CN105463081A - Multiple PCR (polymerase chain reaction) detection method of tomato Ty-1 gene and ty-5 gene - Google Patents
Multiple PCR (polymerase chain reaction) detection method of tomato Ty-1 gene and ty-5 gene Download PDFInfo
- Publication number
- CN105463081A CN105463081A CN201510917791.9A CN201510917791A CN105463081A CN 105463081 A CN105463081 A CN 105463081A CN 201510917791 A CN201510917791 A CN 201510917791A CN 105463081 A CN105463081 A CN 105463081A
- Authority
- CN
- China
- Prior art keywords
- gene
- electrophoresis
- tomato
- distilled water
- detection method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a multiple PCR (polymerase chain reaction) detection method of tomato Ty-1 gene and ty-5 gene, comprising steps such as: 1) extracting from tomato leaves tomato leaf DNA to be detected; 2) subjecting a sample to be detected to multiple PCR amplification with the tomato leaf extracted DNA as a template by using primers of Ty-1 and ty-5 and building a multiple PCR system; 3) electrophoretically detecting a PCR product; 4) verifying whether the tomato sample to be detected contains Ty-1 gene and ty-5 gene. The method is used for quickly identifying whether a tomato material contains tomato yellow leaf curl disease resistant genes Ty-1 and ty-5 or not.
Description
Technical field
The present invention relates to technical field of biological, be specifically related to the multi-PCR detection method of a kind of tomato Ty-1 gene and ty-5 gene.
Background technology
Tomato is a kind of important vegetable crop, is subject to the harm that tomato yellow leaf curl virus (Tomatoyellowleafcurlvirus, TYLCV) is sick in recent years, makes the development of tomato in China industry receive serious impact.This disease is propagated by the Bemisia tabaci of carrying tomato yellowing mosaic virus, and owing to originally not containing disease-resistant gene in cultivated tomato, after plant is infected by TYLCV, growth is subject to serious suppression, easy fruit drop.If seedling stage is susceptible, when endangering serious, even cause total crop failure total crop failure, tremendous influence is caused to tomato production.And the anti-TYLCV gene found in wild-type tomato, find, to this disease, there is good resistance through qualification.
The anti-TYLCV gene of known tomato has, Ty-1, Ty-2, Ty-3, Ty-3a, Ty-4, Ty-5 and Ty-6.In the tomato variety of China, apply more disease-resistant gene is Ty-1, Ty-2, Ty-3, Ty-3a.And Ty-1, Ty-3 and Ty-3a are allelotrope, the disease-resistant gene be therefore utilized at present in tomato variety is very limited.Add TYLCV variability strong, the existing antigen of life-time service easily makes virus break through the resistance of disease-resistant gene.In the anti-TYLCV breeding process of tomato, seed selection contains the material of new antigen gene, and is polymerized by multiple anti-TYLCV gene, can strengthen the resistance level of kind significantly.But carrying out in the process of pyramiding breeding to these genes, after segregating population Resistance Identification, the anti-TYLCV plant obtained cannot be determined wherein containing having plenty of which resistant gene.Utilize the means of molecule marker, can carry out mark to the disease-resistant gene in resistant material after qualification to determine, even can not pass through Resistance Identification, which disease-resistant gene contained by just judging in plant is, accelerate the selection to breeding material, shorten the process of breeding.At present, Ty-1 gene is positioned in tomato No. 6 chromosome long arm ends, mark Ty1 and this gene linkage.Map based cloning determines that this gene and Ty-3 are allelotrope, is the dependent RNA polymerase of RNA.Ty-5 gene is positioned on tomato No. 4 karyomit(e)s, and to mark SlNAC1 chain with CAPS, and this mark is also known unique and molecule marker that ty-5 is chain at present.
Although utilizing the molecule marker of Ty-1 and ty-5 to carry out assisted Selection can accelerate the screening containing genetic material, but need to carry out two-wheeled PCR detection and just can complete screening to material, if the multiplex PCR system of these two genes can be set up, on original basis, working efficiency can be doubled, appraisal cost reduces half, advantageously in the screening of enantiopathy gene.But the linked marker of current Ty-1 gene by analysis after, due to the difference of labeling pattern and restriction endonuclease, all cannot set up multiplex PCR system with ty-5 gene.
Summary of the invention
For overcoming the defect of prior art, the object of the present invention is to provide the multi-PCR detection method of a kind of tomato Ty-1 gene and ty-5 gene, for whether containing tomato yellow leaf curl resistant gene Ty-1 and ty-5 in Rapid identification tomato material.
For achieving the above object, the technical solution adopted in the present invention is as follows:
A multi-PCR detection method for tomato Ty-1 gene and ty-5 gene, it comprises the following steps:
1) from tomato leaf, tomato leaf DNA to be detected is extracted;
2) extract the DNA of acquisition for template with above-mentioned tomato leaf, utilize the primer of Ty-1 and ty-5, by the multi-PRC reaction system set up, multiplexed PCR amplification is carried out to testing sample;
3) PCR primer electrophoresis detection;
4) whether identify containing Ty-1 gene and ty-5 gene in tomato sample to be measured.
Further scheme, step 1 of the present invention) in tomato leaf take from the tomato leaf of breeding, wild, segregating population tomato variety.
Further scheme, step 2 of the present invention) in,
Ty-1 primer is:
Ty1-F:CAACAGCAATGTACCTGGTCAG
Ty1-R:CTGTGGCATACGTTGGTGACAC；
Ty-5 primer is:
ty5-17R：TAACAAAGCCCTCAAAGC
ty5-17F：GTCTCCGAAACGTAATCC。
Further scheme, step 2 of the present invention) in, multi-PRC reaction system is:
10ng/ μ L template DNA 2 μ L,
The each 0.3 μ L of primer Ty1-F/R and ty5-17R/F of 4pmmol/L,
Mix enzyme 10 μ L,
Distilled water or tri-distilled water add to 20 μ L;
Multi-PRC reaction condition is: 95 DEG C of denaturation 3min; Each circulation 95 DEG C of sex change 45sec, 54 DEG C of annealing 45sec, 72 DEG C extend 45sec, totally 38 circulations, and last 72 DEG C extend 10min.
Further scheme, step 3 of the present invention) in, electrophoresis adopts the polyacrylamide gel of 8%, and the concrete steps of electrophoresis comprise:
A) prepare polyacrylamide gel: KOH solution soaks sheet glass certain hour, with stain remover and clean water clean, finally rinse with distilled water, dry rear ethanol length plate; Then by long slab treated side upwards, short slab treated side, to lower cover on long slab, fixes two plates with India-rubber strip, insert vertical electrophoresis apparatus support, short slab is fixed inwards, and namely notched plate is towards electrophoresis liquid direction, the gap between the agarose sealing rubber strip with 1% and sheet glass; Acrylamide soln 30% add 10 × TBE, distilled water, TEMED and 10% APS be configured to 8% polyacrylamide solution; Then electrophoresis chamber is tilted 30 degree, gently make polyacrylamide solution pour between two plates, when waiting sol solution soon to overflow, sheet glass is set level, catch up with bubble with plastic board, fall to insert comb; After having filled with glue, be put in room temperature and allow its natural coagulation, observe glue edge and occur that refracted ray just shows that glue solidifies;
B) polyacrylamide gel electrophoresis: fall 1xTB under electrophoresis apparatus in end slot, upwards groove falls 1 × TBE, makes liquid level higher than edge on short slab, extracts comb, and draw appropriate electrophoresis liquid loading wells wash clean with syringe; Get PCR primer loading; Regulating voltage 160V, electrophoresis 1.5-2.0h, electrophoresis is complete;
C) colour developing of polyacrylamide gel electrophoresis: the offset plate through cooling is placed in the vinyl disc filling stationary liquid, shaking table concussion 3-8min; Then offset plate is placed in the vinyl disc filling staining fluid, shaking table concussion 10-15min; Dyed offset plate distilled water cleans, then with the addition of the Na that concentration is 10%
2s
2o
3distilled water cleaning; The offset plate cleaned up is placed in nitrite ion develop the color, after clear to DNA band, the complete offset plate of colour developing is put back in stationary liquid and react, reacted the cleaning of rear distilled water, then with preservative film sealing, be placed in natural drying at room temperature, band statistics, retention of taking pictures.
Further scheme, stationary liquid of the present invention is made up of 0.5% acetic acid 2.5mL, 10% ethanol 50mL, distilled water 450mL; Described staining fluid is made up of Silver Nitrate and distilled water, and wherein the mass ratio of Silver Nitrate and distilled water is 1:500.
Further scheme, described nitrite ion of the present invention is made up of formaldehyde 1.5mL, the distilled water 500mL of 7.5gNaOH, 37%-40%.
Further scheme, step 4 of the present invention) in, carrying out authentication method concrete steps to Ty-1 gene in testing sample and ty-5 gene is: in step 3) enzyme cut after polymorphic bands in find out greatly 750bp and 172bp band, i.e. respectively corresponding Ty-1 gene and ty-5 gene.
Compared to existing technology, beneficial effect of the present invention is:
1., in the multi-PCR detection method of tomato Ty-1 gene of the present invention and ty-5 gene, PCR system adopts the ty5-17 primer of amplification ty-5 gene compared with SLNACI, and restriction enzyme site reduces, and reaction system stability is higher;
2. the multi-PCR detection method of tomato Ty-1 gene of the present invention and ty-5 gene detects the foundation of ty-5 and Ty-1 system simultaneously, accelerates the process to molecular marker assisted selection, shortens breeding cycle, reduces breeding cost;
3. the multi-PCR detection method of tomato Ty-1 gene of the present invention and ty-5 gene cannot determine the puzzlement containing which disease-resistant gene after overcoming and carrying out Resistance Identification to Liang Ge gene isolation colony;
4. the multi-PCR detection method of tomato Ty-1 gene of the present invention and ty-5 gene can reduce using of chemical pesticide in production process, alleviate the spread and epidemic of disease, save production cost, ensure carrying out smoothly of tomato production, improve the economic benefit of tomato industry.
Accompanying drawing explanation
Fig. 1 ty-5 and Ty-1 detects electrophoretogram; Wherein M:100bpMarker; 1,2,3 represent respectively ty5-17 with 1227, moneymaker and F1 (1227 × moneymaker) TY52, moneymaker and F1 (TY52 × moneymaker) be for template amplification result; 4,5,6 Ty1 is represented respectively with TY52, moneymaker and F1 (TY52 × moneymaker) for template amplification result; 7 represent multiplex PCR system with F1 (1227 × TY52) for template amplification result;
Fig. 2 F2 (1227 × TY52) is separated offspring's multiplex PCR and detects electrophoretogram; Wherein M:100bpMarker; 1-19 represents the random F2 of 19 strains (1227 × TY52) and is separated individual plant through multiplexed PCR amplification rear electrophoresis result.
Embodiment
Below in conjunction with concrete embodiment, the present invention is described in further detail.
A multi-PCR detection method for tomato Ty-1 gene and ty-5 gene, it comprises the following steps:
1) tomato leaf DNA to be detected is extracted;
2) extract the DNA of acquisition for template with above-mentioned tomato leaf, utilize the primer of Ty-1 and ty-5, by the multi-PRC reaction system set up, multiplexed PCR amplification is carried out to testing sample;
Wherein the reaction system of multiplex PCR is:
10ng/ μ L template DNA 2 μ L,
The each 0.3 μ L of primer Ty1-F/R and ty5-17R/F of 4pmmol/L,
Mix enzyme 10 μ L,
Distilled water or tri-distilled water add to 20 μ L;
In PCR reaction system, the primer is:
Ty1-F:CAACAGCAATGTACCTGGTCAG
Ty1-R:CTGTGGCATACGTTGGTGACAC
ty5-17R：TAACAAAGCCCTCAAAGC
ty5-17F：GTCTCCGAAACGTAATCC；
The reaction conditions of multiplex PCR is:
95 DEG C of denaturation 3min; Each circulation 95 DEG C of sex change 45sec, 54 DEG C of annealing 45sec, 72 DEG C extend 45sec, totally 38 circulations, and last 72 DEG C extend 10min;
3) PCR primer electrophoresis detection;
A) prepare polyacrylamide gel, step is as follows:
Sheet glass process: KOH solution soaks sheet glass certain hour, with stain remover and clean water clean, finally rinse twice with distilled water; Naturally dry; With 95% ethanol length plate;
Fastening glass panels: upwards, short slab treated side, to lower cover on long slab, fixes two plates with India-rubber strip to long slab treated side, insert vertical electrophoresis apparatus support, short slab is fixed inwards, and namely notched plate is towards electrophoresis liquid direction, the gap between the agarose sealing rubber strip with 1% and sheet glass.
Prepare 8% acrylamide sol solution: 30% acrylamide soln: 5.3mL; 10 × TBE:2mL; Distilled water: 12.7mL; TEMED:20 μ L; 10%APS:200 μ L;
Encapsulating: tilted 30 degree by electrophoresis chamber, gently make sol solution pour between two plates, when waiting sol solution soon to overflow, sheet glass is set level, catch up with bubble with plastic board, falls to insert comb;
Solidify: after having filled with glue, be put in room temperature and allow its natural coagulation, observe glue edge and occur that refracted ray just shows that glue solidifies; Gel can use immediately, or is stored in room temperature 24 hours, 4 DEG C 48 hours;
B) polyacrylamide gel electrophoresis step is as follows:
Fall liquid: the 1xTBE that falls in end slot under electrophoresis apparatus is about 500mL, and upwards groove falls 1 × TBE, makes liquid level higher than edge on short slab.Extract comb, and draw appropriate electrophoresis liquid loading wells wash clean (because after comb taking-up with syringe, comb adsorbs and the unpolymerized acrylamide in gel top can flow into polymerization in well, and produce irregular surface, after causing, DNA electrophoresis banding pattern is irregular);
Loading: get 1.6 μ LPCR product loadings; Regulating voltage 160V, electrophoresis 1.5-2.0h; Electrophoresis is complete, turns off electrophoresis apparatus, takes off sheet glass;
C) colour developing of polyacrylamide gel electrophoresis, step is as follows:
Fixing: stationary liquid is made up of 0.5% acetic acid 2.5mL, distilled water 450mL, 10% ethanol 50mL; Offset plate through cooling is placed in and contains the above-mentioned vinyl disc having the 1.5L of stationary liquid, shaking table concussion about 6min;
Dyeing: staining fluid is made up of Silver Nitrate 1g, distilled water 500mL; The offset plate cleaned up is placed in the vinyl disc filling staining fluid, shaking table concussion about 12min;
Wash glue: dyed offset plate is placed in the vinyl disc filling 500mL distilled water and cleans 30s; Outwell scavenging solution, add 500mL distilled water, in distilled water, add the Na of 120 μ L10%
2s
2o
3, cleaning 30s;
Colour developing: nitrite ion is made up of 7.5gNaOH, 37%-40% formaldehyde 1.5mL, distilled water 500mL; The offset plate cleaned up is placed in the vinyl disc filling nitrite ion develop the color; Developing time, according to band and the adjustment of the background color depth, reaches DNA band object (general 5-6min) clearly; Nitrite ion with before first can be chilled to 4-10 DEG C in advance, prevent background from deepening;
Color development stopping: the complete offset plate of dyeing is put back to and fills in the vinyl disc of stationary liquid, reaction 3min; With distilled water cleaning twice, each 2min;
Dry glue: offset plate preservative film seals, and is placed in natural drying at room temperature; Band statistics, retention of taking pictures;
4) whether identify containing Ty-1 and ty-5 in tomato sample to be measured:
Polymorphic bands size after multiplex PCR is followed successively by from small to large: 172bp and 187bp (ty-5 polymorphic bands) and 630bp and 750bp (Ty-1 polymorphic bands); If when having 750bp and/or 172bp band in electrophoresis result, illustrate in testing sample containing Ty-1 and/or ty-5; If only have 750bp and 172bp band in electrophoresis result, during without 630bp and 187bp band, testing sample is described simultaneously containing Ty-1 and ty-5 isozygotied; If there is 750bp and/or 172bp band in electrophoresis result, time simultaneously containing 630bp and/or 187bp band, illustrate that testing sample contains Ty-1 and/or ty-5 of heterozygosis; If only have 630bp and 187bp band in electrophoresis result, during without 750bp and 172bp band, testing sample is described not containing Ty-1 and ty-5.
Be below specific embodiment of the present invention, in the following embodiments, the reagent adopted, raw material all can be obtained by buying pattern.
Embodiment 1
The present embodiment in order to detect structure multiplex PCR system electrophoresis after band whether there is overlap, covering, concrete implementation step is as follows:
1) tomato leaf DNA is extracted
Detected materials: 1227 (containing the ty-5 that isozygotys, not containing Ty-2), moneymaker (not containing ty-5 and Ty-2), F1 (1227 × moneymaker) be (containing heterozygosis ty-5, not containing Ty-2), TY52 is (containing the Ty-1 that isozygotys, not containing ty-5), F1 (TY52 × moneymaker) (containing heterozygosis Ty-1, not containing ty-5), F1 (1227 × TY52) (containing heterozygosis Ty-1 and heterozygosis ty-5);
2) extract the DNA of acquisition for template with above-mentioned tomato leaf, utilize the primer of Ty-1 and ty-5, the PCR reaction system increased separately by multi-PRC reaction system and each gene of foundation, is increased to testing sample;
Wherein sample F 1 (1227 × TY52) utilizes the reaction system of multiplex PCR to increase,
Reaction system is:
10ng/ μ L template DNA 2 μ L,
The each 0.3 μ L of primer Ty1-F/R and ty5-17R/F of 4pmmol/L,
Mix enzyme 10 μ L,
Distilled water or tri-distilled water add to 20 μ L;
In PCR reaction system, the primer is:
Ty1-F:CAACAGCAATGTACCTGGTCAG
Ty1-R:CTGTGGCATACGTTGGTGACAC
ty5-17R：TAACAAAGCCCTCAAAGC
ty5-17F：GTCTCCGAAACGTAATCC；
Reaction conditions is: 95 DEG C of denaturation 3min; Each circulation 95 DEG C of sex change 45sec, 54 DEG C of annealing 45sec, 72 DEG C extend 45sec, totally 38 circulations, and last 72 DEG C extend 10min;
Utilize that ty5-17 marks 1227, moneymaker and F1 (1227 × moneymaker) increases, utilize Ty1 to mark and TY52, moneymaker and F1 (TY52 × moneymaker) are increased;
Amplification system is:
10ng/ μ L template DNA 2 μ L,
The each 0.2 μ L of primer Ty1-F/R and ty5-17R/F of 4pmmol/L,
Mix enzyme 10 μ L,
Distilled water or tri-distilled water add to 20 μ L;
Reaction conditions is 94 DEG C of denaturation 3min; 94 DEG C of sex change 45sec in each circulation, 48 DEG C of annealing 45sec, 72 DEG C extend 45sec, totally 38 circulations, and last 72 DEG C extend 10min;
3) PCR primer electrophoresis detection, comprises
A) prepare polyacrylamide gel, step is as follows:
Sheet glass process: KOH solution soaks sheet glass certain hour, with stain remover and clean water clean, finally rinse twice with distilled water; Naturally dry; With 95% ethanol length plate;
Fastening glass panels: upwards, short slab treated side, to lower cover on long slab, fixes two plates with India-rubber strip to long slab treated side, insert vertical electrophoresis apparatus support, short slab is fixed inwards, and namely notched plate is towards electrophoresis liquid direction, the gap between the agarose sealing rubber strip with 1% and sheet glass;
Prepare 8% acrylamide sol solution: 30% acrylamide soln: 5.3mL; 10xTBE:2mL; Distilled water: 12.7mL; TEMED:20 μ L; 10%APS:200 μ L;
Encapsulating: tilted 30 degree by electrophoresis chamber, gently make sol solution pour between two plates, when waiting sol solution soon to overflow, sheet glass is set level, catch up with bubble with plastic board, falls to insert comb;
Solidify: after having filled with glue, be put in room temperature and allow its natural coagulation, observe glue edge and occur that refracted ray just shows that glue solidifies; Gel can use immediately, or is stored in room temperature 24 hours, 4 DEG C 48 hours;
B) polyacrylamide gel electrophoresis step is as follows:
Fall liquid: the 1 × TBE that falls in end slot under electrophoresis apparatus is about 500mL, and upwards groove falls 1 × TBE, makes liquid level higher than edge on short slab; Extract comb, and draw appropriate electrophoresis liquid loading wells wash clean (because after comb taking-up with syringe, comb adsorbs and the unpolymerized acrylamide in gel top can flow into polymerization in well, and produce irregular surface, after causing, DNA electrophoresis banding pattern is irregular);
Loading: get 1.6 μ LPCR product loadings; Regulating voltage 160V, electrophoresis 1.5h, electrophoresis is complete, turns off electrophoresis apparatus, takes off sheet glass;
C) colour developing of polyacrylamide gel electrophoresis, step is as follows:
Fixing: stationary liquid is made up of 0.5% acetic acid 2.5mL, distilled water 450mL, 10% ethanol 50mL; Offset plate through cooling is placed in and contains the above-mentioned vinyl disc having the 1.5L of stationary liquid, shaking table concussion about 6min;
Dyeing: staining fluid is made up of Silver Nitrate 1g, distilled water 500mL; The offset plate cleaned up is placed in the vinyl disc filling staining fluid, shaking table concussion about 12min;
Wash glue: dyed offset plate is placed in the vinyl disc filling 500mL distilled water and cleans 30s; Outwell scavenging solution, add 500mL distilled water, in distilled water, add 120 μ L10%Na
2s
2o
3, cleaning 30s;
Colour developing: nitrite ion is made up of 7.5gNaOH, 37%-40% formaldehyde 1.5mL, distilled water 500mL; The offset plate cleaned up is placed in the vinyl disc filling nitrite ion develop the color; Developing time, according to band and the adjustment of the background color depth, reaches DNA band object (5-6min) clearly; Nitrite ion with before first can be chilled to 4-10 DEG C in advance, prevent background from deepening;
Color development stopping: the complete offset plate of dyeing is put back to and fills in the vinyl disc of stationary liquid, reaction 3min; With distilled water cleaning twice, each 2min;
Dry glue: offset plate preservative film seals, and is placed in natural drying at room temperature; Band statistics, retention of taking pictures;
4) contrast electrophoresis result and carry out interpretation of result:
Utilize separately that ty5-17 marks 1227, moneymaker and F1 (1227 × moneymaker) carry out amplification and obtain polymorphic bands size and be respectively: lane1,172bp; Lane2,187bp; Lane3,172bp and 187bp; Increase to TY52, moneymaker and F1 (TY52 × moneymaker) with Ty-1 mark, obtaining polymorphic bands size is respectively: lane4,750bp; Lane5,630bp; Lane6,630bp and 750bp; Utilize multiplex PCR system to carry out amplification to F1 (1227 × TY52) to obtain polymorphic bands size and be: lane7,172bp, 187bp, 630bp and 750bp, electrophoresis result is see Fig. 1.
Embodiment 2
The multiplex PCR system result after isolation in generation of the present embodiment in order to detect structure, concrete implementation step is as follows:
(1) tomato leaf DNA is extracted
Detected materials: F2 (1227 × TY52), carries out individual plant sampling to all plant to be measured;
(2) extract the DNA of acquisition for template with above-mentioned tomato leaf, utilize the primer of Ty-1 and ty-5, by the multi-PRC reaction system set up, testing sample is increased;
PCR amplification system is:
10ng/ μ L template DNA 2 μ L,
The each 0.3 μ L of primer Ty1-F/R and ty5-17R/F of 4pmmol/L,
Mix enzyme 10 μ L,
Distilled water or tri-distilled water add to 20 μ L;
In PCR reaction system, the primer is:
Ty1-F:CAACAGCAATGTACCTGGTCAG
Ty1-R:CTGTGGCATACGTTGGTGACAC
ty5-17R：TAACAAAGCCCTCAAAGC
ty5-17F：GTCTCCGAAACGTAATCC；
Response procedures is 95 DEG C of denaturation 3min; Each circulation 95 DEG C of sex change 45sec, 54 DEG C of annealing 45sec, 72 DEG C extend 45sec, totally 38 circulations, and last 72 DEG C extend 10min;
(3) PCR primer electrophoresis detection; Comprise
A) prepare polyacrylamide gel, step is as follows:
Sheet glass process: KOH solution soaks sheet glass certain hour, with stain remover and clean water clean, finally rinse twice with distilled water; Naturally dry; With 95% ethanol length plate;
Fastening glass panels: upwards, short slab treated side, to lower cover on long slab, fixes two plates with India-rubber strip to long slab treated side, insert vertical electrophoresis apparatus support, short slab is fixed inwards, and namely notched plate is towards electrophoresis liquid direction, the gap between the agarose sealing rubber strip with 1% and sheet glass;
Prepare 8% acrylamide sol solution: 30% acrylamide soln: 5.3mL; 10 × TBE:2mL; Distilled water: 12.7mL; TEMED:20 μ L; 10%APS:200 μ L;
Encapsulating: tilted 30 degree by electrophoresis chamber, gently make sol solution pour between two plates, when waiting sol solution soon to overflow, sheet glass is set level, catch up with bubble with plastic board, falls to insert comb.
Solidify: after having filled with glue, be put in room temperature and allow its natural coagulation, observe glue edge and occur that refracted ray just shows that glue solidifies; Gel can use immediately, or is stored in room temperature 24 hours, 4 DEG C 48 hours;
B) polyacrylamide gel electrophoresis step is as follows:
Fall liquid: the 1 × TBE that falls in end slot under electrophoresis apparatus is about 500mL, and upwards groove falls 1 × TBE, makes liquid level higher than edge on short slab.Extract comb, and draw appropriate electrophoresis liquid loading wells wash clean (because after comb taking-up with syringe, comb adsorbs and the unpolymerized acrylamide in gel top can flow into polymerization in well, and produce irregular surface, after causing, DNA electrophoresis banding pattern is irregular);
Loading: get 1.6 μ LPCR product loadings; Regulating voltage 160V, electrophoresis 2.0h electrophoresis is complete, turns off electrophoresis apparatus, takes off sheet glass;
C) colour developing of polyacrylamide gel electrophoresis, step is as follows:
Fixing: stationary liquid is made up of 0.5% acetic acid 2.5mL, distilled water 450mL, 10% ethanol 50mL; Offset plate through cooling is placed in and contains the above-mentioned vinyl disc having the 1.5L of stationary liquid, shaking table concussion about 6min;
Dyeing: staining fluid is made up of Silver Nitrate 1g, distilled water 500mL; The offset plate cleaned up is placed in the vinyl disc filling staining fluid, shaking table concussion about 12min;
Wash glue: dyed offset plate is placed in the vinyl disc filling 500mL distilled water and cleans 30s; Outwell scavenging solution, add 500mL distilled water, in distilled water, add the Na of 120 μ L10%
2s
2o
3, cleaning 30s;
Colour developing: nitrite ion is made up of 7.5gNaOH, 37%-40% formaldehyde 1.5mL, distilled water 500mL; The offset plate cleaned up is placed in the vinyl disc filling nitrite ion develop the color; Developing time, according to band and the adjustment of the background color depth, reaches DNA band object (general 5-6min) clearly; Nitrite ion with before first can be chilled to 4-10 DEG C in advance, prevent background from deepening;
Color development stopping: the complete offset plate of dyeing is put back to and fills in the vinyl disc of stationary liquid, reaction 3min.With distilled water cleaning twice, each 2min;
Dry glue: offset plate preservative film seals, and is placed in natural drying at room temperature; Band statistics, retention of taking pictures;
(4) contrast electrophoresis result and carry out interpretation of result;
Electrophoresis result as shown in Figure 2, wherein 1,13 represents containing the ty-5 isozygotied in individual plant, without Ty-1 respectively; 2,11 represent containing the Ty-1 that isozygotys in individual plant, heterozygosis ty-5; 3,10,12 represent in individual plant without Ty-1 and ty-5; 4,7,9,14,17,19 represent in individual plant containing heterozygosis Ty-1 and ty-5; 5,15 represent containing heterozygosis ty-5 in individual plant, without Ty-1; 6,16 represent containing the Ty-1 that isozygotys in individual plant, not containing ty-5; 8 represent containing the ty-5 that isozygotys in individual plant, heterozygosis Ty-1; 18 represent containing the Ty-1 that isozygotys in individual plant, not containing ty-5.
Above-mentioned embodiment is only the preferred embodiment of the present invention; can not limit the scope of protection of the invention with this, change and the replacement of any unsubstantiality that those skilled in the art does on basis of the present invention all belong to the present invention's scope required for protection.
Claims (8)
1. a multi-PCR detection method for tomato Ty-1 gene and ty-5 gene, is characterized in that, it comprises the following steps:
1) from tomato leaf, tomato leaf DNA to be detected is extracted;
2) extract the DNA of acquisition for template with above-mentioned tomato leaf, utilize the primer of Ty-1 and ty-5, by the multi-PRC reaction system set up, multiplexed PCR amplification is carried out to testing sample;
3) PCR primer electrophoresis detection;
4) whether identify containing Ty-1 gene and ty-5 gene in tomato sample to be measured.
2. multi-PCR detection method according to claim 1, is characterized in that, step 1) in tomato leaf take from the tomato leaf of breeding, wild, segregating population tomato variety.
3. multi-PCR detection method according to claim 1, is characterized in that, step 2) in,
Ty-1 primer is:
Ty1-F:CAACAGCAATGTACCTGGTCAG
Ty1-R:CTGTGGCATACGTTGGTGACAC；
Ty-5 primer is:
ty5-17R：TAACAAAGCCCTCAAAGC
ty5-17F：GTCTCCGAAACGTAATCC。
4. multi-PCR detection method according to claim 1, is characterized in that, step 2) in, multi-PRC reaction system is:
10ng/ μ L template DNA 2 μ L,
The each 0.3 μ L of primer Ty1-F/R and ty5-17R/F of 4pmmol/L,
Mix enzyme 10 μ L,
Distilled water or tri-distilled water add to 20 μ L;
Multi-PRC reaction condition is: 95 DEG C of denaturation 3min; Each circulation 95 DEG C of sex change 45sec, 54 DEG C of annealing 45sec, 72 DEG C extend 45sec, totally 38 circulations, and last 72 DEG C extend 10min.
5. multi-PCR detection method according to claim 1, is characterized in that, step 3) electrophoresis adopt 8% polyacrylamide gel, the concrete steps of electrophoresis comprise:
A) prepare polyacrylamide gel: KOH solution soaks sheet glass certain hour, with stain remover and clean water clean, finally rinse with distilled water, dry rear ethanol length plate; Then by long slab treated side upwards, short slab treated side, to lower cover on long slab, fixes two plates with India-rubber strip, insert vertical electrophoresis apparatus support, short slab is fixed inwards, and namely notched plate is towards electrophoresis liquid direction, the gap between the agarose sealing rubber strip with 1% and sheet glass; Acrylamide soln 30% add 10 × TBE, distilled water, TEMED and 10% APS be configured to 8% polyacrylamide solution; Then electrophoresis chamber is tilted 30 degree, gently make polyacrylamide solution pour between two plates, when waiting sol solution soon to overflow, sheet glass is set level, catch up with bubble with plastic board, fall to insert comb; After having filled with glue, be put in room temperature and allow its natural coagulation, observe glue edge and occur that refracted ray just shows that glue solidifies;
B) polyacrylamide gel electrophoresis: fall 1 × TB under electrophoresis apparatus in end slot, upwards groove falls 1 × TBE, makes liquid level higher than edge on short slab, extracts comb, and draw appropriate electrophoresis liquid loading wells wash clean with syringe; Get PCR primer loading; Regulating voltage 160V, electrophoresis 1.5-2.0h, electrophoresis is complete;
C) colour developing of polyacrylamide gel electrophoresis: the offset plate through cooling is placed in the vinyl disc filling stationary liquid, shaking table concussion 3-8min; Then offset plate is placed in the vinyl disc filling staining fluid, shaking table concussion 10-15min; Dyed offset plate distilled water cleans, then with the addition of the Na that concentration is 10%
2s
2o
3distilled water cleaning; The offset plate cleaned up is placed in nitrite ion develop the color, after clear to DNA band, the complete offset plate of colour developing is put back in stationary liquid and react, reacted the cleaning of rear distilled water, then with preservative film sealing, be placed in natural drying at room temperature, band statistics, retention of taking pictures.
6. according to claim 5 multi-PCR detection method, it is characterized in that, described stationary liquid is made up of 0.5% acetic acid 2.5mL, 10% ethanol 50mL, distilled water 450mL; Described staining fluid is made up of Silver Nitrate and distilled water, and wherein the mass ratio of Silver Nitrate and distilled water is 1:500.
7. according to claim 5 multi-PCR detection method, it is characterized in that, described nitrite ion is made up of formaldehyde 1.5mL, the distilled water 500mL of 7.5gNaOH, 37%-40%.
8. multi-PCR detection method according to claim 1, it is characterized in that, step 4) authentication method concrete steps carried out to Ty-1 gene in testing sample and ty-5 gene be: in step 3) enzyme cut after polymorphic bands in find out greatly 750bp and 172bp band, i.e. corresponding Ty-1 gene and ty-5 gene respectively.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510917791.9A CN105463081B (en) | 2015-12-10 | 2015-12-10 | A kind of multi-PCR detection method of tomato Ty-1 genes and ty-5 genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510917791.9A CN105463081B (en) | 2015-12-10 | 2015-12-10 | A kind of multi-PCR detection method of tomato Ty-1 genes and ty-5 genes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105463081A true CN105463081A (en) | 2016-04-06 |
| CN105463081B CN105463081B (en) | 2018-08-24 |
Family
ID=55601234
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510917791.9A Active CN105463081B (en) | 2015-12-10 | 2015-12-10 | A kind of multi-PCR detection method of tomato Ty-1 genes and ty-5 genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105463081B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106939339A (en) * | 2017-03-24 | 2017-07-11 | 上海交通大学 | The Multiplex PCR of tomato Ty 1, Ty 3 and Mi genes is detected simultaneously |
| CN108522275A (en) * | 2018-03-06 | 2018-09-14 | 山东寿光蔬菜种业集团有限公司 | A kind of disease-resistant homozygotic breeding method of tomato |
| CN110511948A (en) * | 2019-09-18 | 2019-11-29 | 华中农业大学 | A kind of gene and its application controlling tomato photosynthesis and light respiration |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101638683A (en) * | 2008-07-28 | 2010-02-03 | 上海市农业科学院 | Dual-PCR method for detecting tomato TY-1 gene and Mi gene at the same time |
| CN104726602B (en) * | 2015-04-07 | 2017-09-29 | 上海孙桥现代农业联合发展有限公司 | Identify tomato yellow leaf curl virus resistant gene Ty 1 molecule labelling method |
-
2015
- 2015-12-10 CN CN201510917791.9A patent/CN105463081B/en active Active
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106939339A (en) * | 2017-03-24 | 2017-07-11 | 上海交通大学 | The Multiplex PCR of tomato Ty 1, Ty 3 and Mi genes is detected simultaneously |
| CN108522275A (en) * | 2018-03-06 | 2018-09-14 | 山东寿光蔬菜种业集团有限公司 | A kind of disease-resistant homozygotic breeding method of tomato |
| CN108522275B (en) * | 2018-03-06 | 2021-06-04 | 山东寿光蔬菜种业集团有限公司 | Method for cultivating disease-resistant homozygote of tomato |
| CN110511948A (en) * | 2019-09-18 | 2019-11-29 | 华中农业大学 | A kind of gene and its application controlling tomato photosynthesis and light respiration |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105463081B (en) | 2018-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105463081A (en) | Multiple PCR (polymerase chain reaction) detection method of tomato Ty-1 gene and ty-5 gene | |
| CN105296648B (en) | Fox derived component identify and animal product in fox, rabbit, dog ingredient multiple PCR detection kit | |
| CN107190096A (en) | The general molecular labeled primer and its joint development methods and applications of trees | |
| CN108118096A (en) | A kind of yak and Carnis Bovis seu Bubali source property discrimination method and its identification reagent box | |
| CN108950052A (en) | With the InDel label of cabbage type rape floral leaf gene linkage and application | |
| CN103103184A (en) | SSR (Simples sequence repeats) and InDel (insertion/deletion) molecular marker primer linked with brassica campestris orange head gene Br-or, and application thereof | |
| CN106148559A (en) | The multiple PCR primer system of a kind of five kinds of animal derived materials of synchronous detecting and detection method | |
| CN104805179B (en) | A kind of molecular labeling and preparation method and application with cabbage type rape grain re-association | |
| CN103667427A (en) | Primer sequence for authenticating resistance of strawberry genetic resource anthracnose and authentication method thereof | |
| CN105331715A (en) | Primers for detecting SSR (simple sequence repeat) marks of prunus pseudocerasus | |
| CN108165647A (en) | A kind of molecule labelling method for being used to identify Chinese cabbage SUZHOUQING(sic), short-foot Huang, Wuta-tsai | |
| CN105463079A (en) | Multiplex PCR (polymerase chain reaction) detection method of tobacco Ty-3 gene and Ty-5 gene | |
| CN111041126A (en) | Polymorphic molecular marker for identifying series cotton varieties in new land and application thereof | |
| CN105463080A (en) | Multiplex PCR (polymerase chain reaction) detection method of tobacco Ty-2 gene and Ty-5 gene | |
| CN105463082B (en) | A kind of multi-PCR detection method of tomato Mi-1 genes and ty-5 genes | |
| CN101671731A (en) | Simple, rapid and efficient agarose gel electrophoresis method for detecting plant molecular marker | |
| CN105018614B (en) | Radix Paeoniae Alba kind detection method | |
| CN106282362A (en) | The application to developing and in cultivar identification of the Rhizoma Dioscoreae esculentae SSR primer | |
| CN104293922B (en) | With the closely linked molecule marker GmSSR18-24 of Soybean Resistance To Rust ospc gene and application | |
| CN108531477A (en) | The foundation of allium main vegetables crop chloroplast DNA extracting method and its quality evaluation system | |
| CN103555719B (en) | With the closely linked SSR marker of black streaked dwarf virus of rice Resistance QTL and application thereof on No. 11 karyomit(e)s | |
| CN112609016A (en) | Method for identifying or assisting in identifying whether soybean contains male sterile gene and application thereof | |
| CN108130378B (en) | SNP (Single nucleotide polymorphism) marker related to sweet and sour flavor character of peach fruit and application thereof | |
| CN105349535B (en) | The specific primer and classifying method of I class mhc gene of the antiviral potentiality detection of Chinese alligator | |
| CN110734985A (en) | method for identifying Aphidius gossypii and Aphidius somniferus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |