CN105462889A - Feed aspergillus flavus biological antagonist and culture and isolation method thereof - Google Patents

Abstract

The invention discloses a biological antagonist of Aspergillus flavus for feed and a cultivation and separation method thereof. Bacillus is a kind of bacterium that exists widely in nature, because of its strong resistance, no pathogenicity, poor environment tolerance, etc., it is widely used in fields such as medical treatment, industry, agriculture and sanitation, the present invention is to the effect of Bacillus to Aspergillus flavus Inhibition and antagonism studies. Firstly, samples were taken from sheep manure, cow manure and other animal manure and soil to isolate Bacillus; the morphological and biochemical identification of the isolated strain was carried out; then the inhibitory and antagonistic effects of various Bacillus on Aspergillus flavus were compared; the antagonistic effect was good The Bacillus bacillus was added to the feed to compare the feeding effects; finally, the preparation method of the feed Aspergillus flavus bioantagonist—Bacillus atrophaeus was determined. The material of the invention has wide sources and simple preparation process, and is more suitable for the antagonism of Aspergillus flavus in feed and the prevention of toxin production.

Description

A kind of aspergillus flavus bioantagonist for feed and its cultivation and isolation method

technical field

The invention belongs to the field of biological products, in particular to the production of animal feed microbial preparations.

Background technique

Aspergillus flavus is a saprophytic or necrotic pathogen of many crops. It relies on the conidia and toxins produced to cross-infect crops, infecting grain, oil crop seeds, feed and various foods, resulting in crop production reduction, threatening people, Livestock and poultry health. The biggest hazard of Aspergillus flavus is the production of aflatoxin, which is highly toxic and is considered carcinogenic, mutagenic, teratogenic, immune-suppressing, and can cause liver damage. Among them, the most toxic Aflatoxin, its toxicity is 10 times that of potassium cyanide and 68 times that of arsenic. Therefore, how to effectively control the production of Aspergillus flavus and its toxins has very important theoretical and practical significance.

Due to the huge economic losses and health hazards caused by Aspergillus flavus pollution, people have been seeking effective control strategies and technologies, and put forward some preliminary measures, various physical and chemical detoxification methods, and biological control. A large number of studies have shown that many antagonistic microorganisms and their active substances have obvious inhibitory effects on the growth of Aspergillus flavus and the production of toxins.

Bacillus atrophaeus has a wide range of sources, is an aerobic bacteria, adapts to a wide range of temperatures, is resistant to salt, alkali and acid, and Bacillus atrophaeus has been used as an indicator bacteria for disinfection and sterilization processes. Therefore, further research and development of Bacillus atrophaeus Applications are very practical.

Contents of the invention

The technical problem to be solved by the present invention is to isolate excellent bacillus from animal feces and soil culture, then carry out appearance, physiological and biochemical identification, make it into an additive form and add it to the feed to compare the feeding effect, and then select the best bacillus Carry out molecular identification, determine the name of the beneficial bacteria, and apply it to the field of feed.

The preparation process that this program adopts is as follows:

1. Sampling various animal manures such as soil, sheep manure, cow manure, etc., in the form of powder, and streaked on the medium. The medium components are: peptone 10g, beef extract 3g, sodium chloride 5g, agar 17g, distilled water 1000mL , pH7.2, use after 121°C high pressure for 20min;

2. Cultivate at 27°C-37°C for 2-4 days, gradually separate and cultivate, when the colony is single and the color and shape are consistent by naked eye observation, continue to cultivate for three generations;

3. Take the strain culture after three generations, use the inoculation loop to dip the bacterial suspension of the strain to be used, and put it on the TSA medium (casein trypsin digest 15.0, soybean powder papain digest 5.0, sodium chloride 5.0, agar 15.0, (pH value 7.3±0.225°C) streaked on the plate, cultivated at a suitable temperature for 18h-48h, when a single colony appears, observe the shape, size, edge, surface, bulge shape, transparency, colony and color of the culture medium. Refer to the "Common Bacteria System Identification Manual" for the observation of appearance. The surface of the colony is round, the edges are neat, the shape is raised, opaque, white or light yellow, and it is initially determined to be Bacillus;

4. Pick pure colonies for Gram staining experiment and spore staining experiment. The results show that the length and width of the cells are 0.5-1.0um and 2.0-4.0um respectively. The vegetative cells are rod-shaped, and some are arranged in chains. If the body is purple, it is positive; the spores are green after staining, and the spores are oval, not enlarged, mesozoic, and further confirmed as Bacillus;

5. Biochemical experiment (bacterial trace biochemical identification tube method), using glycerol, the contact enzyme reaction is positive, can reduce nitrate to nitrite, can liquefy gelatin, can use mannose to ferment, do not use arabinose, amygdalin and Mannitol fermentation can grow in tryptone-containing water, and those who can hydrolyze starch can be identified as Bacillus.

6. Salt tolerance test: growth in 10% NaCL medium; acid and alkali resistance test: the culture medium can grow normally at pH5.5-9; temperature range test: it can still grow at 5-55°C cannot grow under oxygen conditions.

7. Experiments on inhibition of Aspergillus flavus hyphae growth

Add the bacillus culture solution into the culture medium, inoculate the Aspergillus flavus plate cultured on the plate after condensation, and measure the diameter of the colony after constant temperature cultivation with sterile water as the control.

8. Effect experiment on mycelium morphology

The Aspergillus flavus spores were mixed with the bacillus culture medium and cultured in the liquid medium respectively, and the aseptic water was used as the control, and the shaking table was cultivated, and then the morphological changes of the Aspergillus flavus mycelia were observed under a microscope. The results showed that the bacillus had obvious antibacterial effect on Aspergillus flavus.

The present invention also provides a preparation method for adding a bacillus antagonist to feed:

A. Use sterilized physiological saline to make a bacterial suspension of 1*10 ⁵ CFU/ml of the above single bacilli, inoculate them in TSB liquid medium with 4-8% inoculum, and culture them with shaking at 27-35°C 18-24 hours;

B. TSB selection: Tryptone 1.5% (g/100ml) Soybean peptone 0.5% (g/100ml) Sodium chloride 0.5% (g/100ml) Prepared with distilled water, adjust the pH to 7.2±0.2, through 121 ℃ pressure Use after steam sterilization;

C. Add 5-10g/100ml of bentonite to the above medium, let it stand for 20-30 minutes, then centrifugally filter, dry the precipitate at 27-55°C and add it to the animal feed.

The bacteria with the strongest inhibition of Aspergillus flavus or the best effect of adding Bacillus to the feed were amplified by recA primers and ITS primers. The electrophoresis bands were clear and sent to Shanghai Lifei Biotechnology Co., Ltd. for sequencing identification. After GenBank Blast Comparative analysis and the establishment of developmental tree confirmed that the bacterium was Bacillus atrophaeus.

Compared with prior art, the beneficial effect of the present invention is:

1. The raw materials are natural microorganisms with a wide range of sources, no stimulation and no residue;

2. The effect is more obvious and its resistance is strong, non-pathogenic, and poor tolerance to the environment, etc.;

3. No residue is not easy to cause other diseases, and beneficial bacteria are beneficial to animal intestinal digestion.

Description of drawings

Figure 1: Comparison of the similarity between the sequence of the isolate and Bacillus atrophaeus recorded in GenBank with accession numbers CP010778.1, CP007640.1, CP002207.1, and CP011802.1

Figure 2: Construction of a phylogenetic tree based on the sequence of the recA region

detailed description

Embodiment 1. The cultivation and separation of bacillus

Sampling soil, sheep manure, cow manure and other animal manure in powder form and streaking on the culture medium. The culture medium is composed of: 10g of peptone, 3g of beef extract, 5g of sodium chloride, 17g of agar, 1000mL of distilled water, pH7 .2, use after 121°C high pressure for 20 minutes;

Cultivate at 27°C-37°C for 2-4 days, gradually separate and cultivate, when the colony is single and the color and shape are consistent by visual observation, continue to cultivate for three generations;

Take the strains after three generations for culture, use the inoculation loop to dip the suspension of the strains to be used, and put them on the TSA medium (trypsin digest of casein 15.0, soybean powder papain digest 5.0, sodium chloride 5.0, agar 15.0, pH 7.3 ± 0.225 ℃) streaked on the plate, cultivated at a suitable temperature for 18h-48h, when a single colony appears, observe the shape, size, edge, surface, bulge shape, transparency, colony and color of the culture medium. Refer to the "Common Bacteria System Identification Manual" for the observation of appearance. The surface of the colony is round, the edges are neat, the shape is raised, opaque, white or light yellow, and it is initially determined to be Bacillus;

Pure colonies were picked for Gram staining experiments and spore staining experiments. The results showed that the length and width of the cells were 0.5-1.0um and 2.0-4.0um respectively. The vegetative cells were rod-shaped, and some were arranged in chains. Purple is positive; the spores are green after staining, the spores are oval, not enlarged, mesozoic, and further identified as Bacillus;

Biochemical experiment (bacterial trace biochemical identification tube method), using glycerin, positive contact enzyme reaction, can reduce nitrate to nitrite, can liquefy gelatin, can use mannose to ferment, do not use arabinose, amygdalin and mannitol Fermentation, can grow in tryptone-containing water, and those who can hydrolyze starch can be identified as Bacillus.

Tested for salt tolerance: grow in 10% NaCL medium; test for acid and alkali resistance: colonies can grow normally in the medium at pH5.5-9; test for temperature range: can still grow at 5-55°C, and can grow under anaerobic conditions cannot grow.

Example 2. Functional test of bacillus

Experimental observation will be carried out on the growth inhibition of Aspergillus flavus, which is initially determined to be bacillus. Take 1mL of the bacillus culture solution of each treatment on a sterile plate, pour 10-15mL of PDA medium, shake well, and wait for the medium to solidify. Punch a hole in the center of the plate with a bacteria puncher, inject 10uL of Aspergillus flavus spore suspension (1*10 ⁵ CFU/mL) into the hole, take the sterile PDA medium without any treatment as the control, and repeat 3 times for each treatment PDA plates were cultured in a constant temperature incubator at 32°C for 3-5 days, the growth of Aspergillus flavus was observed, the diameter of Aspergillus flavus was measured, and the inhibition rate was calculated. Calculated as follows:

Bacteriostatic rate %=100*(control group diameter-experimental group diameter/contrast diameter), 5 bacteriums with the highest bacteriostatic rate are reserved as Aspergillus flavus antagonist, and the data of the bacteriostatic rate of bacillus culture fluid to Aspergillus flavus are shown in the table 1 shows:

Table 1: The bacteriostatic rate of each treatment group of Bacillus culture solution to Aspergillus flavus

Prepare several strains of Bacillus isolated above with sterilized physiological saline to make a bacterial suspension of 1*10 ⁵ CFU/ml, inoculate in TSB liquid medium with 4-8% inoculum amount, and culture with shaking at 27-35°C for 18 -24 hours;

TSB medium: Tryptone 1.5% (g/100ml), soybean peptone 0.5% (g/100ml), sodium chloride 0.5% (g/100ml), prepared with distilled water, adjust the pH to 7.2±0.2, after 121 Use after pressure steam sterilization at ℃;

Add 5-10g/100ml of bentonite to the above culture medium, let it stand for 20-30 minutes, then centrifuge and filter, dry the precipitate at 27-55°C and add it to animal feed.

Adopt to feed 1 month in this feed, 2 months, 3 months 8 groups (6 lambs of every group) sheep, the sheep body weight is carried out comparative analysis (as shown in table 2):

Table 2: Data table of body weight change after adding antagonists (unit: kg)

Through the above test, it can be proved that the bacterium with the strongest inhibition of Aspergillus flavus or the best effect of adding Bacillus to the feed is the fourth bacterium.

Example 3. Identification of Bacillus strains

Perform PCR amplification on strain 4, the recA sequence has a lower degree of interspecies similarity and can replace or supplement the 16SrRNA gene. This sequence is used to identify bacterial species or to distinguish closely related ones, and is widely used to study the evolutionary relationship of bacteria , so the recA primer was chosen.

recA-F: ACCAGACAATGCTCGACGT

recA-R: CCCTCTTGAAATTCCCGAAT

8F: AGAGTTTGATCCTGGCTCAG

1392R: ACGGGCGGTGTGTAC

Under the annealing temperature of 59.0-63.0°C, pre-denaturation at 94°C for 1 min, denaturation at 94°C for 30 s, annealing at 58.8°C for 30 s, extension at 72°C for 30 s, 34 cycles, and final extension at 72°C for 7 min.

The sequencing result is:

TACCAGACAATGCTCGACGTTCTGACTGAACAGCTGATCGAGACAGCTGC

AAAGGTTGTCGTAAAACGCCTGCAATTTACAGCGCAGCTTGAAAAATGGGCGC

AGCCGATCCATTCGGGAATTTCAAGAGGGA

According to the sequencing results, the sequence size of the ITS region of the isolate was 131bp. The sequencing results were submitted to the GenBank database for BLAST comparison. After comparison, it was found that the sequence of the isolate was more than 98% similar to the Bacillus atrophaeus recorded in GenBank with accession numbers CP010778.1, CP007640.1, CP002207.1, and CP011802.1 (Figure 1). .Lasergene.v7.1 biomedical software constructs a phylogenetic tree based on the sequence of the recA region (Figure 2), and further determines that the bacterial colony is a species of Bacillus atrophaeus.

The above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention in any form and in essence. Those who are familiar with the profession can use the above-mentioned information without departing from the scope of the technical solution of the present invention. The technical content disclosed, and the equivalent changes of making some changes, modifications and evolutions are all equivalent embodiments of the present invention; at the same time, all modifications of any equivalent changes made to the above embodiments according to the substantive technology of the present invention , modification and evolution all still belong to the scope of the technical solution of the present invention.

Claims (7)

1. the antagonist atrophy genus bacillus (Bacillusatrophaeus) for feed flavus.

2. the isolation cultivation method of feed flavus antagonist atrophy genus bacillus (Bacillusatrophaeus) as described in claim 1, it is characterized in that, by various to soil, sheep excrement, cow dung etc. animal excrement sampling with Powdered line coating on substratum, medium component is: peptone 10g, extractum carnis 3g, sodium-chlor 5g, agar 17g, distilled water l000mL, pH7.2, use after 121 DEG C of high pressure 20min.

3. the cultural method of genus bacillus as claimed in claim 2, it is characterized in that, described culture condition is: at 27 DEG C-37 DEG C, cultivate 2-4 days.

4. genus bacillus as claimed in claim 1 suppresses the application in toxin generation in antagonism flavus.

5. application according to claim 4, is characterized in that, described in be applied as in antagonism feed flavus poison produce.

6. a method for culturing and separating for feed flavus antagonist atrophy genus bacillus (Bacillusatrophaeus), is characterized in that:

A. various to soil, sheep excrement, cow dung etc. animal excrement sampling is coated with Powdered line on NA substratum;

B. the strain culturing that three generations is later is got, dip bacterial strain bacteria suspension to be used with transfering loop, in the line of TSA culture medium flat plate, thermophilic cultivates 18h-48h, single bacterium colony to appear, observes the color of shape, size, edge, surface, projecting shape, transparency, bacterium colony and substratum;

C. the pure bacterium colony of picking carries out gramstaining experiment and spore staining experiment;

D. through Salt resistant test, acid and alkali-resistance mensuration, growth temperature range mensuration, aerobism determination test, biochemical test (bacterium micro biochemical qualification tube method), result display bacterium colony smooth surface is opaque, irregular; Body purple, single raw or twin, shaft-like; Aerobic growth; Growth temperature can grow between 5-55 DEG C; Salt tolerance is strong, can grow under 10%NaCl; Minimum growth pH is 5.5, the highest pH is 9.

E. to the growth inhibiting experiment of flavus mycelia

Bacillus nutrient solution is respectively added in substratum, is seeded in the dull and stereotyped upper Aspergillus flavus dish cultivated after condensation, take sterilized water as contrast, after constant temperature culture, measure colony diameter.

F. the impact of Aspergillus flavus filament shapes is tested

By flavus robe respectively with bacillus nutrient solution mixed culture in liquid nutrient medium, with sterilized water be contrast, shaking table cultivate, the mycelial metamorphosis of rear microscopic examination flavus, result display bacillus to flavus, there is obvious restraining effect.

7. comprise a preparation method for the feed of genus bacillus antagonist, it is characterized in that:

A. the physiological saline of the genus bacillus sterilizing described in claim 1-6 is made 1*10 ⁵the bacteria suspension of CFU/ml, is inoculated in TSB liquid nutrient medium with 4-8% inoculum size, 27-35 DEG C of shaking culture 18-24 hour;

TSB substratum: Tryptones 1.5% (g/100ml), soy peptone 0.5% (g/100ml), sodium-chlor 0.5% (g/100ml), formulated with distilled water, regulate pH to be 7.2 ± 0.2, use after 121 DEG C of pressuresteam sterilizations;

B. in above substratum, add wilkinite 5-10g/100ml, leave standstill after 20-30 minute, centrifuging, adds to throw out in animal-feed after drying in 27-55 DEG C of environment.