CN105463069B - Target sequence, primer, identification method and kit for identifying haemaphysalis concinna - Google Patents
Target sequence, primer, identification method and kit for identifying haemaphysalis concinna Download PDFInfo
- Publication number
- CN105463069B CN105463069B CN201510155946.XA CN201510155946A CN105463069B CN 105463069 B CN105463069 B CN 105463069B CN 201510155946 A CN201510155946 A CN 201510155946A CN 105463069 B CN105463069 B CN 105463069B
- Authority
- CN
- China
- Prior art keywords
- haemaphysalis
- haemaphysalis concinna
- concinna
- sequence
- identifying
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a target sequence, a primer, an identification method and a kit for identifying haemaphysalis concinna, and belongs to the technical field of tick detection and identification. The target sequence is a specific DNA sequence for identifying the haemaphysalis concinna, is shown as SEQ ID NO.1, and is a section of the amplified haemaphysalis concinna COI sequence. Through sequence analysis, a primer pair capable of specifically amplifying the COI partial sequence of the haemaphysalis concinna is designed in the conserved region, and the sequences are shown as SEQ ID No.2 and 3. The PCR primer, the identification method and the kit provided by the invention overcome the problems of high requirements on sample completeness, high requirements on professional classification level of an identifier and the like in the traditional classification identification of the haemaphysalis concinna, are convenient to operate, high in sensitivity, strong in specificity, simple, rapid and low in cost, can meet the requirements of rapid and accurate species molecule identification of the haemaphysalis concinna, and have good application prospects.
Description
Technical Field
The invention relates to the technical field of tick detection and identification, in particular to a target sequence, a specific primer pair, an identification method and a kit for identifying Haemaphysalis concinna.
Background
Haemaphysalis concinna belongs to the family of ixodidae and the genus Haemaphysalis, and is widely distributed in northern grassland areas of China (including Heilongjiang, Jilin, Liaoning, inner Mongolian, Gansu, Ningxia, Xinjiang, etc.). In addition, haemaphysalis concinna is also distributed in abroad Mongolian countries, Japan, Korea, Iran, Turkey, and in vast areas such as Czech, Romania, Germany. Adult ticks are primarily parasitic to large mammals (including ungulates and carnivores) and also attack humans. Young ticks and nymphs infest small mammals and birds. The haemaphysalis concinna can be used as a vector to transmit epidemic diseases such as forest encephalitis, Q fever, northern Asia tick borne spotted fever and the like.
At present, species identification of haemaphysalis concinna mainly depends on morphological characteristics, the identification method has high requirements on professional knowledge of an identifier and the integrity of a tick sample, and the tick is easy to be confused with morphological approximate species, so that the time and labor are wasted, and the accuracy and the repeatability of the identification result of the haemaphysalis concinna are low. In recent years, molecular biology techniques have been widely applied to species identification, and there are currently few reports on the identification of Haemaphysalis concinna, which has a COI sequence of Haemaphysalis concinna in the Genbank database but is identical to the certified another reference sequence (NCBI reference sequence) Haemaphysalis para (NC020335.1) in the Genbank database, which is specifically identified as belonging to Haemaphysalis parva, and therefore the applicant believes that the COI sequence disclosed in the Genbank database is not currently Haemaphysalis concinna.
Disclosure of Invention
The first purpose of the invention is to overcome the defects of the prior detection technology and provide a specific target sequence for identifying haemaphysalis concinna.
It is a second object of the present invention to provide a primer pair for amplifying a specific target sequence.
The third purpose of the invention is to provide a method and a kit for identifying haemaphysalis concinna.
In order to achieve the purpose, the invention firstly utilizes a tick COI full-length sequence amplification primer designed by the inventor to amplify the COI sequence of the haemaphysalis concinna.
COI-CF：5’-ATTTTACCGCGATGAATATTYTC-3’(SEQ ID NO.4)
COI-CR：5’-TTATTTTAAAATAATRTT-3’(SEQ ID NO.5)。
In the above sequences, Y and R are degenerate primers, respectively, Y ═ C/T, and R ═ a/G.
COI-CF and COI-CR amplified the COI full-length sequence of haemaphysalis concinna, 1539bp long, and the electrophoretogram is shown in FIG. 1.
According to the invention, according to the COI full-length sequence of the haemaphysalis concinna amplified by the amplification primers COI-CF and COI-CR, the sequence is compared and analyzed with a Genbank database and other haemaphysalis COI sequences amplified by the inventor through a CLUSTALW program in MEGA software, so that a haemaphysalis concinna specific sequence is screened out, amplification primers are designed, and 2 forward primers and 2 reverse primers are designed in total. They are respectively:
forward primer HC-F: 5'CTCTTCTTTAGTAGAAAGTGGTGT3' (shown in SEQ ID NO. 2)
Reverse primer HC-R: 5'GGTCAAAAAATGAAGTATTGAAG3' (shown in SEQ ID NO. 3).
Forward primer HC-F1: 5'-ATATCCGCCCCTTTCT-3' (shown as SEQ ID NO. 6)
Reverse primer HC-R1: 5'-ATTCGTTCTAAGGTCATG-3' (shown as SEQ ID NO. 7)
When the HC-F1 and HC-R1 primers are used for amplification, besides the haemaphysalis concinna, partial haemaphysalis longicornis can also amplify a band with a corresponding size. Compared with HC-F and HC-R, the amplification specificity is poorer, so that HC-F and HC-R primer pairs are selected.
The actual PCR amplification verification proves that the forward primer HC-F and the reverse primer HC-R have good amplification effect and strong specificity. The primer design BLAST alignments are shown in FIG. 2 and FIG. 3.
Designing a haemophilus grouper specific primer and carrying out PCR amplification. Obtaining 323bp DNA specificity strip from Haemaphysalis concinna, sequencing the DNA specificity strip, comparing the DNA specificity strip with BLAST, and determining that the specificity DNA sequence can be used as the specificity DNA sequence for identifying the Haemaphysalis concinna.
The invention firstly provides a target sequence for identifying Haemaphysalis concinna (Haemaphysalis concinna), which has a nucleotide sequence shown in SEQ ID No. 1.
The invention provides application of the target sequence in identification of haemaphysalis concinna.
Specific primer pairs for the above target sequences are within the scope of the invention.
The invention provides a specific primer pair for specifically amplifying the target sequence, and the nucleotide sequence of the specific primer pair is shown as SEQ ID NO.2 and SEQ ID NO. 3.
The invention provides application of the specific primer pair in preparation of a kit for identifying haemaphysalis concinna (Haemaphysisconcinna).
Further, the invention provides a method for identifying Haemaphysalis concinna, which takes total DNA of an insect sample to be detected as a template and takes a nucleotide sequence shown in SEQ ID No.1 as a target sequence, utilizes the specific primer pair provided by the invention to carry out PCR, and judges the result according to the size of an amplified band.
Furthermore, if the amplified band size is 323bp, the insect sample to be tested is haemaphysalis concinna.
In the method for identifying Haemaphysalis concinna, 50 mul of PCR reaction system is as follows: 5 mul of 10 XPCR buffer, 2 mul of each of 10mM upstream primer and 10mM downstream primer, 2 mul of 10mM dNTPs, 1 mul of 50U Taq enzyme and 2 mul of 10-20 ng DNA template, and sterile double distilled water is added to 50 mul;
PCR reaction procedure: preheating at 94 deg.C for 5 min; 36 cycles of 94 ℃ for 30s, 48 ℃ for 30s and 72 ℃ for 30 s; the extension is 72 deg.C, 7min, and the product is stored at 4 deg.C.
The invention also provides a kit for identifying Haemaphysalis concinna, which contains a primer pair with a nucleotide sequence shown as SEQ ID NO.2 and SEQ ID NO. 3.
The invention provides application of the kit in identifying Haemaphysalis concinna.
The invention provides a target sequence for identifying haemaphysalis concinna. The PCR primer and the identification method for identifying the haemaphysalis concinna overcome the problems that the traditional haemaphysalis concinna identification has high requirement on sample integrity, needs professional classification experts, has high identification cost and the like, make up the defects of the existing detection technology, are simple, convenient and quick to operate, high in sensitivity, strong in specificity, simple, quick and low in cost, improve the efficiency and accuracy of haemaphysalis concinna identification, and can meet the requirements of quick and accurate species molecule identification of the haemaphysalis concinna. The method is suitable for research and analysis work such as haemophilus haemaphysalis distribution survey, population analysis and control of related tick borne diseases, and has important theoretical significance and application value.
Drawings
FIG. 1 shows that the inventor designs a primer pair COI-CF/COI-CR for amplifying a COI full-length sequence of tick COI, and amplifies the COI full-length sequence of haemaphysalis concinna by using the primer pair. 1% agarose gel electrophoresis picture of PCR amplification product; wherein M: DL2000 Marker; 1: 1# Haemaphysalis concinna)
FIG. 2 shows the result of BLAST comparison analysis of HC-F sequence of the forward amplimer of haemaphysalis concinna designed by the present invention with the Genbank database and the COI sequence of other haemaphysalis concinna amplified by the present inventors; wherein 1: HC-F primer sequences; 2: the COI sequence of the 1# Haemaphysalis concinna amplified by the inventor; 3: the inventor amplified 1# Haemaphysalis pratensis (Haemaphysalis verticillium) COI sequence; 4: the 1# haemaphysalis japonica (japonicumalgicornis) COI sequence amplified by the inventor; 5: the inventor amplified COI sequence of 1# Haemaphysalis longicornis (Haemaphysalis Haemaphysalis); 6: the brown yellow tick (haemaphysis flava) COI sequence in Genbank database; 7: the Haemaphysalis major (Haemaphysalis humerosa) COI sequence in the Genbank database; 8: the rhynchosmus ohibius (haemaphysis lemuris) COI sequence in Genbank database; 9: the Oncorhynchus longipes (Haemaphysalin Punctata) COI sequence in Genbank database;
FIG. 3 shows the result of BLAST comparison analysis of HC-R sequence of the Haemophilus haemaphysalis reverse amplification primer designed by the present invention with the Genbank database and the COI sequence of other blood ticks of the same genus amplified by the present inventors; wherein 1: HC-R primer sequences; 2: the COI sequence of the 1# Haemaphysalis concinna amplified by the inventor; 3: the inventor amplified 1# Haemaphysalis pratensis (Haemaphysalis verticillium) COI sequence; 4: the 1# haemaphysalis japonica (japonicumalgicornis) COI sequence amplified by the inventor; 5: the inventor amplified COI sequence of 1# Haemaphysalis longicornis (Haemaphysalis Haemaphysalis); 6: the brown yellow tick (haemaphysis flava) COI sequence in Genbank database; 7: the Haemaphysalis major (Haemaphysalis humerosa) COI sequence in the Genbank database; 8: the rhynchosmus ohibius (haemaphysis lemuris) COI sequence in Genbank database; 9: the Oncorhynchus longipes (Haemaphysalin Punctata) COI sequence in Genbank database;
FIG. 4 is a 1% agarose gel electrophoresis of tick DNA samples using specific primers designed according to the present invention for PCR detection; wherein M: DL2000 Marker; 1: 1# dermaphyllus pratensis (Dermacentor nuttallii); 2:2# dermaphyllus pratensis (Dermacentor nuttallii); 3: rhipicephalus guttatus (Ixodes persulatus); 4: 1# Haemaphysalis japonica (Haemaphysalis japonica); 5:2# Haemaphysalis japonica (Haemaphysalis japonica); 6:1# Haemaphysalis longicornis (Haemaphysalis longicornis); 7:2# Haemaphysalis longicornis (Haemaphysalis longicornis); 8: 1# Asian Hyalomma asiaticum (Hyalomma asiaticum); 9:2# Asian Hyalomma asiaticum; 10: haemaphysalis verticillium; 11: haemaphysalis constinna 1; 12: haemaphysalis constinna 2.
Detailed Description
The following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.
The haemaphysalis longicornis is collected from Beijing, the Rhizophus communis, the haemaphysalis, and the haemaphysalis are collected from Heilongjiang, the hyalomma asiaticum is collected from inner Mongolia, and the haemaphysalis is collected from Xinjiang. All samples were stored at the national institute for inspection and quarantine science.
Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The reagents used in the examples are commercially available unless otherwise specified.
Example 1 determination of a Haemophilus haemaphysalis specific target sequence and primer design for amplification thereof
PCR amplification and sequencing are carried out on the full-length sequence of the COI of the Haemaphysalis concinna (Haemaphysalis concinna) by utilizing a full-length sequence amplification primer COI-CF/COI-CR designed by the inventor, a section of the COI sequence of the Haemaphysalis concinna is amplified for the first time, the length is 1539bp, and an electrophoresis chart is shown in figure 1.
COI-CF：5’-ATTTTACCGCGATGAATATTYTC-3’；(SEQ ID NO.4)
COI-CR：5’-TTATTTTAAAATAATRTT-3’(SEQ ID NO.5)。
According to the COI sequence of the haemaphysalis concinna amplified by COI-CF/COI-CR, the sequence is compared and analyzed with other haemaphysalis concinna COI sequences in the same genus in a Genbank database through a CLUSTALW program in MEGA software, and the haemaphysalis concinna COI highly conserved sequence is determined. Designing specific primers of the haemaphysalis concinna, screening out specific sequences of the haemaphysalis concinna and designing amplification primers, wherein 2 forward primers and 2 reverse primers are designed in total. They are respectively:
forward primer HC-F: 5'CTCTTCTTTAGTAGAAAGTGGTGT3' (shown in SEQ ID NO. 2)
Reverse primer HC-R: 5'GGTCAAAAAATGAAGTATTGAAG3' (shown in SEQ ID NO. 3).
Forward primer HC-F1: 5'-ATATCCGCCCCTTTCT-3'
Reverse primer HC-R1: 5'-ATTCGTTCTAAGGTCATG-3'
The primer design BLAST alignments are shown in FIG. 2 and FIG. 3. When the HC-F1 and HC-R1 primers are used for amplification, besides the haemaphysalis concinna, partial haemaphysalis longicornis can also amplify a band with a corresponding size. Compared with HC-F and HC-R, the amplification specificity is poorer, so that HC-F and HC-R primer pairs are selected. And PCR amplification is carried out to obtain a 323bp DNA specificity strip, the DNA specificity strip is sequenced and BLAST compared to determine that the specificity DNA sequence can be used as a specificity DNA sequence (shown as SEQ ID No. 1) for identifying the Haemaphysalis concinna (Haemaphysis concinna).
The specific primer pairs for specifically amplifying the target sequence obtained by repeated screening are HC-F and HC-R which are respectively shown as SEQ ID NO. 2-3.
Example 2 construction of PCR method for identifying Haemophilus haemaphysalis
1. Sample processing and DNA genome extraction
1# prairie leather tick Dermacentor nuttallali; 2# dermaphyllus pratensis Dermacentor nuttallii; hard tick Ixodes persulatus; 1# Haemaphysalis japonica; 2# Haemaphysalis japonica; 1# Haemaphysalis longicornis; haemaphysalis longicornis 2; 1# Asian Hyalomma asiaticum; 2# Asian hyalomma hyalomyasiticum; haemaphysalis verticillium; haemaphysalis concinna 1# Haemaphysalis; the 2# Haemaphysalis concinna samples were washed with distilled water, placed in 1.5ml centrifuge tubes, respectively, 200. mu.l lysis buffer (10mmol/L Tris-HCl pH 8.0; 50mmol/L NaCl; 0.45% Tween 20; 0.45% NP-40) was added, the samples were ground with a grinding bar, vortexed and mixed, 10. mu.l proteinase K (100. mu.g/ml) was added, and digested overnight at 56 ℃. Then processing at 95 ℃ for 5 minutes, centrifuging at 12000rpm for 5 minutes, transferring the supernatant into a new centrifuge tube to obtain genomic DNA which can be used for PCR amplification.
2. Specific PCR amplification
The reaction system was 50. mu.l, added with 5. mu.l of 10 XPCR buffer, 2. mu.l each of the upstream and downstream primer pairs (10mM), 2. mu.l of dNTPs (10mM), 1. mu.l of Taq enzyme (50U) and 2. mu.l of 10 to 20ng of DNA template, and sterilized double distilled water was added to 50. mu.l. Sterilized double distilled water was used as a negative control.
PCR reaction procedure: preheating at 94 deg.C for 5 min; 36 cycles of 94 ℃ for 30s, 48 ℃ for 30s and 72 ℃ for 30 s; the final elongation is 72 deg.C, 7min, and 4 deg.C. And (3) performing 1% agarose gel electrophoresis on 5 mu l of PCR product, wherein the result is shown in figure 4, the negative control is sterilized double distilled water, the electrophoresis result of the haemaphysalis concinna sample has a clear band with the size of 323bp with higher brightness, and on the contrary, other lanes have no band or have non-specific amplification such as tailing, primer dimer and the like, and the sample is other tick or non-tick sample. Further shows that the method of the invention has good specificity and high accuracy.
Example 3 kit for identifying haemaphysalis concinna and application thereof
1. The kit comprises the following components: lysis buffer (10mmol/L Tris-HCl pH8.0; 50mmol/L NaCl; 0.45% Tween 20; 0.45% NP-40); proteinase K (100. mu.g/ml);
forward primer HC-F: 5'-CTCTTCTTTAGTAGAAAGTGGTGT-3' (10mmol/L)
Reverse primer HC-R: 5'-GGTCAAAAAATGAAGTATTGAAG-3' (10 mmol/L); taq enzyme (50U/. mu.l); 10 × PCR buffer; dNTPs (10 mM); instruction manual for identifying haemaphysalis concinna.
2. The method comprises the following specific operation steps:
(1) taking a suspected haemaphysalis concinna sample, cutting open a chitin shell of the suspected haemaphysalis concinna sample by using scissors, taking out 0.1-0.2 g of internal muscle tissue of the suspected haemaphysalis concinna sample by using tweezers, putting the suspected haemaphysalis concinna sample into a 1.5ml EP tube, adding 500 mu l of lysis buffer solution, and grinding the sample by using a grinding rod; then adding 500 mul of lysis buffer solution and 10 mul of proteinase K, and evenly mixing by vortex; digesting at 56 ℃ overnight; then treating for 5 minutes at 95 ℃; centrifuging at 12000rpm for 5 min; the DNA sample of the supernatant was transferred to a new centrifuge tube for use.
(2) Preparing a PCR reaction system:
| reagent | Volume (μ l) |
| 10× |
5 |
| HC- |
2 |
| HC- |
2 |
| |
2 |
| |
1 |
| |
2 |
| Double distilled water | Make up to 50. mu.l |
(3) Setting a PCR reaction program:
preheating at 94 deg.C for 5 min; 36 cycles of 94 ℃ for 30s, 48 ℃ for 30s and 72 ℃ for 30 s; the final elongation is 72 deg.C, 7min, and 4 deg.C.
(4) And (3) carrying out electrophoresis detection on 1.0-1.5% agarose, taking out 6 mu l of each PCR product and DNA Marker, and carrying out 120V electrophoresis for 30 min.
(5) And (4) ultraviolet photography. If the electrophoresis result shows a clear band with the size of 323bp with higher brightness, the sample is the haemaphysalis concinna; otherwise, other samples without the strip or without the tailing, primer dimer and other non-specific amplifications are other tick or non-tick samples.
The kit can be used for quickly identifying the haemaphysalis concinna, has the characteristics of strong specificity, high accuracy and low cost, is simple and convenient to operate, and is suitable for research and analysis work of distribution survey of the haemaphysalis concinna, population analysis, control of related tick borne diseases and the like.
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Claims (8)
1. Method for identifying haemaphysalis concinna (A)Haemaphysalis concinna) The target sequence of (1), wherein the nucleotide sequence is as shown in SEQ ID No. 1.
2. Use of a target sequence according to claim 1 for identifying haemaphysalis concinna for non-disease diagnostic purposes.
3. For identifying haemaphysalis concinna (Haemaphysalis concinna) The nucleotide sequence of the specific primer pair is shown as SEQ ID NO.2 and SEQ ID NO. 3.
4. Use of a specific primer pair according to claim 3 in the preparation of a kit for identifying haemaphysalis concinna (Haemophilus haemaphysalis) (Haemophilus)Haemaphysalis concinna) Application in a kit.
5. Identification of Haemophilus haemaphysalis: (Haemaphysalis concinna) The method of (1), characterized in that, using the total DNA of the insect sample to be tested as a template, carrying out PCR by using the specific primer pair of claim 3, and determining the result according to the size of the amplified band;
if the amplified band is 323bp, the insect sample to be detected is haemaphysalis concinna.
6. The method of claim 5, wherein the 50 μ l PCR reaction system is: 5 mul of 10 XPCR buffer, 2 mul of each of 10mM upstream primer and 10mM downstream primer, 2 mul of 10mM dNTPs, 1 mul of 50U Taq enzyme and 2 mul of 10-20 ng DNA template, and sterile double distilled water is added to 50 mul;
PCR reaction procedure: preheating at 94 deg.C for 5 min; 36 cycles of 94 ℃ for 30s, 48 ℃ for 30s and 72 ℃ for 30 s; the extension is 72 deg.C, 7min, and the product is stored at 4 deg.C.
7. Method for identifying haemaphysalis concinna (A)Haemaphysalis concinna) The kit is characterized by comprising a pair of primers, and the nucleotide sequences of the primers are shown as SEQ ID NO.2 and SEQ ID NO. 3.
8. The kit of claim 7 for the identification of haemaphysalis concinna (tick) (for non-disease diagnostic purposes)Haemaphysalis concinna) The use of (1).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510155946.XA CN105463069B (en) | 2015-04-02 | 2015-04-02 | Target sequence, primer, identification method and kit for identifying haemaphysalis concinna |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510155946.XA CN105463069B (en) | 2015-04-02 | 2015-04-02 | Target sequence, primer, identification method and kit for identifying haemaphysalis concinna |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105463069A CN105463069A (en) | 2016-04-06 |
| CN105463069B true CN105463069B (en) | 2020-02-07 |
Family
ID=55601224
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510155946.XA Active CN105463069B (en) | 2015-04-02 | 2015-04-02 | Target sequence, primer, identification method and kit for identifying haemaphysalis concinna |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105463069B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115058520A (en) * | 2022-06-22 | 2022-09-16 | 中国农业科学院兰州兽医研究所 | Target sequence, primer pair and kit for identifying or assisting in identifying haemaphysalis lanuginosa and application of target sequence, primer pair and kit |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101757618A (en) * | 2009-12-17 | 2010-06-30 | 四川农业大学 | Recombined subunit vaccine of haemaphysalis concinna and preparation method thereof |
-
2015
- 2015-04-02 CN CN201510155946.XA patent/CN105463069B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101757618A (en) * | 2009-12-17 | 2010-06-30 | 四川农业大学 | Recombined subunit vaccine of haemaphysalis concinna and preparation method thereof |
Non-Patent Citations (2)
| Title |
|---|
| Genotypic identification of three new strains of spotted fever group rickettsiae isolated in China;ZHANG,J.Z.,et al;《ACTA VIROLOGICA》;19961231;第40卷(第4期);第215-219页 * |
| 新疆硬蜱优势种类分布及牦牛蜱传梨形虫病流行病学研究;巴音查汗等;《中国畜牧兽医学会家畜寄生虫学分会第六次代表大会暨第十一次学术研讨会》;20111118 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105463069A (en) | 2016-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN110878377B (en) | Fluorescent quantitative PCR differential diagnosis kit for strong and weak viruses of African swine fever viruses | |
| CN101240351B (en) | Real time quantitative PCR determination method for lymphatic cyst virus | |
| CN105907890B (en) | Primer, probe and method for quickly distinguishing HP-PRRS vaccine GDr180 strain and wild strain | |
| CN111286559A (en) | Primer, probe and kit for detecting African swine fever virus | |
| CN105463069B (en) | Target sequence, primer, identification method and kit for identifying haemaphysalis concinna | |
| CN106754911B (en) | Primer group for identifying mycoplasma bovis, bovine viral diarrhea virus and infectious bovine rhinotracheitis virus and application thereof | |
| CN111454943A (en) | Novel coronavirus detection kit | |
| CN108410991B (en) | Detection method for distinguishing tick interspecific and intraspecies specificity | |
| CN111500774B (en) | Epidemic hemorrhagic disease virus and serotype identification RT-PCR kit | |
| CN112522434B (en) | Primer group and kit for simultaneously detecting multiple pathogenic fungi | |
| CN104561387B (en) | A kind of apple stem pitting virus real-time fluorescence quantitative PCR detection method | |
| CN105463068B (en) | For identifying target sequence, primer, identification method and the kit of Haemaphysalis verticalis | |
| CN109136409B (en) | Kit and method for detecting African swine fever virus based on K196R gene | |
| CN110157836B (en) | Primer, probe and method for detecting IBRV and BVDV | |
| CN106521038A (en) | High-sensitivity BHV-2 (bovine herpes virus 2) quantitative real-time PCR (polymerase chain reaction) detection method and kit | |
| CN107988429B (en) | Reagent for detecting rabies virus and application thereof | |
| CN112941240A (en) | Primer pair, kit and method for detecting goose astrovirus and goose goblet virus | |
| CN113718044A (en) | Primer, probe and kit for fluorescent quantitative detection of swine mycoplasma, mycoplasma microformis and new mycoplasma haemophilus | |
| CN112266979A (en) | RPA detection primer based on watermelon mosaic virus conserved region, detection method and application thereof | |
| EP2821507A1 (en) | A method for detecting, identifying and/or quantifying a pathogen in an individual | |
| CN110273025A (en) | A kind of Alon mountain virus PCR detection primer group, kit and application | |
| CN105463067B (en) | For identifying target sequence, primer, identification method and the kit of Haemaphysalis japonica | |
| CN116970735B (en) | Rapid detection method and kit for maize rust recombinant polymerase | |
| CN103589783B (en) | SCAR (sequence characterized amplified region) primer and method for identifying felwort and adulterants thereof by using SCAR technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |