiple major disease are closely bound up, and at the commitment of a lot of disease, microRNA composes and has distinctive exception.If what therefore can make a variation at microRNA can be detected in early days in time, the early warning of major disease, early diagnosis and prognosis treatment will be gone far towards.And want to determine the critical role of microRNA in gene regulating further, key be will rapidly, detection by quantitative microRNA exactly.
The Measures compare maturation of current detection MicroRNA mainly contains Northern engram analysis, microarray (microarray) is analyzed and real-time quantitative fluorescence PCR (quantitativeReal-TimePCR).The sample that Northern engram analysis and microarray (microarray) need is large, detect limit for height, linearity range is narrow, analytical cycle is long, poor specificity, can not meet modern analysis requirement.Comparatively the above two have a clear superiority in real-time quantitative PCR, need that sample size is few, detection limit is lower, linearity range is wide, and analysis time shortens relatively, and specificity is high, has become the standard method of a kind of quantitative MicroRNA.Along with era development, these three kinds of detection meanss can not meet human's demand all, and the analyzing and testing for actual sample needs sensitiveer detection means badly.Rolling circle amplification (RCA, rollingcircleamplification) develops a kind of new nucleic acid isothermal amplification method the mid-90, can realize 10
5-10
9amplification efficiency doubly.Ring mediated isothermal amplification (loop-mediatedisothermalamplification, LAMP) technology is a kind of constant temperature nucleic acid amplification technology being applicable to gene diagnosis of Japanese scholars proposition in 2000, can realize 10
9~ 10
10nucleic acid amplification efficiency doubly, has developed into ripe disease detection technology at present.Our experiment be then use one cleverly method rolling circle amplification and loop-mediated isothermal amplification technique are combined, to realizing the super sensitivity detection of MicroRNA.
Summary of the invention
Technical problem to be solved by this invention is that utilize rolling circle amplification and the ring mediated isothermal amplification two-step amplification method that provide the low background of the specific hypersensitive of a kind of microRNA detect the method for microRNAs.
Technical scheme of the present invention is specific as follows:
A kind of method utilizing two-step amplification method to detect microRNA, comprise the following steps: the first linear rolling circle amplification template of design containing restriction endonuclease sites, with target microRNA for linear rolling circle amplification template is connected into ring by linking probe, and with the rolling circle amplification template of Cheng Huan for primer carries out rolling circle amplification, the first step realizing signal is amplified; Then rolling circle amplification product restriction enzyme is cut into identical short strand, carry out ring mediated amplification with above-mentioned short strand for template, the second step realizing signal amplifies.
The above-mentioned method utilizing two-step amplification method to detect microRNA specifically comprises the following steps:
(1) first design the linear rolling circle amplification template of one 5 ' end phosphorylation modification for target microRNA, described linear rolling circle amplification template comprises three sections: with 5 ' end section of target microRNA one end complementation, with 3 ' end section of all the other fragment complementations of target microRNA and the centre portion containing a restriction endonuclease sites;
(2) template cyclization process: to containing target microRNA system in add DNA ligase and 5 ' end phosphorylation modification linear rolling circle amplification template, target microRNA and 5 ' holds the linear rolling circle amplification template base pair complementarity of phosphorylation modification to make 5 ' to hold the linear rolling circle amplification template of phosphorylation modification to join end to end, and obtains into the rolling circle amplification template of ring;
(3) rolling circle amplification process: with the rolling circle amplification template of Cheng Huan for primer carries out rolling circle amplification, obtain rolling circle amplification product;
(4) cutting process: rolling circle amplification product is cut into several identical short strands with restriction enzyme;
(5) ring mediated isothermal amplification process: be that template carries out ring mediated isothermal amplification with the short strand described in step (4), then adds DNA developer in ring mediated isothermal amplification product, and with real-time fluorescence quantitative PCR collection and analysing amplified signal.
Restriction endonuclease sites described in step (1) is the restriction enzyme site of EcoRI enzyme.
The centre portion containing a restriction endonuclease sites described in step (1) is 21nt.
Template cyclization process described in step (2) is specially: to containing the linear rolling circle amplification template adding DNA ligase damping fluid and 5 ' end phosphorylation modification in the system of target microRNA, place 0.5 ~ 1 hour for 22 ~ 37 DEG C; And then add DNA ligase, 16 ~ 37 DEG C connect 2 ~ 24 hours, 65 DEG C of deactivation 15min.
Rolling circle amplification process described in step (3) is specially: in system, add dNTP and archaeal dna polymerase, 37 DEG C of amplifications 4-6h, 80 DEG C of deactivation 15min.
Cutting process described in step (4) is specially: in system, add the restriction enzyme complementary sequence with centre portion complementation, thin up, and anneal 1 hour for 95 DEG C, finally add restriction enzyme, 37 DEG C of enzymes cut 12 ~ 24 hours, 80 DEG C of deactivation 15min.
Ring mediated isothermal amplification process described in step (5) is specially: four of ring mediated isothermal amplification kinds of primers, amplification buffer joined in the short strand that step (4) obtains, 95 DEG C of heating 5min, are then quenched to 4 DEG C; Then add dNTP, archaeal dna polymerase, DNA developer, then use ultrapure water constant volume, 65 DEG C of monitoring in real time on real-time fluorescence quantitative PCR immediately; According to the time of appearance time or " S " point of inflexion on a curve, carry out quantitatively or qualitative analysis.
Cleaning Principle of the present invention as shown in Figure 1, linear rolling circle amplification template and DNA ligase is added containing in the system of target microRNA, the two ends of rolling circle amplification template respectively with the microRNA complementary pairing of part, and 5 ends of template are phosphate groups to be modified, rolling circle amplification template connects into ring with the target microRNA as linking probe under the effect of DNA ligase, then using the rolling circle amplification template of Cheng Huan as primer, carry out rolling changing amplification under the effect of archaeal dna polymerase, the one-level realizing signal is amplified.
Rolling circle amplification take cyclic DNA as template, by a short DNA primer (complementary with part cyclic template), enzymatically dNTPs is transformed into single stranded DNA, and this single stranded DNA comprises hundreds and thousands of the complementary fragments of the templates repeated.Therefore with the rolling circle amplification template of Cheng Huan for primer amplification product is out a long single stranded DNA comprising hundreds and thousands of circular DNA template sequence repeated.We devise a restriction endonuclease sites in linear rolling circle amplification template, and after itself and complementary sequence complementation, the cutting of being limited property restriction endonuclease is ruptured.
Our second section is tested the long single stranded DNA obtained by first time rolling circle amplification exactly and is cut into identical short single stranded DNA, and with cut produce short single stranded DNA be second step amplification ring mediated isothermal amplification template, the secondary carrying out signal amplifies, and the signal of this step is received by real-time fluorescence quantitative PCR and analyzes.
The present invention has the following advantages and beneficial effect:
In the present invention, the design of rolling circle amplification template according to the different specific templates of microRNA sequences Design, can reach the object of the detection detecting different types of microRNA.Detection method of the present invention has very low detection limit, can detect that concentration is low to moderate the microRNA of 500aM, and compared with the detection limit 200pM of single step rolling circle amplification under equal conditions, detection limit reduces a lot.Further, analyze the total serum IgE extracted from Hela cell, disturb even if there is various RNA, still have good Detection capability to microRNA21, illustrate that experimental technique of the present invention has good immunity from interference, selectivity is good.
Accompanying drawing explanation
Fig. 1 is that utilization is rolled and changed amplification and ring mediated isothermal amplification two TRAP detection microRNA schematic flow sheets.
Fig. 2 is temperature condition optimization figure; From left to right represent 55 successively
oc, 60
oc, 65
oc.
Fig. 3 is archaeal dna polymerase concentration conditions optimization figure; From left to right the concentration of representation DNA polysaccharase is 0.5U, 0.25U, 0.125U, 0U successively.
Fig. 4, Fig. 5 are external detection limit mensuration figure.
Fig. 6, Fig. 7 are single step rolling circle amplification detection limit figure.
Fig. 8, Fig. 9 are actual sample detection limit figure.
Embodiment
Below by way of specific embodiment, technical scheme of the present invention is further described.In order to show differentiation, rolling circle amplification template is polymerized archaeal dna polymerase used with target microRNA and is called archaeal dna polymerase 1, archaeal dna polymerase used in loop-mediated isothermal amplification is called archaeal dna polymerase 2.
Embodiment 1
1. the design of the complementary sequence of rolling circle amplification template, restriction enzyme cleavage sites and four primers of ring mediated isothermal amplification in the present invention
(1) as shown in Figure 1, DNA is synthesized by sangon company, and rolling circle amplification template is for designed by microRNA21 sequence (5 '-uagcuuaucagacugauguuga-3 '), and microRNA21 is a kind of important tumor markers.The template of rolling circle amplification comprises three parts, 5 ' end and 3 ' end be district complementary with the microRNA of half respectively, this region is responsible for identifying corresponding microRNA, forms the duplex structure of DNA-RNA hybridization and rolling circle amplification template is joined end to end into ring, and 5 ' end of template is phosphorylation modification.The sequence of rolling circle amplification template is 5 '-PO
4-CTGATAAGCTACGACTCTAGAGGATCCCCGGGTACGTTTCCGTGTGTAAATTGTTA TCCGCTCACATCTCCACACAAGTAACCTCTATGATATCGAATTCTCGCTCCAAACG CTGCAGGTGTGCGGGCCTCTTCGCTATTACCGATTAAGATAGCTAACGCCAGGGTT TTCCCAGTCACGACGTTGATCAACATCAGT-3 '; The cleavage site of restriction enzyme is chosen for the restriction enzyme site of EcoRI enzyme, the cutting sequence of the restriction enzyme of design be one section with the single stranded DNA of the 21nt of rolling circle amplification template complementation, sequence is ATGATATCTGAATTCTCGCTC.Template sequence (short strand) according to the ring mediated isothermal amplification rolling the product cutting generation of changing amplification devises the primer of 4 ring mediated isothermal amplifications: primer 1:CTCGCTCCAAACGCTGCAGGT, primer 2: TCAACGTCGTGACTGGGAAAACCCTTTTTGTGCGGGCCTCTTCGCTATTAC, primer 3:AATTCAGATATCATAGAGGTTACTTGTGTGG, primer 4:CGACTCTAGAGGATCCCCGGGTACTTTTAGATGTGAGCGGATAACAATTTACAC AC.
(2) the detection target reached needed for: for respective objects microRNA, the detection limit that the method can detect is low.
2. the optimization of experiment condition
Reach lower detection limit to react, first the present invention is optimized the consumption of BstDNA enzyme and the temperature of amplified reaction in ring mediated isothermal amplification experiment.
(1) optimization of temperature of reaction
Loop-mediated isothermal amplification carries out in 1 × archaeal dna polymerase 2 damping fluid, comprises 20mMTris-HCl (pH8.8), 10mM (NH in this damping fluid
4)
2sO
4, 2mMMgSO
4, 10mMKCl, 0.1%TritonX-100.First add in the sample to which the primer of different concns, the final concentration of primer 1 and primer 3 is 100nM, and the final concentration of primer 2 and primer 4 is 3 μMs, LAMP template concentrations is 10pM, adding ultrapure water completion cumulative volume is 8.5 μ L, and 95 DEG C are heated 5 minutes, then quenching to 4 DEG C; Then add 500 μMs of dNTP, 0.2 μ L20 × DNA developer and 0.3UDNA polysaccharase 2, react 2 hours at 55 DEG C, 60 DEG C, 65 DEG C temperature respectively; Finally, reaction product is carried out 12% neutral polyacrylamide gel electrophoresis, compare reaction and carry out degree.
(2) optimization of enzyme dosage
According to the sample mode of temperature optimization part, add the archaeal dna polymerase of different amount (0.5U, 0.25U, 0.125U) before amplification, 65 DEG C are reacted two hours.Finally, reaction product is carried out 12% neutral polyacrylamide gel electrophoresis, compare reaction and carry out degree.
3. detection limit
Connect in annulation, microRNA21(100fM, 10fM, 1fM and 500aM of 125nM rolling circle amplification template, different concns), 10 × DNA ligase damping fluid (400mMTris-HCl, pH7.6,100mMMgCl
2, 100mMDTT, 2.5mMATP), add ultrapure water to 9 μ L, hatch 30min at 22 DEG C; Then add 1 μ LDNA ligase enzyme 22 DEG C and connect 1h, 65 DEG C of deactivation 15min; Then in above-mentioned system, add 250 μMs of dNTP, 0.2 μ LDNA polysaccharase 1 and 10 × archaeal dna polymerase 1 damping fluid (500mMTris-HCl, pH7.5,100mMMgCl
2), 37 DEG C of amplifications 4-6h, 80 DEG C of deactivation 15min; Add 2.5 μMs of restriction enzyme digestion sites complementary sequences subsequently, completion volume, to the ultrapure water of 19 μ L, slowly anneals (about 1 hour time) for 95 DEG C; Finally add 1 μ L restriction enzyme, 37 DEG C of enzymes cut through night, 80 DEG C of deactivation 15min.
The digestion products getting centesimal previous step system does second step amplification experiment.Loop-mediated isothermal amplification carries out in 1 × archaeal dna polymerase 2 damping fluid, wherein comprises 20mMTris-HCl (pH8.8), 10mM (NH
4)
2sO
4, 2mMMgSO
4, 10mMKCl, 0.1%TritonX-100; Add the primer of different concns in sample, the final concentration of primer 1 and primer 3 is 100nM, and the final concentration of primer 2 and primer 4 is 3 μMs, and adding ultrapure water completion cumulative volume is 8.5 μ L, and 95 DEG C are heated 5 minutes, then quenching to 4 DEG C; Then 500 μMs of dNTP, 0.2 μ L20 × DNA developer and 0.3 μ LDNA polysaccharase 2 is added, and monitor fluorescence in real time change at 65 DEG C of temperature on real-time quantitative fluorescence PCR instrument immediately.According to appearance time, or the time of " S " point of inflexion on a curve, carry out quantitatively or qualitative analysis.
4. the detection limit of single step rolling circle amplification
In order to verify that two step amplified reactions are better than the reaction of single step rolling circle amplification, the present invention determines the detection limit of single step rolling circle amplification.Connect in annulation, microRNA21(10nM, 5nM, 2nM, 1nM, 500pM, 200pM, 0pM of 125nM rolling circle amplification template, different concns), 10 × DNA ligase damping fluid (400mMTris-HCl, pH7.6,100mMMgCl
2, 100mMDTT, 2.5mMATP), add ultrapure water to 9 μ L, hatch 30min at 22 DEG C; Then add 1 μ LDNA ligase enzyme 22 DEG C and connect 1h, 65 DEG C of deactivation 15min; Then in above-mentioned system, add 250 μMs of dNTP, 0.2 μ LDNA polysaccharase 1 and 10 × archaeal dna polymerase 1 damping fluid (500mMTris-HCl, pH7.5,100mMMgCl
2), 37 DEG C of amplifications 4-6h, 80 DEG C of deactivation 15min; Finally, add 1 μ L20 × DNA developer and 200 μ L1 × PBS damping fluids, under 494nm exciting light, measure the fluorescence spectrum in 520-660nm wavelength region.
5. the detection limit of actual sample
The total serum IgE of Hela cell is extracted with TROzol reagent.According to the mode sample that external detection limit is identical, replacing aforementioned MicroRNA21 to prepare total serum IgE sample concentration gradient with total serum IgE is the sample of 100ng, 50ng, 1ng, 500pg, 0pg.Equally, monitor fluorescence in real time change on real-time quantitative fluorescence PCR instrument.
SEQUENCELISTING
<110> Wuhan is along reaching bio tech ltd, Wuhan University
<120> mono-kind utilizes two-step amplification method to detect the method for MicroRNA
<130>2016
<160>7
<170>PatentInversion3.3
<210>1
<211>22
<212>RNA
<213> is unknown
<400>1
uagcuuaucagacugauguuga22
<210>2
<211>198
<212>DNA
<213> artificial sequence
<400>2
ctgataagctacgactctagaggatccccgggtacgtttccgtgtgtaaattgttatccg60
ctcacatctccacacaagtaacctctatgatatcgaattctcgctccaaacgctgcaggt120
gtgcgggcctcttcgctattaccgattaagatagctaacgccagggttttcccagtcacg180
acgttgatcaacatcagt198
<210>3
<211>21
<212>DNA
<213> is unknown
<400>3
atgatatctgaattctcgctc21
<210>4
<211>21
<212>DNA
<213> is unknown
<400>4
ctcgctccaaacgctgcaggt21
<210>5
<211>51
<212>DNA
<213> is unknown
<400>5
tcaacgtcgtgactgggaaaaccctttttgtgcgggcctcttcgctattac51
<210>6
<211>31
<212>DNA
<213> is unknown
<400>6
aattcagatatcatagaggttacttgtgtgg31
<210>7
<211>56
<212>DNA
<213> is unknown
<400>7
cgactctagaggatccccgggtacttttagatgtgagcggataacaatttacacac56
Claims (8)
1. the method utilizing two-step amplification method to detect microRNA, it is characterized in that, comprise the following steps: the first linear rolling circle amplification template of design containing restriction endonuclease sites, with target microRNA for linear rolling circle amplification template is connected into ring by linking probe, and with the rolling circle amplification template of Cheng Huan for primer carries out rolling circle amplification, the first step realizing signal is amplified; Then rolling circle amplification product restriction enzyme is cut into identical short strand, carry out ring mediated amplification with above-mentioned short strand for template, the second step realizing signal amplifies.
2. the method utilizing two-step amplification method to detect microRNA according to claim 1, is characterized in that, specifically comprise the following steps:
(1) first design the linear rolling circle amplification template of one 5 ' end phosphorylation modification for target microRNA, described linear rolling circle amplification template comprises three sections: with 5 ' end section of target microRNA one end complementation, with 3 ' end section of all the other fragment complementations of target microRNA and the centre portion containing a restriction endonuclease sites;
(2) template cyclization process: to containing target microRNA system in add DNA ligase and 5 ' end phosphorylation modification linear rolling circle amplification template, target microRNA and 5 ' holds the linear rolling circle amplification template base pair complementarity of phosphorylation modification to make 5 ' to hold the linear rolling circle amplification template of phosphorylation modification to join end to end, and obtains into the rolling circle amplification template of ring;
(3) rolling circle amplification process: with the rolling circle amplification template of Cheng Huan for primer carries out rolling circle amplification, obtain rolling circle amplification product;
(4) cutting process: rolling circle amplification product is cut into several identical short strands with restriction enzyme;
(5) ring mediated isothermal amplification process: be that template carries out ring mediated isothermal amplification with the short strand described in step (4), then adds DNA developer in ring mediated isothermal amplification product, and with real-time fluorescence quantitative PCR collection and analysing amplified signal.
3. the method utilizing two-step amplification method to detect microRNA according to claim 2, is characterized in that: the restriction endonuclease sites described in step (1) is the restriction enzyme site of EcoRI enzyme.
4. the two-step amplification method that utilizes according to Claims 2 or 3 detects the method for microRNA, it is characterized in that: the centre portion containing a restriction endonuclease sites described in step (1) is 21nt.
5. the method utilizing two-step amplification method to detect microRNA according to claim 2, it is characterized in that, template cyclization process described in step (2) is specially: to containing the linear rolling circle amplification template adding DNA ligase damping fluid and 5 ' end phosphorylation modification in the system of target microRNA, place 0.5 ~ 1 hour for 22 ~ 37 DEG C; And then add DNA ligase, 16 ~ 37 DEG C connect 2 ~ 24 hours, 65 DEG C of deactivation 15min.
6. the method utilizing two-step amplification method to detect microRNA according to claim 2, it is characterized in that, the rolling circle amplification process described in step (3) is specially: in system, add dNTP and archaeal dna polymerase, 37 DEG C of amplifications 4-6h, 80 DEG C of deactivation 15min.
7. the method utilizing two-step amplification method to detect microRNA according to claim 2, it is characterized in that, cutting process described in step (4) is specially: in system, add the restriction enzyme complementary sequence with centre portion complementation, thin up, anneal 1 hour for 95 DEG C, finally add restriction enzyme, 37 DEG C of enzymes cut 12 ~ 24 hours, 80 DEG C of deactivation 15min.
8. the method utilizing two-step amplification method to detect microRNA according to claim 2, it is characterized in that, ring mediated isothermal amplification process described in step (5) is specially: four of ring mediated isothermal amplification kinds of primers, amplification buffer joined in the short strand that step (4) obtains, 95 DEG C of heating 5min, are then quenched to 4 DEG C; Then add dNTP, archaeal dna polymerase, DNA developer, then use ultrapure water constant volume, 65 DEG C of monitoring in real time on real-time fluorescence quantitative PCR immediately; According to the time of appearance time or " S " point of inflexion on a curve, carry out quantitatively or qualitative analysis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610019896.7A CN105463110B (en) | 2016-01-13 | 2016-01-13 | A method of MicroRNA is detected using two-step amplification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610019896.7A CN105463110B (en) | 2016-01-13 | 2016-01-13 | A method of MicroRNA is detected using two-step amplification method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105463110A true CN105463110A (en) | 2016-04-06 |
| CN105463110B CN105463110B (en) | 2019-01-29 |
Family
ID=55601263
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610019896.7A Expired - Fee Related CN105463110B (en) | 2016-01-13 | 2016-01-13 | A method of MicroRNA is detected using two-step amplification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105463110B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834508A (en) * | 2017-03-17 | 2017-06-13 | 武汉大学 | The method that the hyper-branched rolling circle amplification that a kind of coupled reaction triggers detects miRNA |
| CN106868155A (en) * | 2017-03-15 | 2017-06-20 | 武汉大学 | A kind of method that utilization Exonucleolytic enzyme reaction produces primer combination dendroid rolling circle amplification Visual retrieval miRNA |
| CN110484606A (en) * | 2019-08-15 | 2019-11-22 | 中国海洋大学 | A kind of primer self-generating Rolling Circle Amplification methods that restriction enzyme mediates |
| WO2020107560A1 (en) * | 2018-11-28 | 2020-06-04 | 上海纳米技术及应用国家工程研究中心有限公司 | Method for detecting micrornas based on rolling circle amplification and dna origami |
| CN113789368A (en) * | 2020-09-29 | 2021-12-14 | 中国农业科学院农业基因组研究所 | Nucleic acid detection kit, reaction system and method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104212792A (en) * | 2014-04-22 | 2014-12-17 | 上海大学 | Nicking endonuclease-based netted rolling cycle amplification system and use thereof |
-
2016
- 2016-01-13 CN CN201610019896.7A patent/CN105463110B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104212792A (en) * | 2014-04-22 | 2014-12-17 | 上海大学 | Nicking endonuclease-based netted rolling cycle amplification system and use thereof |
Non-Patent Citations (2)
| Title |
|---|
| HAIYUN LIU等: "high specific and ultrasensitive isothermal detection of microRNA by padlock probe-based exponential rolling circle amplification", 《ANAL. CHEM.》 * |
| TIAN TIAN等: "a review: microRNA detection methods", 《ORG. BIOMOL. CHEM》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868155A (en) * | 2017-03-15 | 2017-06-20 | 武汉大学 | A kind of method that utilization Exonucleolytic enzyme reaction produces primer combination dendroid rolling circle amplification Visual retrieval miRNA |
| CN106868155B (en) * | 2017-03-15 | 2020-03-10 | 武汉大学 | Method for visually detecting miRNA (micro ribonucleic acid) by using exonuclease reaction generated primer combined with dendritic rolling circle amplification |
| CN106834508A (en) * | 2017-03-17 | 2017-06-13 | 武汉大学 | The method that the hyper-branched rolling circle amplification that a kind of coupled reaction triggers detects miRNA |
| WO2020107560A1 (en) * | 2018-11-28 | 2020-06-04 | 上海纳米技术及应用国家工程研究中心有限公司 | Method for detecting micrornas based on rolling circle amplification and dna origami |
| CN110484606A (en) * | 2019-08-15 | 2019-11-22 | 中国海洋大学 | A kind of primer self-generating Rolling Circle Amplification methods that restriction enzyme mediates |
| CN110484606B (en) * | 2019-08-15 | 2022-07-22 | 中国海洋大学 | Restriction endonuclease-mediated primer self-generation rolling circle amplification method |
| CN113789368A (en) * | 2020-09-29 | 2021-12-14 | 中国农业科学院农业基因组研究所 | Nucleic acid detection kit, reaction system and method |
| CN113789368B (en) * | 2020-09-29 | 2023-10-24 | 中国农业科学院农业基因组研究所 | Nucleic acid detection kit, reaction system and method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105463110B (en) | 2019-01-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gines et al. | Emerging isothermal amplification technologies for microRNA biosensing: Applications to liquid biopsies | |
| CN105463110A (en) | Method for utilizing two-step amplification method for detecting MicroRNA(ribonucleic acid) | |
| CN102719526B (en) | MicroRNA quantitative detection analytic method by utilizing isothermal amplification to synthesize fluorescent nano silver cluster probe | |
| EP1972693B1 (en) | Method and kit for detecting a target protein using a DNA aptamer | |
| US20080318801A1 (en) | Method and kit for evaluating rna quality | |
| EP3475449B1 (en) | Uses of a cell-free nucleic acid standards | |
| US20120045768A1 (en) | Methods and compositions to detect and differentiate small rnas in rna maturation pathway | |
| Wang et al. | Identification of Saliva Using Micro RNA Biomarkers for Forensic Purpose | |
| CN103571962B (en) | Multi-enzyme cleavage site mediated nucleic acid isothermal amplification detecting method | |
| Liu et al. | Research progress in molecular biology related quantitative methods of MicroRNA | |
| Chi et al. | CRISPR-Cas14a-integrated strand displacement amplification for rapid and isothermal detection of cholangiocarcinoma associated circulating microRNAs | |
| Chen et al. | Intracellular self-enhanced rolling circle amplification to image specific miRNAs within tumor cells | |
| WO2022117769A1 (en) | Method of detection of a target nucleic acid sequence | |
| CN109251964B (en) | Circulating microRNAs detection kit, method for specifically detecting circulating microRNAs and application | |
| CN104212792A (en) | Nicking endonuclease-based netted rolling cycle amplification system and use thereof | |
| CN104342486A (en) | MiRNA detection method and its application | |
| KR101820440B1 (en) | Method for detection of target nucleic acids | |
| CN116287129B (en) | Ultra-short chain miRNA detection method and system based on reverse-folded crRNA | |
| CN112481363A (en) | Application of mutant Aerolysin monomer in detection of RNA base sequence and RNA modification | |
| CN114250276B (en) | MicroRNA detection system and method based on exponential amplification reaction and Argonaute nuclease | |
| Huang et al. | An intramolecular DNAzyme-based amplification for miRNA analysis with improving reaction kinetics and high sensitivity | |
| CN109957611B (en) | Specific quantitative PCR reaction mixed solution, miRNA quantitative detection kit and detection method | |
| CN109576350B (en) | Kit and method for simultaneously quantifying DNA and RNA and quality control method | |
| WO2021188395A1 (en) | Padlock probe-based rolling circle amplification paired with nuclease protection for point-of-need nucleic acid detection | |
| CN113151459A (en) | Fluorescence detection method of BCR-ABL1 mutant gene T315I and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190129 Termination date: 20200113 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |