CN105441582A - Qualitative and quantitative multiple-gene helicobacter pylori detection system and kit and application thereof - Google Patents
Qualitative and quantitative multiple-gene helicobacter pylori detection system and kit and application thereof Download PDFInfo
- Publication number
- CN105441582A CN105441582A CN201610070235.7A CN201610070235A CN105441582A CN 105441582 A CN105441582 A CN 105441582A CN 201610070235 A CN201610070235 A CN 201610070235A CN 105441582 A CN105441582 A CN 105441582A
- Authority
- CN
- China
- Prior art keywords
- gene
- seqidno
- nucleotide sequence
- primer
- vaca
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a qualitative and quantitative multiple-gene helicobacter pylori detection system and a kit and application thereof. The qualitative and quantitative multiple-gene helicobacter pylori detection system includes multiple pairs of primers respectively for a strain identification gene (16S rRNA) and quantitative analysis genes ureC and beta-globin of the helicobacter pylori. The qualitative and quantitative multiple-gene helicobacter pylori detection system and the kit of the system do not need the steps including conventional isolated culture of bacteria and the like, strain identification and quantitative analysis can be directly conducted on tissue samples in the same reaction system, the accuracy of detection results is obviously improved, an accurate and low-cost etiological basis is clinically provided for the first time, and important references are provided for accurate diagnosis and differential diagnosis of helicobacter pylori infection and curative effect observation.
Description
Technical field
The present invention relates to a kind of multiple gene testing product and the detection system used by this product, belong to biological technical field.
Background technology
Helicobacter pylori (H.pylori) is a kind of Grain-negative, micro-aerobic, bending bacillus, mainly resides in human stomach.Helicobacter pylori infection and chronic atrophic gastritis, peptide ulceration, gastric mucosa-associated lymphoid tissue lymphoma and cancer of the stomach etc. occur to develop closely related, therefore cause clinical extensive concern.1994, international cancer research institution IARC was classified as mankind I class carcinogen, was uniquely be listed in clearly carcinogenic to mankind bacterial disease pathogenic microorganism so far.A lot of report thinks that helicobacter pylori infection is with coronary heart disease, similar rheumatism, liver and bladder disease, pulmonary tuberculosis, vomiting of pregnancy, directly the disease such as colorectal carcinoma and multiple dermatosis is relevant.Epidemiology shows, and the whole world almost has the population of half to infect this bacterium, and developing country is even up to 60% ~ 70%.Therefore, helicobacter pylori infection is the public health problem faced by countries in the world need.
Helicobacter pylori pathogenicity and its infective dose closely related.Current helicobacter pylori detects and authentication method all has its limitation.Such as: 1) separation and Culture qualification: after heiicobacter pylori cultivation becomes bacterium colony, identify through biochemical reaction.Because heiicobacter pylori cultivation needs micro-aerobic condition, require harsh to nutritional condition, therefore recall rate is extremely low, not easily promote, and heiicobacter pylori cultivation needs the regular hour, be unfavorable for quick diagnosis as routine diagnosis means.2) tissue pathological slice staining: the method is the section of Stomach in Patients spectroscopy biopsy, can be observed the helicobacter pylori in tissue after dyeing.The method affects obviously by helicobacter pylori carrying capacity, and complex operation, time-consuming, is unsuitable for the detection of large flux sample.3) urease dependence test (urea breath test): be divided into according to mark difference
13c breathalyse and
14c breathalyse, clinical application is extensive.Shortcoming is costly, be subject to the impact of antibacterial medicines and antisecretory, susceptibility is low.4) immunologic test: detect in serum or the antigenic component of helicobacter pylori in antibody (IgG) or direct-detection ight soil in saliva and urine.Its shortcoming to reflect Current Infection.5) foranalysis of nucleic acids method: comprise order-checking, PCR, oligonucleotide probe hybridization etc., but these inspection method detection site are few, specificity is low, and flux is little, and cost is higher, and can not do quantitative analysis.6) quantitative analysis: conventional quantitative analysis method is real-timePCR, but the method detects single, and flux is little, high to cost during multiple genetic analysis.
In sum, helicobacter pylori to be identified and quantitative analysis is the urgent problem demanding prompt solution of those skilled in the art how fast, accurate and comprehensively.
Summary of the invention
The technical problem to be solved in the present invention be to provide a kind of can fast, accurately, the helicobacter pylori quantitative and qualitative analysis multiple gene detection system of low cost and test kit thereof, and adopt this detection system preparing the application in diagnostic products.
The present invention is a kind of technical scheme solving the problems of the technologies described above proposition: a kind of helicobacter pylori quantitative and qualitative analysis multiple gene detection system, can carry out in same reaction system its strain identification, quantitatively, virulence and drug resistance analysis.Comprise the primer that strain identification gene 16SrRNA is detected, respectively to the primer that virulence gene cagA, vacA-s1, vacA-s2, vacA-m1, vacA-m2, iceA1, iceA2, dupA, oipA and luxS detect, respectively to the primer carrying out polymorphic detection in 261 sites of 2143 sites of drug resistant gene 23SrRNA, 148 sites of rdxA, 1777 sites of pbp1A and gyrA, and respectively the primer that the gene ureC of quantitative analysis and-globin detects is carried out to the copy number of helicobacter pylori; 5 ' end of the forward primer of described each primer is equipped with forward universal primer sequence, and 5 ' end of the reverse primer of described each primer is equipped with reverse universal primer sequence.Described detection system carries out capillary electrophoresis analysis after carrying out PCR reaction.
For the nucleotide sequence of the forward primer of 16SrRNA gene as shown in SEQIDNo.1, for the nucleotide sequence of the reverse primer of 16SrRNA gene as shown in SEQIDNo.2;
For the nucleotide sequence of the forward primer of cagA gene as shown in SEQIDNo.3, for the nucleotide sequence of the reverse primer of cagA gene as shown in SEQIDNo.4;
For the nucleotide sequence of the forward primer of vacA-s1 or vacA-s2 gene as shown in SEQIDNo.5, for the nucleotide sequence of the reverse primer of vacA-s1 or vacA-s2 gene as shown in SEQIDNo.6;
For the nucleotide sequence of the forward primer of vacA-m1 gene as shown in SEQIDNo.7, for the nucleotide sequence of the reverse primer of vacA-m1 gene as shown in SEQIDNo.8;
For the nucleotide sequence of the forward primer of vacA-m2 gene as shown in SEQIDNo.9, for the nucleotide sequence of the reverse primer of vacA-m2 gene as shown in SEQIDNo.10;
For the nucleotide sequence of the forward primer of iceA1 gene as shown in SEQIDNo.11, for the nucleotide sequence of the reverse primer of iceA1 gene as shown in SEQIDNo.12;
For the nucleotide sequence of the forward primer of iceA2 gene as shown in SEQIDNo.13, for the nucleotide sequence of the reverse primer of iceA2 gene as shown in SEQIDNo.14;
For the nucleotide sequence of the forward primer of dupA gene as shown in SEQIDNo.15, for the nucleotide sequence of the reverse primer of dupA gene as shown in SEQIDNo.16;
For the nucleotide sequence of the forward primer of oipA gene as shown in SEQIDNo.17, for the nucleotide sequence of the reverse primer of oipA gene as shown in SEQIDNo.18;
For the nucleotide sequence of the forward primer of luxS gene as shown in SEQIDNo.19, for the nucleotide sequence of the reverse primer of luxS gene as shown in SEQIDNo.20;
For the nucleotide sequence of the forward primer of 23SrRNA gene as shown in SEQIDNo.21, the nucleotide sequence of the reverse primer that corresponding 23SrRNA gene 2143 site is base A is as shown in SEQIDNo.22, and the nucleotide sequence of the reverse primer that corresponding 23SrRNA gene 2143 site is bases G is as shown in SEQIDNo.23;
For the nucleotide sequence of the forward primer of rdxA gene as shown in SEQIDNo.24, the nucleotide sequence of the reverse primer that corresponding rdxA gene 148 site is base C is as shown in SEQIDNo.25, and the nucleotide sequence of the reverse primer that corresponding rdxA gene 148 site is base T is as shown in SEQIDNo.26;
For the nucleotide sequence of the forward primer of pbp1A gene as shown in SEQIDNo.27, the nucleotide sequence of the reverse primer that corresponding pbp1A gene 17 77 site is base A is as shown in SEQIDNo.28, and the nucleotide sequence of the reverse primer that corresponding pbp1A gene 17 77 site is bases G is as shown in SEQIDNo.29;
For the nucleotide sequence of the forward primer of gyrA gene as shown in SEQIDNo.30, corresponding gyrA gene 261 site is for the nucleotide sequence of the reverse primer of base C or T is as shown in SEQIDNo.31, and the nucleotide sequence of the reverse primer that corresponding gyrA gene 261 site is bases G or A is as shown in SEQIDNo.32;
For the nucleotide sequence of the forward primer of ureC gene as shown in SEQIDNo.33, for the nucleotide sequence of the reverse primer of ureC gene as shown in SEQIDNo.34;
For the nucleotide sequence of the forward primer of-globin gene as shown in SEQIDNo.35, and for the nucleotide sequence of the reverse primer of-globin gene as shown in SEQIDNo.36;
The nucleotide sequence of described forward universal primer is as shown in SEQIDNo.37;
The nucleotide sequence of described reverse universal primer is as shown in SEQIDNo.38.
The final concentration of forward primer in detection system for 16SrRNA, ureC, cagA, vacA-s1, vacA-m1, vacA-m2, iceA1, iceA2, dupA, oipA and luxS gene is 200nM; The final concentration of reverse primer in detection system for 16SrRNA, ureC, cagA, vacA-s1, vacA-m1, vacA-m2, iceA1, iceA2, oipA, luxS and-globin gene is 100nM; The final concentration of forward primer in detection system for dupA and-globin gene is 100nM;
The final concentration of forward primer in detection system for 261 sites of 2143 sites of 23SrRNA gene, 148 sites of rdxA gene, 1777 sites of pbp1A gene and gyrA gene is 100nM; Corresponding 23SrRNA gene 2143 site is that the final concentration of reverse primer in detection system of base A is 300nM; Corresponding 23SrRNA gene 2143 site is that the final concentration of reverse primer in detection system of bases G is 350nM; The final concentration of reverse primer in detection system that corresponding rdxA gene 148 site is base C, corresponding pbp1A gene 17 77 site is base A, corresponding gyrA gene 261 site is the reverse primer of base C or T, corresponding rdxA gene 148 site is base T, corresponding pbp1A gene 17 77 site is bases G is 400nM; Corresponding gyrA gene 261 site is that the final concentration of reverse primer in detection system of bases G or A is 450nM.
Above-mentioned helicobacter pylori detection system also comprises PCR damping fluid, MgCl
2the universal tag mixture of solution, dNTPs, warm start archaeal dna polymerase, band fluorescence and DNA profiling; The universal tag mixture of described band fluorescence comprises reverse universal primer and with fluorescently-labeled forward universal primer.
Above-mentioned fluorescent mark is CY5, CY3 or FAM etc.
Above-mentioned helicobacter pylori detection system also comprises positive control solution and negative controls; Described positive control is the plasmid mixture comprising all goal gene target spots; Described negative controls is nuclease free ultrapure water.
The amounts of components during reaction of above-mentioned helicobacter pylori detection system in system is 10 × PCR damping fluid 1 volume, the band universal tag mixture of fluorescence and dNTPs totally 1 volume of 2mmol/L, the MgCl of 25mmol/L
2solution 2 volume, primer mixture 1 volume, warm start archaeal dna polymerase 1 volume of 5U/ μ L, DNA profiling 2 volume, pure water 2 volume.
The usage quantity of above-mentioned DNA profiling is 5 ~ 50ng/ system.
The present invention is the another kind of technical scheme solving the problems of the technologies described above proposition: a kind of application adopting above-mentioned detection system to prepare helicobacter pylori diagnosis and detection product.
The present invention is another technical scheme solving the problems of the technologies described above proposition: a kind of helicobacter pylori quantitative and qualitative analysis multiple gene detection kit adopting above-mentioned detection system.
The present invention has positive effect:
(1) helicobacter pylori quantitative and qualitative analysis multiple gene detection system of the present invention and test kit, have employed multipair Auele Specific Primer and universal primer, multiplexed PCR amplification reaction is changed into substance reaction, effectively avoids mutually disturbing between primer, all goal gene of equivalence amplification.Optimize reaction system, in conjunction with capillary electrophoresis and detection technique of fluorescence, be different from conventional gel electrophoretic analysis pattern, non-specific amplification product, primer dimer can be separated with specific amplification products, at utmost reduce false positive.The detected result of this test kit is without assorted peak, and specificity is high.The pathogenic agent being low to moderate 10 copies can be detected, highly sensitive.
(2) steps such as the microbial culture of employing helicobacter pylori routine are not needed, directly strain identification and quantitative synchronous detection and analysis are carried out to tissue samples in same reaction system, one-time detection draws all results, compensate for low, the consuming time length of common detection methods flux and the shortcoming such as recall rate is low, cost is low, convenience good, the very first time provides etiology foundation that is comprehensive, accurate, low cost for clinical, instructs accurate Diagnosis and differential diaggnosis and the observation of curative effect of clinical helicobacter pylori infection.
(3) the 16SrRNA gene of helicobacter pylori has the conservative property of height, is the gene for strain identification.
(4) diversity of helicobacter pylori pathogenicity and the multiple virulence factor of its infective dose and generation closely related.
UreC gene is single copy gene, in conjunction with Human genome-globin as internal reference, can realize quantitative analysis, the accuracy of detected result is significantly improved, monitor infection amount and result for the treatment of.
CagA, vacA-s1, vacA-s2, vacA-m1, vacA-m2, iceA1, iceA2, dupA, oipA and luxS gene is the gene for judging bacterial virulence.Wherein, CagA albumen be helicobacter pylori pathogenicity island cagPAI on the coded product of cagA gene, be that helicobacter pylori infection causes host to produce the important effect albumen of Inflammatory response.VacA gene exists in all helicobacter pyloris, but only has the Helicobacter pylori Strains of about 50% to have VacA peptone to express.VacA has direct toxic action to gastric epithelial cell, can cause the damage of gastric mucosa and delay the reparation of Weishang skin.Signal sequence district (s district) and intermediate zone (m district) is there is in vacA gene structure.S district and m district form 5 kinds of mosaics, i.e. s1a/m1, s1a/m2, s1b/m1, s1b/m2, s2/m2 of vacA gene in different forms.Detecting the expression amount of vacA-s1, vacA-s2, vacA-m1, vacA-m2 gene, studying its somatotype for judging that the pathogenic power of Helicobacter pylori Strains is significant.IceA gene mainly contains two kinds of allelic variations: iceA1 and iceA2, iceA1 genetic expression means that raising helicobacter pylori contacts with epithelial, and closely related with the generation of ulcer.DupA gene is relevant with the generation of duodenal bulbar ulcer.OipA encodes pro-inflammatory outer membrane protein A, closely related with IL-8 level at the end of the plantation density of the clinical symptom after helicobacter pylori infection, bacterium, serious neutrophil infiltration and higher concentration, and the open state in oipA gene signal district is relevant with the genotypic existence of cagA, vacA, iceA, has certain directive property to duodenal ulcer and gastritis.LuxS genes encoding LuxS proteolytic enzyme, is synthesis high conservative, can be belonged to the basis of the signaling molecule AI-2 of bacterium identification in difference, gram-positive and the common LuxS/AI-2QS system of negative bacteria in composition helicobacter pylori.AI-2 is combined and activated transcription with luxS protein-specific when being increased to certain Ningdu, regulates downstream gene expression, relevant to the height of formation of helicobacter pylori specific biological film, and biomembranous being formed in improves its pathogenic and resistance to a certain extent.Detection is carried out to helicobacter pylori infection amount and virulence associated gene and will provide important references for clinical diagnosis, treatment and prevention etc.
(5) conventional medicine of helicobacter pylori clinical treatment comprises clarithromycin, metronidazole, amoxycilline Trihydrate bp and levofloxacin.But its resistance phenomenon is day by day serious and in global, and the shortcoming such as current conventional Resistance detection method all exists length consuming time and sensitivity is low, greatly have impact on clinical efficacy.23SrRNA, rdxA, pbp1A and gyrA gene polynorphisms of helicobacter pylori and clinical drug-resistant closely related.Wherein, 23SrRNA gene is for judging the resistance for clarithromycin (Clarithromycin).RdxA gene is used for the resistance judged for metronidazole (Metronidazole).Pbp1A gene is used for the resistance judged for amoxycilline Trihydrate bp (Amoxicillin).GyrA gene is used for the resistance judged for levofloxacin (Levofloxacin).Detection is carried out to Hp Drug Resistance genes involved and will provide important references for clinical individualization treatment.
Accompanying drawing explanation
Fig. 1 carries out the collection of illustrative plates after capillary electrophoresis analysis after the test kit of the embodiment of the present invention 1 carries out PCR reaction to positive control;
Fig. 2 carries out the collection of illustrative plates after capillary electrophoresis analysis after the test kit of the embodiment of the present invention 1 carries out PCR reaction to negative control;
Fig. 3 carries out the collection of illustrative plates after capillary electrophoresis analysis after the test kit of the embodiment of the present invention 1 carries out PCR reaction to sample 1;
Fig. 4 carries out the collection of illustrative plates after capillary electrophoresis analysis after the test kit of the embodiment of the present invention 1 carries out PCR reaction to sample 2;
Fig. 5 carries out the collection of illustrative plates after capillary electrophoresis analysis after the test kit of the embodiment of the present invention 1 carries out PCR reaction to sample 3;
Fig. 6 carries out the collection of illustrative plates after capillary electrophoresis analysis after the test kit of the embodiment of the present invention 1 carries out PCR reaction to sample 4.
Embodiment
Below by embodiment, the present invention is specifically described; what be necessary to herein means out is that following examples are only used to further illustrate the present invention; can not be interpreted as limiting the scope of the invention, person skilled in art can make some nonessential improvement and adjustment according to the invention described above content to the present invention.In following embodiment, if not specially show, reagent used is analytical pure, and agents useful for same all can obtain from commercial channel.The experimental technique of unreceipted actual conditions in literary composition, the condition described in " Molecular Cloning: A Laboratory guide " book that the Science Press that conveniently condition is write as J. Pehanorm Brooker etc. usually publishes for 2002, or according to the condition that manufacturers advises.Unless otherwise defined, all specialties used in literary composition and scientific words and one skilled in the art the same meaning be familiar with.In addition, any method similar or impartial to described content and material all can be applicable in the present invention.
Embodiment 1
One, the composition of test kit
The helicobacter pylori detection kit of the present embodiment comprises: primer mixture, PCR damping fluid (10 × PCRBuffer), MgCl
2the universal tag mixture of solution, dNTPs, band fluorescence, warm start archaeal dna polymerase (Taq DNA polymerase), positive control and negative control thing.The dNTPs of 2mmol/L and the universal tag mixture of band fluorescence mix and become a pipe reagent.
PCR damping fluid, dNTPs and warm start archaeal dna polymerase are all from Takara company (article No.: R007A).
Positive control solution is the plasmid mixture comprising all goal gene target spots.
Negative controls is nuclease free ultrapure water.
Primer mixture comprises the forward primer for 16SrRNA gene, for the reverse primer of 16SrRNA gene, for the forward primer of cagA gene, for the reverse primer of cagA gene, for the forward primer of vacA-s1 or vacA-s2 gene, for the reverse primer of vacA-s1 or vacA-s2 gene, for the forward primer of vacA-m1 gene, for the reverse primer of vacA-m1 gene, for the forward primer of vacA-m2 gene, for the reverse primer of vacA-m2 gene, for the forward primer of iceA1 gene, for the reverse primer of iceA1 gene, for the forward primer of iceA2 gene, for the reverse primer of iceA2 gene, for the forward primer of dupA gene, for the reverse primer of dupA gene, for the forward primer of oipA gene, for the reverse primer of oipA gene, for the forward primer of luxS gene, for the reverse primer of luxS gene, for the forward primer of 23SrRNA gene, corresponding 23SrRNA gene 2143 site is the reverse primer of base A, corresponding 23SrRNA gene 2143 site is the reverse primer of bases G, for the forward primer of rdxA gene, corresponding rdxA gene 148 site is the reverse primer of base C, corresponding rdxA gene 148 site is the reverse primer of base T, for the forward primer of pbp1A gene, corresponding pbp1A gene 17 77 site is the reverse primer of base A, corresponding pbp1A gene 17 77 site is the reverse primer of bases G, for the forward primer of gyrA gene, corresponding gyrA gene 261 site is the reverse primer of base C or T, corresponding gyrA gene 261 site is the reverse primer of bases G or A, for the forward primer of ureC gene, for the reverse primer of ureC gene, for the forward primer of-globin gene, for the reverse primer of-globin gene.The feature of each primer is as shown in table 1.
Table 1 primer sequence mark sheet
primer synthesizes by Sani bio tech ltd, Shanghai.Wherein, 5 ' end of each forward primer is equipped with forward universal primer sequence, and 5 ' end of each reverse primer is provided with reverse universal primer sequence.
Universal tag mixture with fluorescence comprises appropriate reverse universal primer and with fluorescently-labeled forward universal primer, fluorescent mark is CY5(also can be CY3 or FAM etc.).
The nucleotides sequence of forward universal primer is classified as: TGCATGACACTCGAGACTAG, as shown in SEQIDNo.37.
The nucleotides sequence of reverse universal primer is classified as: CATGACGACTCACTATACTA, as shown in SEQIDNo.38.
Two, the using method of test kit
The concrete detecting step of the helicobacter pylori detection kit of the present embodiment is as follows:
1. sample collection
Immersed by the stomach mucous membrane living tissue specimen of helicobacter pylori patient in physiological saline, adopt the DNA of bacteria extraction agent box of Tian Gen company to extract sample DNA, concrete operation is see extraction agent box product description.
After obtaining sample DNA, measure the Ratio control sample DNA quality of concentration and OD260/OD280 through ultraviolet spectrophotometer.The preferred concentration of sample DNA is 10ng/ μ L ~ 100ng/ μ L.The preferable range of the ratio of OD260/OD280 is 1.7 ~ 1.9.
2.PCR reacts
Adopt the reagent in the test kit of the present embodiment to prepare PCR reaction system with DNA profiling (sample DNA, positive control solution or negative controls) respectively, concrete component is as shown in table 2.
Table 2PCR reaction system component table
Then at the enterprising performing PCR response procedures of PCR instrument (ABIVeriti96well), peak optimization reaction program is as shown in table 3.
Table 3PCR response procedures table
3, capillary electrophoresis fragment analysis.
Methane amide (the SampleLoadingSolution of 38.5 μ L is added in each hole of 96 hole sample panel, ABsciex company, article No.: the interior mark (DNASizeStandardKit-400BasePairs of 608082) and 0.5 μ L, ABsciex company, article No.: 608098), again the PCR primer of 1 μ L is added wherein, instill a mineral oil, prevent in electrophoresis process because high temperature causes PCR primer to be volatilized.
The GenomeLab dissociating buffer of about 250 μ L is added in each hole of another 96 hole damping fluid plate.
According to the operational manual of capillary electrophoresis analysis instrument, sample panel and damping fluid plate are put into machine, run Frag-3 separable programming.Perform the analytical procedure of acquiescence, finally preserve data.
PCR primer clip size for each gene is different, and the capillary electrophoresis peak figure obtained, wherein X-coordinate represents fragment length, and ordinate zou represents fluorescence intensity.
4. interpretation of result
Capillary electrophoresis analysis instrument carries out data analysis automatically.
Three, the detected result of test kit judges
1. test kit availability deciding
Meet following condition simultaneously, just can carry out result judgement:
1) negative control: fluorescent signal do not detected between 138nt ~ 327nt.
2) positive control a: fluorescent signal respectively detected at each expanding fragment length place, and fluorescent signal value is higher than 2000.
2. sample availability deciding:
Between 138nt ~ 327nt:
1) if detect the fluorescent signal value of sample to have one at least higher than 200000, then sample adds excessive, carries out capillary electrophoresis detection again after advising suitably diluting PCR primer.
2) if the fluorescent signal value of detection sample is all lower than 2000, then sample add-on is lower, suitably can increase PCR primer add-on or increase PCR reaction cycle number; If still undesirable, again sample need be prepared.
3. result criterion
1) identification of strains
The object segment area of 16SrRNA gene there is corresponding peak and fluorescent signal value all higher than 2000, and the ratio of the specific peak area that specific peak area/-globin of answering of 16SrRNA and ureC gene pairs is corresponding is greater than 0.1, can judge to have infected helicobacter pylori.
2) virulence qualification
There is corresponding peak in the object segment area of cagA, vacA-s1, vacA-s2, vacA-m1, vacA-m2, iceA1, iceA2, dupA, oipA, luxS gene, fluorescent signal value is all higher than 2000, and the ratio of the specific peak area that specific peak area/-globin that each virulence gene is corresponding is corresponding is greater than 0.1, illustrate in the helicobacter pylori of patient infection containing this virulence gene expression.
3) resistance qualification
(1) clarithromycin resistance
When 180nt place occurs that peak area/175nt place occurs that the ratio of peak area is less than 0.25, illustrate that 23SrRNA gene 2143 site is homozygous wildtype, when 23SrRNA gene 2143 site is homozygous wildtype, clarithromycin is had no drug resistance.When 180nt place occurs that peak area/175nt place occurs that the ratio of peak area is 0.25 ~ 0.7, be decided to be the weak positive, when 23SrRNA gene 2143 site is the weak positive, have a small amount of resistance to clarithromycin.When 180nt place occurs that peak area/175nt place occurs that the ratio of peak area is 0.7 ~ 4, illustrate that 23SrRNA gene 2143 site is heterozygous mutant, when 180nt place occurs that peak area/175nt place occurs that the ratio of peak area is greater than 4, illustrate that 23SrRNA gene 2143 site is homozygous mutant, when 23SrRNA gene 2143 site is homozygous mutant or heterozygous mutant, there is resistance to clarithromycin.
(2) Metronidazole
When 257.6nt place occurs that peak area/252.6nt place occurs that the ratio of peak area is less than 0.25, illustrate that rdxA gene 148 site is homozygous wildtype, when rdxA gene 148 site is homozygous wildtype, metronidazole is had no drug resistance.When 257.6nt place occurs that peak area/252.6nt place occurs that the ratio of peak area is 0.25 ~ 0.7, be decided to be the weak positive, when rdxA gene 148 site is the weak positive, have a small amount of resistance to metronidazole.When 257.6nt place occurs that peak area/252.6nt place occurs that the ratio of peak area is 0.7 ~ 4, illustrate that rdxA gene 148 site is heterozygous mutant, when 257.6nt place occurs that peak area/252.6nt place occurs that the ratio of peak area is greater than 4, illustrate that rdxA gene 148 site is homozygous mutant, when rdxA gene 148 site is homozygous mutant or heterozygous mutant, there is resistance to clarithromycin.
(3) amoxycilline Trihydrate bp resistance
When 158.9nt place occurs that peak area/153.8nt place occurs that the ratio of peak area is less than 0.25, illustrate that pbp1A gene 17 77 site is homozygous wildtype, when pbp1A gene 17 77 site is homozygous wildtype, amoxycilline Trihydrate bp is had no drug resistance.When 158.9nt place occurs that peak area/153.8nt place occurs that the ratio of peak area is 0.25 ~ 0.7, be decided to be the weak positive.When pbp1A gene 17 77 site is the weak positive, there is a small amount of resistance to amoxycilline Trihydrate bp.When 158.9nt place occurs that peak area/153.8nt place occurs that the ratio of peak area is 0.7 ~ 4, illustrate that pbp1A gene 17 77 site is heterozygous mutant, when 158.9nt place occurs that peak area/153.8nt place occurs that the ratio of peak area is greater than 4, illustrate that pbp1A gene 17 77 site is homozygous mutant, when pbp1A gene 17 77 site is homozygous mutant or heterozygous mutant, there is resistance to amoxycilline Trihydrate bp.
(4) levofloxacin resistance
When 311nt place occurs that peak area/306nt place occurs that the ratio of peak area is less than 0.25, illustrate that gyrA gene 261 site is homozygous wildtype, when gyrA gene 261 site is homozygous wildtype, levofloxacin is had no drug resistance.When 311nt place occurs that peak area/306nt place occurs that the ratio of peak area is 0.25 ~ 0.7, be decided to be the weak positive.When gyrA gene 261 site is the weak positive, there is a small amount of resistance to levofloxacin.When 311nt place occurs that peak area/306nt place occurs that the ratio of peak area is 0.7 ~ 4, illustrate that gyrA gene 261 site is heterozygous mutant, when 311nt place occurs that peak area/306nt place occurs that the ratio of peak area is greater than 4, illustrate that gyrA gene 261 site is homozygous mutant, when gyrA gene 261 site is homozygous mutant or heterozygous mutant, there is resistance to levofloxacin.
4) quantitative analysis
Specific fragment (199nt) place that the peak area/-globin occurred when specific fragment (138nt) place corresponding to ureC is corresponding occurs that the ratio of peak area is greater than 0.1, patient infection helicobacter pylori is described, ratio is directly proportional to the copy number of helicobacter pylori, ratio is larger, illustrates that helicobacter pylori infection is more serious.Specific fragment (199nt) place that the peak area/-globin occurred when specific fragment (138nt) place corresponding to ureC is corresponding occurs that the ratio of peak area is less than 0.02, be judged to infect negative.When specific fragment (199nt) place that the peak area/-globin occurred when specific fragment (138nt) place corresponding to ureC is corresponding occurs that the ratio of peak area is 0.02 ~ 0.1, need again test.
4. result judges example
The collection of illustrative plates after capillary electrophoresis analysis is adopted as shown in Figure 1 after adopting the test kit of the present embodiment to carry out PCR reaction to positive control.All there is corresponding peak in the target fragment region of 16SrRNA, ureC ,-globin, cagA, vacA-s1, vacA-m1, vacA-m2, iceA1, iceA2, dupA, oipA, luxS, vacA-s2,23SrRNA, rdxA, pbp1A and gyrA gene.This result is very directly perceived, and 1 strain identification gene, 2 quantitate genes, 10 virulence associated genes, 4 drug resistance genes all increase well.Not interference between each primer is described, can effectively increase all goal gene simultaneously.
Adopt the collection of illustrative plates after capillary electrophoresis analysis as shown in Figure 2 after adopting the test kit of the present embodiment to carry out PCR reaction to negative control, do not occur any goal gene peak, only have non-specific background's fluorescent signal being less than 100nt place.
The collection of illustrative plates after capillary electrophoresis analysis is adopted as shown in Figure 3 after adopting the test kit of the present embodiment to carry out PCR reaction to sample 1.All there is corresponding peak in the target fragment region of 16SrRNA, ureC, cagA, vacA-s1, vacA-m1, iceA1, oipA, luxS, 23SrRNA, rdxA, pbp1A and gyrA gene.According to result criterion, this patient infection helicobacter pylori is described, and expresses corresponding virulence factor, have resistance to clarithromycin, levofloxacin, resistance is not had to metronidazole, amoxycilline Trihydrate bp.Detected result is very directly perceived.
Utilize the collection of illustrative plates after adopting capillary electrophoresis analysis as shown in Figure 4 after adopting the test kit of the present embodiment to carry out PCR reaction to sample 2.All there is corresponding peak in the target fragment region of 16SrRNA, ureC, cagA, vacA-s1, vacA-m2, iceA2, oipA, luxS, 23SrRNA, rdxA, pbp1A and gyrA gene.According to result criterion, this patient infection helicobacter pylori is described, and expresses corresponding virulence factor, have resistance to clarithromycin, metronidazole, resistance is not had to amoxycilline Trihydrate bp, levofloxacin.Detected result is very directly perceived.
The collection of illustrative plates after capillary electrophoresis analysis is adopted as shown in Figure 5 after adopting the test kit of the present embodiment to carry out PCR reaction to sample 3.All there is corresponding peak in the target fragment region of 16SrRNA, ureC, cagA, vacA-s1, vacA-m2, oipA, luxS, 23SrRNA, rdxA, pbp1A and gyrA gene.According to result criterion, this patient infection helicobacter pylori is described, and expresses corresponding virulence factor, have resistance to amoxycilline Trihydrate bp, resistance is not had to clarithromycin, metronidazole, levofloxacin.Detected result is very directly perceived.
Utilize the collection of illustrative plates after adopting capillary electrophoresis analysis as shown in Figure 6 after adopting the test kit of the present embodiment to carry out PCR reaction to sample 4.All there is not corresponding peak in the target fragment region of 16SrRNA, ureC, cagA, vacA-s1, vacA-m1, iceA2, oipA, luxS, 23SrRNA, rdxA, pbp1A and gyrA gene, but corresponding peak has appearred in the target fragment region of-globin gene.According to result criterion, illustrate that this patient does not infect helicobacter pylori.Detected result is very directly perceived.
Embodiment 2
The helicobacter pylori detection kit of the present embodiment is identical with the rest part of embodiment 1, and difference is: primer mixture only comprise the forward primer for 16SrRNA gene, the reverse primer for 16SrRNA gene, the forward primer for ureC gene, the reverse primer for ureC gene, for the forward primer of-globin gene, the reverse primer for-globin gene.
Obviously, above-described embodiment is only for example of the present invention is clearly described, and is not the restriction to embodiments of the present invention.For those of ordinary skill in the field, can also make other changes in different forms on the basis of the above description.Here without the need to also cannot enumerating all embodiments.And these belong to spirit institute's apparent change of extending out of the present invention or change and are still among protection scope of the present invention.
SEQUENCELISTING
<110> Tung Wah hospital
<120> helicobacter pylori quantitative and qualitative analysis multiple gene detection system and test kit thereof and application
<130> without
<160>38
<170>PatentInversion3.3
<210>1
<211>40
<212>DNA
<213> synthetic
<400>1
tgcatgacactcgagactagattactgaagctgattgcgc40
<210>2
<211>40
<212>DNA
<213> synthetic
<400>2
catgacgactcactatactactggagagactaagccctcc40
<210>3
<211>40
<212>DNA
<213> synthetic
<400>3
tgcatgacactcgagactaggatckttttgatgggacacc40
<210>4
<211>46
<212>DNA
<213> synthetic
<400>4
catgacgactcactatactacaaaaatcctaccaaaaagaatcagt46
<210>5
<211>39
<212>DNA
<213> synthetic
<400>5
tgcatgacactcgagactagctgcttgaatgcgccaaac39
<210>6
<211>42
<212>DNA
<213> synthetic
<400>6
catgacgactcactatactaatggaawtacaacaaacacacc42
<210>7
<211>44
<212>DNA
<213> synthetic
<400>7
tgcatgacactcgagactaggtttagaaactggcacyaggtcaa44
<210>8
<211>43
<212>DNA
<213> synthetic
<400>8
catgacgactcactatactaaaattggctataatccatgacyg43
<210>9
<211>39
<212>DNA
<213> synthetic
<400>9
tgcatgacactcgagactagttgcttgatggcctgcatt39
<210>10
<211>43
<212>DNA
<213> synthetic
<400>10
catgacgactcactatactagcaagcatggattatggtaagga43
<210>11
<211>42
<212>DNA
<213> synthetic
<400>11
tgcatgacactcgagactagccaggaatttttsttgcatcaa42
<210>12
<211>40
<212>DNA
<213> synthetic
<400>12
catgacgactcactatactaggcaaytctgaaaacactca40
<210>13
<211>43
<212>DNA
<213> synthetic
<400>13
tgcatgacactcgagactagactttaccctttgatgtggttac43
<210>14
<211>44
<212>DNA
<213> synthetic
<400>14
catgacgactcactatactatgtarttaaagtcgttaatggcaa44
<210>15
<211>43
<212>DNA
<213> synthetic
<400>15
tgcatgacactcgagactaggtggggtadataatcacttgaga43
<210>16
<211>40
<212>DNA
<213> synthetic
<400>16
catgacgactcactatactaacctatatcgctaacgcact40
<210>17
<211>41
<212>DNA
<213> synthetic
<400>17
tgcatgacactcgagactagccaatcacaagccctgaagat41
<210>18
<211>44
<212>DNA
<213> synthetic
<400>18
catgacgactcactatactaattatagggtttaggcactctctt44
<210>19
<211>40
<212>DNA
<213> synthetic
<400>19
tgcatgacactcgagactagacaccaaagtcaaagcccct40
<210>20
<211>40
<212>DNA
<213> synthetic
<400>20
catgacgactcactatactacccataggcgaccaatccay40
<210>21
<211>40
<212>DNA
<213> synthetic
<400>21
tgcatgacactcgagactagggtggtatctcaaggatggc40
<210>22
<211>38
<212>DNA
<213> synthetic
<400>22
catgacgactcactatactaaaccgcggcaagacggga38
<210>23
<211>43
<212>DNA
<213> synthetic
<400>23
catgacgactcactatactagatctaaccgcggcaagacggcg43
<210>24
<211>47
<212>DNA
<213> synthetic
<400>24
tgcatgacactcgagactagcactctaacyttataagactcyggrta47
<210>25
<211>41
<212>DNA
<213> synthetic
<400>25
catgacgactcactatactacgccaagctcttacaacaccc41
<210>26
<211>46
<212>DNA
<213> synthetic
<400>26
catgacgactcactatactaactatcgccaagctcttacaacactt46
<210>27
<211>42
<212>DNA
<213> synthetic
<400>27
tgcatgacactcgagactagtttggggacatcaaactttctt42
<210>28
<211>41
<212>DNA
<213> synthetic
<400>28
catgacgactcactatactacgacyattrgcaaaggagcaa41
<210>29
<211>46
<212>DNA
<213> synthetic
<400>29
catgacgactcactatactataacacgacyattrgcaaaggagctg46
<210>30
<211>38
<212>DNA
<213> synthetic
<400>30
tgcatgacactcgagactagaaggttaggcagacggct38
<210>31
<211>38
<212>DNA
<213> synthetic
<400>31
catgacgactcactatactacacccccatggcgataty38
<210>32
<211>43
<212>DNA
<213> synthetic
<400>32
catgacgactcactatactattaaccacccccatggcgatagr43
<210>33
<211>40
<212>DNA
<213> synthetic
<400>33
tgcatgacactcgagactagagccacaacccttttgaaga40
<210>34
<211>44
<212>DNA
<213> synthetic
<400>34
catgacgactcactatactatcatgaaagatttcttcaatcgct44
<210>35
<211>42
<212>DNA
<213> synthetic
<400>35
tgcatgacactcgagactagctcttatcttcctcccacagct42
<210>36
<211>42
<212>DNA
<213> synthetic
<400>36
catgacgactcactatactaagaaagcgagcttagtgatact42
<210>37
<211>20
<212>DNA
<213> synthetic
<400>37
tgcatgacactcgagactag20
<210>38
<211>20
<212>DNA
<213> synthetic
<400>38
catgacgactcactatacta20
Claims (10)
1. a helicobacter pylori quantitative and qualitative analysis multiple gene detection system, it is characterized in that: comprise the primer that strain identification gene 16SrRNA is detected, and the primer that the gene the ureC respectively copy number of helicobacter pylori being carried out to quantitative analysis detects with-globin.
2. helicobacter pylori quantitative and qualitative analysis multiple gene detection system according to claim 1, it is characterized in that: 5 ' end of the forward primer of described each primer is equipped with forward universal primer sequence, 5 ' end of the reverse primer of described each primer is equipped with reverse universal primer sequence;
For the nucleotide sequence of the forward primer of 16SrRNA gene as shown in SEQIDNo.1, for the nucleotide sequence of the reverse primer of 16SrRNA gene as shown in SEQIDNo.2;
For the nucleotide sequence of the forward primer of ureC gene as shown in SEQIDNo.33, for the nucleotide sequence of the reverse primer of ureC gene as shown in SEQIDNo.34;
For the nucleotide sequence of the forward primer of-globin gene as shown in SEQIDNo.35, and for the nucleotide sequence of the reverse primer of-globin gene as shown in SEQIDNo.36;
The nucleotide sequence of described forward universal primer is as shown in SEQIDNo.37;
The nucleotide sequence of described reverse universal primer is as shown in SEQIDNo.38.
3. helicobacter pylori quantitative and qualitative analysis multiple gene detection system according to claim 2, it is characterized in that: also comprise respectively to the primer that virulence gene cagA, vacA-s1, vacA-s2, vacA-m1, vacA-m2, iceA1, iceA2, dupA, oipA and luxS detect, respectively to the primer carrying out polymorphic detection in 261 sites of 2143 sites of drug resistant gene 23SrRNA, 148 sites of rdxA, 1777 sites of pbp1A and gyrA;
For the nucleotide sequence of the forward primer of cagA gene as shown in SEQIDNo.3, for the nucleotide sequence of the reverse primer of cagA gene as shown in SEQIDNo.4;
For the nucleotide sequence of the forward primer of vacA-s1 or vacA-s2 gene as shown in SEQIDNo.5, for the nucleotide sequence of the reverse primer of vacA-s1 or vacA-s2 gene as shown in SEQIDNo.6;
For the nucleotide sequence of the forward primer of vacA-m1 gene as shown in SEQIDNo.7, for the nucleotide sequence of the reverse primer of vacA-m1 gene as shown in SEQIDNo.8;
For the nucleotide sequence of the forward primer of vacA-m2 gene as shown in SEQIDNo.9, for the nucleotide sequence of the reverse primer of vacA-m2 gene as shown in SEQIDNo.10;
For the nucleotide sequence of the forward primer of iceA1 gene as shown in SEQIDNo.11, for the nucleotide sequence of the reverse primer of iceA1 gene as shown in SEQIDNo.12;
For the nucleotide sequence of the forward primer of iceA2 gene as shown in SEQIDNo.13, for the nucleotide sequence of the reverse primer of iceA2 gene as shown in SEQIDNo.14;
For the nucleotide sequence of the forward primer of dupA gene as shown in SEQIDNo.15, for the nucleotide sequence of the reverse primer of dupA gene as shown in SEQIDNo.16;
For the nucleotide sequence of the forward primer of oipA gene as shown in SEQIDNo.17, for the nucleotide sequence of the reverse primer of oipA gene as shown in SEQIDNo.18;
For the nucleotide sequence of the forward primer of luxS gene as shown in SEQIDNo.19, for the nucleotide sequence of the reverse primer of luxS gene as shown in SEQIDNo.20;
For the nucleotide sequence of the forward primer of 23SrRNA gene as shown in SEQIDNo.21, the nucleotide sequence of the reverse primer that corresponding 23SrRNA gene 2143 site is base A is as shown in SEQIDNo.22, and the nucleotide sequence of the reverse primer that corresponding 23SrRNA gene 2143 site is bases G is as shown in SEQIDNo.23;
For the nucleotide sequence of the forward primer of rdxA gene as shown in SEQIDNo.24, the nucleotide sequence of the reverse primer that corresponding rdxA gene 148 site is base C is as shown in SEQIDNo.25, and the nucleotide sequence of the reverse primer that corresponding rdxA gene 148 site is base T is as shown in SEQIDNo.26;
For the nucleotide sequence of the forward primer of pbp1A gene as shown in SEQIDNo.27, the nucleotide sequence of the reverse primer that corresponding pbp1A gene 17 77 site is base A is as shown in SEQIDNo.28, and the nucleotide sequence of the reverse primer that corresponding pbp1A gene 17 77 site is bases G is as shown in SEQIDNo.29;
For the nucleotide sequence of the forward primer of gyrA gene as shown in SEQIDNo.30, corresponding gyrA gene 261 site is for the nucleotide sequence of the reverse primer of base C or T is as shown in SEQIDNo.31, and the nucleotide sequence of the reverse primer that corresponding gyrA gene 261 site is bases G or A is as shown in SEQIDNo.32.
4. helicobacter pylori quantitative and qualitative analysis multiple gene detection system according to claim 3, is characterized in that: the final concentration of forward primer in detection system for 16SrRNA, ureC, cagA, vacA-s1, vacA-m1, vacA-m2, iceA1, iceA2, dupA, oipA and luxS gene is 200nM; The final concentration of reverse primer in detection system for 16SrRNA, ureC, cagA, vacA-s1, vacA-m1, vacA-m2, iceA1, iceA2, oipA, luxS and-globin gene is 100nM; The final concentration of forward primer in detection system for dupA and-globin gene is 100nM;
The final concentration of forward primer in detection system for 261 sites of 2143 sites of 23SrRNA gene, 148 sites of rdxA gene, 1777 sites of pbp1A gene and gyrA gene is 100nM; Corresponding 23SrRNA gene 2143 site is that the final concentration of reverse primer in detection system of base A is 300nM; Corresponding 23SrRNA gene 2143 site is that the final concentration of reverse primer in detection system of bases G is 350nM; The final concentration of reverse primer in detection system that corresponding rdxA gene 148 site is base C, corresponding pbp1A gene 17 77 site is base A, corresponding gyrA gene 261 site is the reverse primer of base C or T, corresponding rdxA gene 148 site is base T, corresponding pbp1A gene 17 77 site is bases G is 400nM; Corresponding gyrA gene 261 site is that the final concentration of reverse primer in detection system of bases G or A is 450nM.
5. helicobacter pylori quantitative and qualitative analysis multiple gene detection system according to any one of claim 1 to 4, is characterized in that: also comprise PCR damping fluid, MgCl
2the universal tag mixture of solution, dNTPs, warm start archaeal dna polymerase, band fluorescence and DNA profiling; The universal tag mixture of described band fluorescence comprises reverse universal primer and with fluorescently-labeled forward universal primer.
6. helicobacter pylori quantitative and qualitative analysis multiple gene detection system according to claim 5, is characterized in that: described fluorescent mark is CY5 or CY3 or FAM.
7. helicobacter pylori quantitative and qualitative analysis multiple gene detection system according to claim 6, is characterized in that: also comprise positive control solution and negative control thing; Described positive control is the plasmid mixture comprising all goal gene target spots; Described negative controls is nuclease free ultrapure water.
8. helicobacter pylori quantitative and qualitative analysis multiple gene detection system according to claim 6, it is characterized in that: amounts of components during reaction in system is 10 × PCR damping fluid 1 volume, universal tag mixture with fluorescence and the dNTPs of 2mmol/L totally 1 volume, the MgCl of 25mmol/L
2solution 2 volume, primer mixture 1 volume, warm start archaeal dna polymerase 1 volume of 5U/ μ L, DNA profiling 2 volume, pure water 2 volume; The usage quantity of described DNA profiling is 5 ~ 50ng/ system.
9. one kind adopts the helicobacter pylori quantitative and qualitative analysis multiple gene detection kit of detection system as claimed in claim 1.
10. the application adopting detection system as claimed in claim 1 to prepare the diagnosis and detection product of helicobacter pylori.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610070235.7A CN105441582B (en) | 2016-02-02 | 2016-02-02 | Helicobacter pylori is qualitative and quantitative multiplex genetic test system and its kit and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610070235.7A CN105441582B (en) | 2016-02-02 | 2016-02-02 | Helicobacter pylori is qualitative and quantitative multiplex genetic test system and its kit and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105441582A true CN105441582A (en) | 2016-03-30 |
| CN105441582B CN105441582B (en) | 2019-02-26 |
Family
ID=55552204
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610070235.7A Active CN105441582B (en) | 2016-02-02 | 2016-02-02 | Helicobacter pylori is qualitative and quantitative multiplex genetic test system and its kit and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105441582B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111996273B (en) * | 2020-11-02 | 2021-02-26 | 北京健为医学检验实验室有限公司 | Method and kit for detecting drug-resistant gene mutation of helicobacter pylori |
-
2016
- 2016-02-02 CN CN201610070235.7A patent/CN105441582B/en active Active
Non-Patent Citations (6)
| Title |
|---|
| 周丽芳，等: "多重基因分析系统检测幽门螺杆菌的初步研究", 《检验医学》 * |
| 徐凯: "不同消化性疾病来源的幽门螺杆菌毒力基因cagA、vacA、oipA、dupA的检测及其意义", 《中国优秀硕士学位论文全文数据库（医药卫生科技辑）》 * |
| 施莉，等: "芯片检测幽门螺杆菌左氧氟沙星耐药gyrA基因突变的应用", 《中华检验医学杂志》 * |
| 李大欢，等: "贵州省某院幽门螺杆菌致病性的优势基因型特征", 《重庆医学》 * |
| 胡玢婕，等: "幽门螺杆菌生物膜形成与其耐药机制的相关性", 《检验医学》 * |
| 黄德强: "幽门螺杆菌耐药基因的 DNA 序列分析", 《中国优秀博硕士学位论文全文数据库(硕士)医药卫生科技辑》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111996273B (en) * | 2020-11-02 | 2021-02-26 | 北京健为医学检验实验室有限公司 | Method and kit for detecting drug-resistant gene mutation of helicobacter pylori |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105441582B (en) | 2019-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105441583A (en) | Multiple-gene helicobacter pylori detection system and kit and application thereof | |
| AU2011227110B2 (en) | Methods, kits and compositions for detection of MRSA | |
| Cerqueira et al. | PNA-FISH as a new diagnostic method for the determination of clarithromycin resistance of Helicobacter pylori | |
| AU2013353904B2 (en) | Method for detecting Helicobacter pylori DNA in a stool sample | |
| Herthnek et al. | New PCR systems to confirm real-time PCR detection of Mycobacterium avium subsp. paratuberculosis | |
| Bölske et al. | Diagnosis of paratuberculosis by PCR. | |
| Schmitt et al. | PCR detection of clarithromycin-susceptible and-resistant Helicobacter pylori from formalin-fixed, paraffin-embedded gastric biopsies | |
| CN104745575A (en) | Gene composition used for detecting cell proliferative abnormality or grading disease degree and application thereof | |
| CN104745681A (en) | Multi-element generic composition and use thereof | |
| Xuan et al. | Detection of clarithromycin-resistant Helicobacter pylori in clinical specimens by molecular methods: A review | |
| Fearnley et al. | The development of a real-time PCR to detect pathogenic Leptospira species in kidney tissue | |
| Kargar et al. | Real-time PCR for Helicobacter pylori quantification and detection of clarithromycin resistance in gastric tissue from patients with gastrointestinal disorders | |
| CN103397024B (en) | Mycobacterium avium detection primer and probe and use their to detect the method for mycobacterium avium | |
| CN105463124A (en) | Helicobacter pylori identification and virulence multiplex gene detection system, kit adopting detection system and application of detection system | |
| CN105506160A (en) | System for detecting multiple quantitative and virulent genes of H.pylori as well as kits and applications of system | |
| Debruyne et al. | Comparative performance of different PCR assays for the identification of Campylobacter jejuni and Campylobacter coli | |
| CN105441582A (en) | Qualitative and quantitative multiple-gene helicobacter pylori detection system and kit and application thereof | |
| CN105368825A (en) | Helicobacter pylori antibiotic drug resistance analysis kit and drug resistance detecting method | |
| CN105506161A (en) | System for detecting multiple drug-resistant and quantitative genes of H.pylori as well as kits and applications of system | |
| JP2013504319A (en) | Peptide nucleic acid probe, kit and method for detecting Helicobacter pylori and / or clarithromycin resistance, and use thereof | |
| Shan et al. | Multiplex PCR-ASE functionalized microfluidic diagnostic platform for the detection of clarithromycin resistance mutations in Helicobacter pylori | |
| CN103224932A (en) | Primer and probe for detection of mycobacterium intracellulare, and method for detection of mycobacterium intracellulare using the primer or the probe | |
| MX2015003386A (en) | Method for detection of braf and pi 3k mutations. | |
| Alavifard et al. | Pyrosequencing analysis for rapid and accurate detection of clarithromycin resistance-associated mutations in Iranian Helicobacter pylori isolates | |
| FI126289B (en) | Method for detecting the presence of a hypervirulent strain of Clostridium difficile |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20180605 Address after: 200040 West Yan'an Road, Jingan District, Shanghai, No. 221 Applicant after: Huadong Hospital Applicant after: NINGBO HEALTH GENE TECHNOLOGIES CO., LTD. Address before: 200040 West Yan'an Road, Jingan District, Shanghai, No. 221 Applicant before: Huadong Hospital |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |