CN105463106A - Method for identifying pantoea beijingensis and used primer pair thereof - Google Patents
Method for identifying pantoea beijingensis and used primer pair thereof Download PDFInfo
- Publication number
- CN105463106A CN105463106A CN201610006534.4A CN201610006534A CN105463106A CN 105463106 A CN105463106 A CN 105463106A CN 201610006534 A CN201610006534 A CN 201610006534A CN 105463106 A CN105463106 A CN 105463106A
- Authority
- CN
- China
- Prior art keywords
- beijing
- general bacterium
- primer
- general
- bacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Abstract
The invention discloses a method for identifying pantoea beijingensis and a used primer pair thereof. The method for identifying pantoea beijingensis includes the steps that genomic deoxyribonucleic acid (DNA) of a biological sample to be detected serves as a template, a specific primer pair ATF-ATR for pantoea beijingensis is used for conducting polymerase chain reaction (PCR) amplification to obtain a PCR product, the size of the PCR product is detected, and if the PCR product contains DNA fragments of 500-700 bp, it is identified that the biological sample to be detected is or contains pantoea beijingensis; if the PCR product does not contain DNA fragments of 500-700 bp, it is identified that the biological sample to be detected is not or does not contain pantoea beijingensis. According to the specific primer pair ATF-ATR for pantoea beijingensis, a specific strip is formed only in the genomic DNA of pantoea beijingensis through amplification, no amplification product is obtained in other strains, and the specific primer pair ATF-ATR for pantoea beijingensis can be used for fast identifying pantoea beijingensis.
Description
Technical field
The present invention relates in biological technical field the method and the primer pair thereof of identifying the general bacterium in Beijing.
Background technology
China is Pleurotus eryngii large-scale planting from last century the nineties.General Pseudomonas comprises several kinds (Pantoea:insightsintoahighlyversatileanddiversegenuswithi ntheEnterobacteriaceae, FEMSMicrobiologyReviews (2015) 39:968-984) as plant growth-promoting bacteria, biocontrol microorganisms or phytopathogen.It is the serious plant disease occurred in Pleurotus eryngii industrial production at home and abroad in recent years by general microbial Pleurotus eryngii bacterial soft rot, be reported in the pathogenic bacteria of the Pleurotus eryngii soft rot of Beijing area identified and name as the general bacterium in Beijing (Pantoeabeijingensissp.nov., isolatedfromthefruitingbodyofPleurotuseryngii.Liuetal.An tonievanLeeuwenhoek (2013) 104:1039 – 1047).Pleurotus eryngii bacterial soft rot, is just difficult to control once occur at production plant, produces cause serious loss to Pleurotus eryngii industrial.The general bacterium in Beijing is also the malignant bacteria (FirstreportofPantoeabeijingensisinducedsoftrotdiseaseofP leurotusnebrodensisinChina.Xuetal.PlantDisease (2014) 98 (7): 1000) of the Pleurotus nebrodensis soft rot that Beijing area occurs.The exploitation of Beijing general bacterium quick diagnosis technology, significant to effective prevention and control of Pleurotus eryngii soft rot and Pleurotus nebrodensis soft rot.
Summary of the invention
Technical problem to be solved by this invention how to identify or the general bacterium in assistant identification Beijing (Pantoeabeijingensis).
For solving the problems of the technologies described above, the invention provides the general bacterium specific PCR primers pair in Beijing.
The general bacterium specific PCR primers in Beijing provided by the present invention is called ATF-ATR to name, is made up of primer ATF and primer ATR; Described primer ATF is the single strand dna shown in SEQIDNo.1; Described primer ATR is the single strand dna shown in SEQIDNo.2.
Present invention also offers and comprise Beijing general bacterium special primer to the reagent of the general bacterium of the qualification of ATF-ATR or assistant identification Beijing or test kit.
The reagent of the general bacterium of above-mentioned qualification or assistant identification Beijing or test kit also comprise other reagent except primer carried out needed for PCR reaction.
Present invention also offers the general bacterium special primer in Beijing to the preparation method of ATF-ATR, qualification or the reagent of the general bacterium in assistant identification Beijing or the preparation method of test kit.
Beijing provided by the present invention preparation method of general bacterium special primer to ATF-ATR comprises the step of individually being packed by described two single strand dnas of general for Beijing bacterium special primer to ATF-ATR.
The reagent of the general bacterium of qualification provided by the present invention or assistant identification Beijing or the preparation method of test kit, comprise the step of individually being packed by described two single strand dnas of general for Beijing bacterium special primer to ATF-ATR.
Present invention also offers the DNA molecular shown in SEQIDNo.3.
DNA molecular shown in SEQIDNo.3 is the specific DNA fragment of the general bacterium in Beijing.
Beijing general bacterium special primer also belongs to protection scope of the present invention to the application in qualification or the general bacterium in assistant identification Beijing of the application of ATF-ATR in qualification or the general bacterium in assistant identification Beijing, the reagent of the general bacterium of qualification or assistant identification Beijing or test kit and the application of the DNA molecular shown in SEQIDNo.3 in qualification or the general bacterium in assistant identification Beijing.
Above-mentioned application does not all comprise diagnostic method and/or the methods for the treatment of of disease.
Present invention also offers the method for qualification or the general bacterium in assistant identification Beijing.
The method of the general bacterium of qualification provided by the present invention or assistant identification Beijing, comprise with the genomic dna of biological sample to be measured for template, with the general bacterium special primer in Beijing, pcr amplification is carried out to ATF-ATR and obtain PCR primer, detect the size of described PCR primer, if described PCR primer contains the DNA fragmentation (or described PCR primer is the DNA fragmentation of 500-700bp) of 500-700bp, described biological sample to be measured is the general bacterium in Beijing or contains the general bacterium in Beijing, or described biological sample candidate to be measured contains the general bacterium in Beijing for the general bacterium in Beijing or candidate; If the DNA fragmentation (or described PCR primer be not the DNA fragmentation of 500-700bp) of described PCR primer not containing 500-700bp, described biological sample to be measured is not the general bacterium in Beijing or does not contain the general bacterium in Beijing, or described biological sample candidate to be measured is not that the general bacterium in Beijing or candidate do not contain the general bacterium in Beijing.
In the method for the general bacterium of above-mentioned qualification or assistant identification Beijing, the DNA fragmentation of described 500-700bp specifically can be the DNA fragmentation of 630bp.
Experiment proves, Beijing general bacterium special primer has only amplified specific band to ATF-ATR in the genomic dna of the general bacterium in Beijing, and in other bacterial strain, all do not obtain amplified production, Beijing general bacterium special primer can be used for the general bacterium in Rapid identification Beijing to ATF-ATR.The present invention prevents to provide technical support with the contagium and route of transmission that cut off the general microbial Pleurotus eryngii soft rot in Beijing and Pleurotus nebrodensis soft rot in time early, can realize carrying out early prevention and control to the general microbial Pleurotus eryngii soft rot in Beijing and Pleurotus nebrodensis soft rot.
Accompanying drawing explanation
Fig. 1 is the agarose gel electrophoresis figure of primer pair 16sp1-16sp2 to the pcr amplification product of general bacterium.Wherein, M:1kbplusDNAladder; 1. the general bacterium in Beijing (Pantoeabeijingensissp.nov.) JZB2120001
t; 2.PantoeagaviniaeDSM22758; 3.PantoeaeucalyptiDSM23077; 4.PantoeaanthophilaDSM23080; 5.PantoeaagglomeransDSM30072; 6PantoeadispersaDSM30073; 7.PantoeaagglomeransJCM1236; 8.PantoeaagglomeransJCM20143; 9.Pantoeapleurotisp.nov.JZB2120015
t.
Fig. 2 is that Beijing general bacterium special primer is to the agarose gel electrophoresis figure of the pcr amplification product of the general bacterium of ATF-ATR specific detection.Wherein, M:1kbplusDNAladder; 1. the general bacterium in Beijing (Pantoeabeijingensissp.nov.) JZB2120001
t; 2.PantoeagaviniaeDSM22758; 3.PantoeaeucalyptiDSM23077; 4.PantoeaanthophilaDSM23080; 5.PantoeaagglomeransDSM30072; 6PantoeadispersaDSM30073; 7.PantoeaagglomeransJCM1236; 8.PantoeaagglomeransJCM20143; 9.Pantoeapleurotisp.nov.JZB2120015
t.
Embodiment
Below in conjunction with embodiment, the present invention is further described in detail, the embodiment provided only in order to illustrate the present invention, instead of in order to limit the scope of the invention.
Experimental technique in following embodiment, if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Beijing in following embodiment general bacterium (Pantoeabeijingensissp.nov.) JZB2120001
t(i.e. LMG27579
tor KCTC32406
t) (Pantoeabeijingensissp.nov., isolatedfromthefruitingbodyofPleurotuseryngii.Liuetal.An tonievanLeeuwenhoek (2013) the 104:1039 – 1047) public can obtain this bacterial strain from Beijing City Academy Of Agriculture and Forest Sciences INST OF PLANT PROT & ENVIRONME or Belgian BCCM/LMG DSMZ or KCTC DSMZ of Korea S.
Pantoeapleurotisp.nov.JZB2120015 in following embodiment
t(Pantoeapleurotisp.nov., the IsolatedfromtheFruitingBodiesofPleurotuseryngii.Maetal.C urrentMicrobiology.19November2015) public can obtain this bacterial strain from Beijing City Academy Of Agriculture and Forest Sciences INST OF PLANT PROT & ENVIRONME or Belgian BCCM/LMG DSMZ or Chinese CGMCC DSMZ.
PantoeagaviniaeDSM22758, PantoeaeucalyptiDSM23077, PantoeaanthophilaDSM23080, PantoeaagglomeransDSM30072 and PantoeadispersaDSM30073 in following embodiment are the bacterial strain of German DSM DSMZ.
PantoeaagglomeransJCM1236 and PantoeaagglomeransJCM20143 in following embodiment is the bacterial strain of Japanese JCM DSMZ.
Embodiment 1, PCR primer pair ATF-ATR is utilized to identify the general bacterium in Beijing
1, the PCR reagent of the general bacterium in Beijing is identified
The PCR reagent of the general bacterium in qualification Beijing of the present embodiment by the general bacterium special primer in Beijing to ATF-ATR, 2 × TaqPCRMix (Bioeasy) and ddH
2o forms.
Wherein, the general bacterium special primer in Beijing is made up of ATF (upstream primer) and ATR (downstream primer) ATF-ATR, the nucleotide sequence of ATF is 5'GAGAATCTAGCTAGTCAAACCTATGGGAAC3'(SEQIDNo.1), the nucleotide sequence of ATR is 5'GATACTTTCGACATCGCGATATATTTGCCA3'(SEQIDNo.2).
2, the general bacterium in Beijing is identified
2.1, the DNA of bacterial strain is extracted
From bacterial classification (Beijing general bacterium (Pantoeabeijingensissp.nov.) JZB2120001 that-80 DEG C are preserved
t; PantoeagaviniaeDSM22758; PantoeaeucalyptiDSM23077; PantoeaanthophilaDSM23080; PantoeaagglomeransDSM30072; PantoeadispersaDSM30073; PantoeaagglomeransJCM1236; PantoeaagglomeransJCM20143 or Pantoeapleurotisp.nov.JZB2120015
t) rule in solid LB media, cultivate 20h, be connected in the test tube that LB substratum (3mL) is housed, with 200rpm28 DEG C of shaking culture 18h with the single bacterium colony of each bacterial isolates of transfering loop picking for 28 DEG C.
Each strains tested DNeasyBlood & TissueKit (QIAGEN) is extracted STb gene as pcr template, and operate according to the specification sheets of test kit, concrete steps are as follows:
1) collect 2ml inoculum, the centrifugal 1min of 12000rpm, removes supernatant.
2) add 180 μ lBufferATL, 20 μ l Proteinase Ks, 4 μ lRNaseA, 56 DEG C process 1 hour.
3) vibrate 15s, adds 200 μ lbufferAL and mix.
4) 200 μ l dehydrated alcohols are added, the centrifugal 3min of 8000rpm.
5) supernatant is collected in centrifugal column, the centrifugal 1min of 8000rpm.
6) in centrifugal column, 500 μ lBufferAW1 are added, the centrifugal 1min of 8000rpm.
7) in centrifugal column, 500 μ lBufferAW2 are added, the centrifugal 1min of 8000rpm.
8) be put into by centrifugal column on a new 1.5ml centrifuge tube, add 50 μ lBufferAE, room temperature places the centrifugal 1min of 1min, 8000rpm, and gained is the STb gene of bacterium.
2.2, pcr amplification
Respectively with 2.1 STb gene of each bacterial strains extracted for template, utilize the general bacterium special primer in Beijing of step 1 to carry out PCR to ATF-ATR.PCR reaction system (20 μ L): 10 μm of olL
-1upstream and downstream primer each 1 μ L, 2 × TaqPCRMix (Bioeasy) 10 μ L, template DNA 1 μ L, ddH
2o7 μ L.PCR reaction conditions: 95 DEG C, 5min; 95 DEG C, 30s, 66 DEG C, 30s, 72 DEG C of 1min, 30 circulations; 72 DEG C extend 10min.1% agarose gel electrophoresis detects.
Primer pair 16sp1-16sp2PCR is utilized to increase the 16srDNA fragment of each bacterial strain.Primer pair 16sp1-16sp2 is made up of 16sp1 (sequence is 5 ' AGAGTTTGATCCTGGCTCAGAACGAACGCT3 ') and 16sp2 (sequence is 5 ' TACGGCTACCTTGTTACGACTTCACCCC3 ').PCR reaction system (20 μ L): 10 μm of olL
-1upstream and downstream primer each 1 μ L, 2 × TaqPCRMix (Bioeasy) 10 μ L, template DNA 1 μ L, ddH
2o7 μ L.PCR reaction conditions: 95 DEG C, 5min; 95 DEG C, 30s, 55 DEG C, 30s, 72 DEG C of 2min, 30 circulations; 72 DEG C extend 10min.1% agarose gel electrophoresis detects.
Result shows that primer pair 16sp1-16sp2 all can amplify object band in 9 bacterial strains for examination, and the DNA extraction of strains tested respond well (Fig. 1) is described.Beijing general bacterium special primer can only with Beijing general bacterium (Pantoeabeijingensissp.nov.) JZB2120001 to ATF-ATR
tbe 500-700bp band for template amplification goes out size, other 8 bacterial strains are this 500-700bp band (Fig. 2) not.Reclaim Beijing general bacterium (Pantoeabeijingensissp.nov.) JZB2120001
t500-700bp band, check order, result shows that the size of this 500-700bp band is 630bp, and its sequence is SEQIDNo.3.Illustrate that Beijing general bacterium special primer is the special primer pair of the general bacterium in Beijing to ATF-ATR, can be used for the general bacterium in Rapid identification Beijing.
Claims (10)
1. the general bacterium special primer pair in Beijing, is made up of primer ATF and primer ATR; Described primer ATF is the single strand dna shown in SEQIDNo.1; Described primer ATR is the single strand dna shown in SEQIDNo.2.
2. qualification or the reagent of the general bacterium in assistant identification Beijing or test kit, comprise the general bacterium special primer pair in Beijing according to claim 1.
3. the preparation method that the general bacterium in Beijing according to claim 1 special primer is right, comprises the step of individually being packed by described two single strand dnas right for general for described Beijing bacterium special primer.
4. the preparation method of reagent according to claim 2 or test kit, comprises the step of individually being packed by described two single strand dnas right for general for described Beijing bacterium special primer.
5. the general bacterium in Beijing according to claim 1 special primer is to the application in qualification or the general bacterium in assistant identification Beijing.
6. reagent according to claim 2 or the application of test kit in qualification or the general bacterium in assistant identification Beijing.
7. the method for qualification or the general bacterium in assistant identification Beijing, comprise with the genomic dna of biological sample to be measured for template, PCR primer is obtained to carrying out pcr amplification with the general bacterium special primer in Beijing according to claim 1, detect the size of described PCR primer, if described PCR primer contains the DNA fragmentation of 500-700bp, described biological sample to be measured is the general bacterium in Beijing or contains the general bacterium in Beijing, or described biological sample candidate to be measured contains the general bacterium in Beijing for the general bacterium in Beijing or candidate; If the DNA fragmentation of described PCR primer not containing 500-700bp, described biological sample to be measured is not the general bacterium in Beijing or does not contain the general bacterium in Beijing, or described biological sample candidate to be measured is not that the general bacterium in Beijing or candidate do not contain the general bacterium in Beijing.
8. method according to claim 7, is characterized in that: the DNA fragmentation of described 500-700bp is the DNA fragmentation of 630bp.
DNA molecular shown in 9.SEQIDNo.3.
The application of DNA molecular shown in 10.SEQIDNo.3 in qualification or the general bacterium in assistant identification Beijing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610006534.4A CN105463106B (en) | 2016-01-04 | 2016-01-04 | Identify the method and its primer pair of the general bacterium in Beijing |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610006534.4A CN105463106B (en) | 2016-01-04 | 2016-01-04 | Identify the method and its primer pair of the general bacterium in Beijing |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105463106A true CN105463106A (en) | 2016-04-06 |
| CN105463106B CN105463106B (en) | 2019-03-08 |
Family
ID=55601259
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610006534.4A Active CN105463106B (en) | 2016-01-04 | 2016-01-04 | Identify the method and its primer pair of the general bacterium in Beijing |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105463106B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894121A (en) * | 2015-06-10 | 2015-09-09 | 中国中医科学院中药研究所 | Primer pair used for identifying peucedanum praeruptorum and application thereof |
-
2016
- 2016-01-04 CN CN201610006534.4A patent/CN105463106B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894121A (en) * | 2015-06-10 | 2015-09-09 | 中国中医科学院中药研究所 | Primer pair used for identifying peucedanum praeruptorum and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| YU LIU等: "Pantoea beijingensis sp nov., isolated from the fruiting body of Pleurotus eryngii", 《ANTONIE VAN LEEUWENHOEK》 * |
| 冯建军等: "PMA结合实时荧光PCR进行玉米细菌性枯萎病菌细胞活性检测初步研究", 《植物检疫》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105463106B (en) | 2019-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104263813A (en) | Sequences of primer for identifying fusarium solani and/or fusarium oxysporum, kit and method thereof | |
| Broda et al. | Use of restriction fragment length polymorphism analysis to differentiate strains of psychrophilic and psychrotrophic clostridia associated with ‘blown pack’spoilage of vacuum‐packed meats | |
| Rivas et al. | Rapid identification of Clavibacter michiganensis subspecies sepedonicus using two primers random amplified polymorphic DNA (TP-RAPD) fingerprints | |
| Rincón et al. | Diversity of rhizobial bacteria isolated from nodules of the gypsophyte Ononis tridentata L. growing in Spanish soils | |
| CN103014171A (en) | Method for analyzing fungus microbial community structure by utilizing specific rDNA long fragment | |
| Dekowska et al. | Genetic heterogeneity of Alicyclobacillus strains revealed by RFLP analysis of vdc region and rpoB gene | |
| CN105463105A (en) | Method for authenticating Beijing Pantoea and paired DNA molecules applied by method | |
| Fránová et al. | First report of a 16SrIII-B subgroup phytoplasma associated with leaf reddening, virescence and phyllody of purple coneflower | |
| CN105483260A (en) | Pantoea beijingensis specific primer and application thereof | |
| Corrêa et al. | Application of PCR-RFLP technique to species identification and phylogenetic analysis of Streptomyces associated with potato scab in Brazil based on partial atpD gene sequences | |
| CN105506117A (en) | Method for authenticating Peking pantoea through primer pair AHF-AHR | |
| CN105463103A (en) | Method for authenticating Beijing Pantoea | |
| CN105463106A (en) | Method for identifying pantoea beijingensis and used primer pair thereof | |
| CN105463107A (en) | Primer pair AWF-AWR for identifying pantoea beijingensis | |
| Srivastava et al. | Rapid identification of endophytic fungi of sugarcan (saccharum spp. hybrid) using PCR-RFLP of rDNA | |
| CN106801052A (en) | A kind of Isospora suis rRNA gene orders and its acquisition methods | |
| Pérez-Brito et al. | Molecular characterization of Kluyveromyces marxianus strains isolated from Agave fourcroydes (Lem.) in Yucatan, Mexico | |
| Lee et al. | Differentiation of citrus bacterial canker strains in Korea by host range, rep-PCR fingerprinting and 16S rDNA analysis | |
| KR101413121B1 (en) | Method for detecting Acidovorax citrulli | |
| CN104531695B (en) | A kind of specificity molecular marker DNA sequence of Lactobacillus casei and application thereof | |
| Tolba et al. | Molecular characterization of rare actinomycetes using 16S rRNA-RFLP | |
| KR20150014042A (en) | Marker composition for identification of Weissella viridescens | |
| Tagawa et al. | Development of a genotyping method for potato scab pathogens based on multiplex PCR | |
| CN114438257B (en) | Primer group and kit for simultaneously detecting 5 pathogenic bacteria of tobacco and application of primer group and kit | |
| CN107012242B (en) | Method for identifying Pantoea pleuroti by using primer pair K37FR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |