CN105420364A - Graphene accelerated PCR (polymerase chain reaction) technology - Google Patents
Graphene accelerated PCR (polymerase chain reaction) technology Download PDFInfo
- Publication number
- CN105420364A CN105420364A CN201510945883.8A CN201510945883A CN105420364A CN 105420364 A CN105420364 A CN 105420364A CN 201510945883 A CN201510945883 A CN 201510945883A CN 105420364 A CN105420364 A CN 105420364A
- Authority
- CN
- China
- Prior art keywords
- pcr
- graphene
- nucleic acid
- amplification
- accelerates
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a graphene accelerated PCR (polymerase chain reaction) technology, in particular an integrated novel modified PCR technology integrating a novel material graphene and PCR and being capable of accelerating nucleic acid amplification, and aims to increase contact between nucleic acid molecules, accelerate PCR process and reduce nonspecific amplification in a PCR system by utilizing the characteristics of adsorption and high-specific surface of graphene. The graphene accelerated PCR technology relates to the field of nucleic acid amplification in molecular biology and molecular tests, is a theoretical innovation integrating the novel material graphene and PCR detection, and can be used for increasing the contact probability of nucleic acid molecules by utilizing the characteristics of adsorption and high-specific surface of graphene, integrating a PCR to slowly release one or various ingredients, combining mineral oil or liquid petrolatum to seal and isolate the external environment, and solving the problem of false positivity caused by over-long reaction time of the PCR and increase of nonspecific amplification due to over-long reaction time of the PCR.
Description
Technical field:
The invention belongs to the field of nucleic acid amplification of molecular biology and molecule inspection, be specifically related to increase contact between nucleic acid molecule by the absorption of Graphene and high-ratio surface characteristic, accelerate PCR (polymerase chain reaction) process and the technical field of less non-specific amplification.
Background technology:
Nucleic acid amplification is the development along with human genetics, and especially the discovery of DNA double chain and one that develops out have the technology of innovation.The inspiration of nucleic acid amplification is created unintentionally: in test tube, simulate natural DNA index reproduction process at the KaryMullis of nineteen eighty-three U.S. PE-Cetus company.Its ultimate principle is to provide the suitable reactions systems such as oligonucleotide primer, archaeal dna polymerase, DNA profiling and buffer system, through DNA sex change, renaturation, extension, gets final product the section of DNA molecule of known two terminal sequences of exponential amplification.Experienced by invention and the progress of heat-resisting polymerase, thermal cycler instrument etc., apply for first PCR related invention patent (USPatent4,683,202) in Cetus company in 1987.
PCR (polymerase chain reaction) is by sex change--annealing--, and extension three primitive reaction steps are formed: the 1. sex change of template DNA: template DNA to be amplified is after being heated to about 94 DEG C certain hours, make template DNA double-strand or dissociate through the double-stranded DNA that pcr amplification is formed, make it to become strand, so that it is combined with primer, for lower whorl reaction is prepared; 2. the annealing (renaturation) of template DNA and primer: template DNA becomes after strand through heat denatured, and temperature is down to about 54 DEG C, and the complementary sequence of primer and template DNA strand matches and combines; 3. the extension of primer: temperature of reaction rises to about 72 DEG C, DNA profiling-primer binding substances is under hot resistant DNA polymerase effect, take dNTP as reaction raw materials, take target sequence as template, by base pair complementarity and semiconservative replication principle, synthesize a semiconservative replication chain that the is new and complementation of template DNA chain, continuous recirculation sex change--annealing--extends three processes, just can obtain more " semiconservative replication chain ", and this new chain can become again the template of circulation next time.Generally, often complete a circulation and need 2 ~ 4 minutes, within 2 ~ 3 hours, just can will wait that expanding goal gene amplification amplifies millions of times.Round pcr not only facilitates the development of gene clone technology greatly, also improve sensitivity and the efficiency of detection of nucleic acids, PCR has been widely used in the serial detection fields such as protein engineering, order-checking, molecular cloning, genome project, medical treatment, agricultural, herding, environmental protection, food, has become the basic technology of 21 reagent life sciences.
Adopt nucleic acid augmentative instrument conventional on the market, PCR primary first-order equation process probably needs 2 ~ 3 hours.Although this substantially reduced than the time used when finding round pcr originally, because operator are more and more urgent for the requirement of saving experimental period, people pay attention to, how when not affecting PCR detection efficiency, reducing the problem in PCR reaction times gradually.The research of the correlation function of Graphene (Graphene) provides possibility for improving PCR efficiency.PCR non-specific amplification in early stage is less, but along with the amplification of goal gene, non-specific amplification increases equally, if can shorten the PCR reaction times, then can greatly reduce non-specific amplification, reduces the possibility that false positive occurs.
Graphene (Graphene) is the extremely important novel material found over year more than last decade, and Graphene narrow sense concept refers to the two dimensional crystal only having a carbon atom thickness being made up of hexangle type honeycomb lattice structure carbon atom with sp2 hybridized orbital.The Graphene number of plies is normal distribution, and broad sense Graphene great majority refer to multi-layer graphene, as few layer graphene (3 ~ 5 layers), and multi-layer graphene (about 10 layers).Univ Manchester UK physicist An Deliehaimu and Constantine Nuo Woxiaoluofu isolated Graphene in 2004 from graphite, and confirming that Graphene can Individual existence, two people are also because of at " pioneering research of two-dimensional graphene material " common acquisition Nobel Prize in physics in 2010.Graphene is good conductor, and not only very hard but also electroconductibility is splendid, its electronic mobility can reach 200,000cm
2v
-1s
-1, resistivity can reach 10
-6Ω cm is the material that resistivity is minimum in the world, is also splendid normal temperature superconducting material.Graphene also has the characteristic of good bio-compatibility and the various atom of absorption and molecule.
Nucleic acid molecule is extremely small, and the relative distance between its molecule is comparatively large, each other from away from, if the contact between nucleic acid molecule can be increased, just can increase the efficiency of nucleic acid amplification.Because Graphene has good bio-compatibility, there is the various atom of absorption and molecule and up to 2600m simultaneously
2the characteristic of/g specific surface, the adsorbable nucleic acid molecule of Graphene, and be dispersed to rapidly further in PCR reaction compartment, greatly accelerate the contact area between nucleic acid molecule and efficiency.And Standard PCR reaction makes nucleic acid double chain separately only by high temperature, make its random incorporation and carry out pcr amplification, by the combination of Graphene and nucleic acid molecule, Reaction time shorten greatly, PCR non-specific amplification can be reduced because the reaction times shortens simultaneously, guarantee the reliability of result.
Summary of the invention:
In order to the non-specific amplification problem solving PCR long reaction time and bring thus, the present invention's " a kind of Graphene acceleration round pcr " combines the improvement round pcr of the acceleration PCR process that a kind of novel material Graphene combines with PCR, Graphene is utilized to have the characteristic of absorption and high-ratio surface, increase the contact area between nucleic acid molecule and efficiency, substantially reduce the PCR reaction times, scientific research and Clinical Laboratory personnel are allowed to understand detected result in time, reduce non-specific amplification simultaneously, improve detection efficiency and accuracy.
A kind of Graphene accelerates round pcr, it is characterized in that the new capability of a kind of integration that a kind of novel material Graphene combines with PCR accelerates the improvement round pcr of nucleic acid amplification, Graphene is utilized to have absorption and high-ratio surface characteristic, in PCR reaction system, increase the contact between nucleic acid molecule, accelerate PCR (polymerase chain reaction) process and reduce non-specific amplification.PCR described above is a kind of Protocols in Molecular Biology for amplifying the specific DNA fragmentation that increases, and it can be counted as the special DNA replication dna process of in vitro.
A kind of Graphene accelerates round pcr, it is characterized in that described novel material Graphene narrow sense concept refers to the two dimensional crystal only having a carbon atom thickness being made up of hexangle type honeycomb lattice structure carbon atom with sp2 hybridized orbital, also broad sense Graphene (multilayer) can be adopted to be good with the multi-layer graphene within 10 layers especially, and there is the Graphene of higher absorption and high-ratio surface characteristic.
A kind of Graphene accelerates round pcr, it is characterized in that its English of described PCR is expressed as PolymeraseChainReaction, its Chinese is expressed as polymerase chain reaction, refer to suitable reactions systems such as providing oligonucleotide primer, archaeal dna polymerase, DNA profiling and buffer system, through DNA sex change, renaturation, extension can the process of section of DNA molecule of known two terminal sequences of exponential amplification.
A kind of Graphene accelerates round pcr, it is characterized in that the new capability of a kind of integration that described Graphene combines with PCR accelerates the improvement round pcr of nucleic acid amplification, Cheng Qian can be crossed in preparation PCR reaction system, in, appropriate Graphene is added afterwards according to concrete solution properties, to shorten the nucleic acid amplification time, the problem of non-specific amplification solving PCR primary first-order equation overlong time (needing 2 ~ 3 hours) and cause thus, the PCR reaction times can be shortened, greatly reduce the generation of non-specific amplification simultaneously, reduce the possibility that false positive occurs, make to understand experiment or detected result within a short period of time and obtain more reliable data to become possibility.
A kind of Graphene accelerates round pcr, it is characterized in that nucleic acid molecule refers to the biomacromolecule compound become by many nucleotide polymerization, it is one of most base substance of life, extensively be present in the cell of all animal and plant cellss, microorganism and artificial culture or breeding, organ, tissue etc. or other life entity bodies, DNA single chain, RNA single strand in the hybrid molecule that nucleic acid is divided into thymus nucleic acid (DNA) and Yeast Nucleic Acid (RNA) and RNA and DNA to combine according to chemical constitution difference or reaction system.DNA is the essential substance basis storing, copy and convey hereditary information.RNA mainly contains tRNA, mRNA, rRNA and MicroRNA etc., and: RNA plays an important role-wherein transfer RNA (tRNA) in protein building-up process, is called for short tRNA, plays a part to carry and shift activated amino acid; Messenger RNA(mRNA), being called for short mRNA, is the template of synthetic protein; Ribosomal Yeast Nucleic Acid, being called for short rRNA, is the main place of cell synthetic protein.
A kind of Graphene accelerates round pcr, it is characterized in that the contact increased between nucleic acid molecule refers to by Graphene absorption, dispersed nucleic acid molecule, to increase the contact probability between nucleic acid molecule, improves nucleic acid amplification efficiency.
A kind of Graphene accelerates round pcr, it is characterized in that on the PCR reaction solution liquid level prepared, add mineral oil or the closed isolated external environment of whiteruss, and make dUTP replace dTTP substrate, adding uracil-DNA glycosylase (UDG enzyme) in PCR system digests micro-aerosol glue stain simultaneously.Combine and adopt a certain or Multiple components hot start method of PCR slowly-releasing, a certain composition (as primer) can be dissolved in 15% (w/v) Dextran and PEG mixture, 15% (w/v) Dextran and the PEG mixing thick substances containing a certain composition is made to be placed in bottom reaction system, add other composition of PCR more successively, inviolent mixing is in order to avoid destroy slowly-releasing layered structure, combine above-mentioned mineral oil or whiteruss to close isolated external environment strategy and Graphene and to combine with PCR this strategy of contact probability increased between nucleic acid molecule, reaction times and the problem such as PCR non-specific amplification and aerosol glue stain can be greatly reduced, be applicable to Graphene combine with PCR and accelerate the herding of PCR strategy, agricultural, food, clinical diagnosis, the field of nucleic acid amplification of scientific research detection and enzyme immunodetection and diagnosis.
A kind of Graphene accelerates round pcr, it is characterized in that this improvement round pcr for external diagnosis reagent III-1 series products namely " with pathogenic pathogen antigen, antibody and nucleic acid etc. detect relevant reagent " in detection of nucleic acids related reagent, as hbv nucleic acid detection reagent, hepatitis B virus surface antigen (HBsAg) detection reagent, hepatitis C virus (HCV) nucleic acid detection reagent, hepatitis D virus (HDV) nucleic acid detection reagent, human immunodeficiency virus (HIV) nucleic acid detection reagent, the serial nucleic acid detection reagent such as human papillomavirus (HPV) genotype tests reagent.
A kind of Graphene accelerates round pcr, it is characterized in that this improvement round pcr for PCR, the Bubble-PCR of Standard PCR, real-time fluorescence quantitative PCR, Multiple detection PCR, inverse PCR, anchor PCR, link mediation, nest-type PRC, to synthesize PCR, immuno-PCR, gene type PCR, high GC content PCR, LA-PCR, heat start PCR, fusion DNA vaccine, clone PCR, bacterium colony PCR, reverse transcription PCR to the PCR that suddenlys change, order-checking and DNA based on the field of nucleic acid amplification of polymerase chain reaction.
A kind of Graphene accelerates round pcr, it is characterized in that the slowly-releasing PCR adding immobilization AsOligo, Nano microsphere is cross-linked AsOligo and Graphene adsorbs different primers to adding silicon chip in advance through overlay film, exposure, development, in array garden well reaction chamber after photoetching, solid phase slowly-releasing primer is split warm start in the well of garden and is just discharged, there is different target primer in different gardens well, micro-sphere crosslinked AsOligo and Graphene, preparation does not contain the PCR reaction solution of primer and adds sample of nucleic acid, make it to be distributed in uniformly in chip PCR chamber, add mineral oil or whiteruss again in chip surface airtight garden well in case primer interference after slowly-releasing, silicon encloses thin transparent diaphragm, and keep airtight as far as possible, poly array PCR or quantitative fluorescent PCR is carried out with whole silicon.
A kind of Graphene accelerates round pcr, it is characterized in that the application of policies of the contact acceleration PCR increased between nucleic acid molecule by a kind of absorption and high-ratio surface characteristic of novel material Graphene is write in computer software programs and network program, improve PCR detection efficiency, reduction PCR reaction times and reduce nucleic acids non-specific amplification, improving the nucleic acid amplification technologies of the acceleration PCR process that Graphene combines with PCR further.
A kind of Graphene accelerates round pcr, it is characterized in that being used alone or conbined usage of isolated external environment strategy closed by contact acceleration round pcr, PCR reacted constituent slow release method, mineral oil or the whiteruss increased between nucleic acid molecule by a kind of absorption and high-ratio surface characteristic of novel material Graphene, accelerate PCR process further and or reduce non-specific amplification effect.
A kind of Graphene accelerates round pcr, it is characterized in that the application of policies accelerating PCR by the contact increased between nucleic acid molecule of a kind of absorption of novel material Graphene and high-ratio surface characteristic provides instruments design and the exploitation of thermal cycling in regular-PCR instrument, quantitative real time PCR Instrument etc., improve the efficiency of PCR reaction and or reduce non-specific nucleic acid amplification.
A kind of Graphene accelerates round pcr, it is characterized in that the application of this technology is as gene amplification detection kit, main component comprises sample nucleic acid and extracts reagent, substrate dNTPs or dUTPs, primer, heat-resisting polymerase and damping fluid thereof, also can contain fluorescence dye, fluorescent probe.
The present invention's " a kind of Graphene acceleration round pcr " object is to increase contact between nucleic acid molecule to accelerate PCR (polymerase chain reaction), be conducive to the non-specific amplification reducing nucleic acid, reaction times shortening is more conducive to observations and guarantees its reliability simultaneously.PCR is by sex change--annealing--extends three primitive reaction steps and forms: the sex change of template DNA, template DNA and the annealing (renaturation) of primer, the extension of primer, under the effect of hot resistant DNA polymerase, take dNTP as reaction raw materials, take target sequence as template, by base pair complementarity and semiconservative replication principle, synthesize a semiconservative replication chain that the is new and complementation of template DNA chain, continuous recirculation sex change--annealing--extends three processes, just can obtain more " semiconservative replication chain ".Generally, often complete a circulation and need 2 ~ 4 minutes, within 2 ~ 3 hours, just can will wait that expanding goal gene amplification amplifies millions of times.Along with the workload of scientific worker is increasing with the quantity of information contacted, the limited time is effectively utilized to complete more work just very urgent.In addition in PCR experiment process, PCR pollution problem is the problem of numerous scientific research personnel very headache always.In PCR pollutes, non-specific amplification situation is very complicated, also be the subject matter causing PCR to pollute, usually solve a kind of pollution, the pollution of the non-specific amplification of other unknown causes still exists, when making PCR invention be authorized to more than 3000 part of patent of invention, biological educational circles does not still find the key issue solving PCR and pollute.PCR pollutes basic source primarily of 2 aspects: polluting again of the positive template crossed contamination 1, outside PCR reaction system and PCR primer aerosol glue.Any DNA chain of the Excess primer 2, in PCR reaction system and its 3 ' termini-complementary is hybridized, is increased.The present invention's " a kind of Graphene acceleration round pcr " utilizes a kind of novel material Graphene to adsorb and high-ratio surface characteristic accelerates PCR strategy to the contact increased between nucleic acid molecule, isolated external environment strategy closed by PCR reacted constituent slowly-releasing strategy, mineral oil or whiteruss, greatly can weaken non-specific amplification and aerosol glue stain problem, not only accelerate PCR process, improve verity and the accuracy of detection simultaneously.
The present invention's " a kind of Graphene acceleration round pcr " specification sheets and embodiment mainly set forth its mechanism and technical characterstic for SYBRGreenI real-time fluorescence quantitative PCR, this is not only easy and simple to handle, sensitive, cheap based on worry SYBRGreenI real-time fluorescence quantitative PCR, also because more accurately can see reaction process intuitively.Adopt SYBRGreenI real-time fluorescence quantitative PCR not represent the present invention as embodiment and be only limitted to SYBRGreenI Real-Time Fluorescent Quantitative PCR Technique, the present invention can be applicable to the various round pcrs containing primer, comprise the amplification technique of various DNA/RNA, various multiple/unwind technology, various fluorescence dye/fluorescent probe PCR technology, the quantitatively various/variation of array round pcr, various thermal cycling, constant temperature detect round pcr etc.
PCR is with exponential form amplified target gene, namely often through a PCR thermal cycling, molecules of interest is amplification one times just, fluorescence dye SYBRGreenI real-time fluorescence quantitative PCR is on regular-PCR basis, introduce DNA fluorescence dye SYBRGreenI, and the fluorescent value that Real-Time Monitoring record PCR reacts, SYBRGreenI is a kind of fluorescence dye that can be incorporated in DNA double spiral ditch, and reading value in conjunction with fluorescence after DNA double chain increases more than hundreds of times, synchronously can reflect the DNA content of pcr amplification.
Graphene has following main characteristic: 1, high electronic mobility: can reach 200,000cm2V
-1s
-1; 2, extremely low resistivity, resistivity can reach 10
-6Ω cm is the material that resistivity is minimum in the world, is also the superconducting material under normal temperature; 3, excellent mechanical property: Young ' smodulus1.1Tpa; 4, high-ratio surface, the good Graphene specific surface of quality can reach 2600m
2/ g; 5, fabulous stability; 6, bio-compatibility; 7, adsorbable various atom and molecule etc.Graphene scanning electron microscope the results are shown in accompanying drawing 1.The present invention's " a kind of Graphene acceleration round pcr " its principle utilizes Graphene high-ratio surface, adsorbable various atom and molecule, this series of characteristics of bio-compatibility, by Graphene absorption, dispersed nucleic acid molecule, to increase the contact efficiency between nucleic acid molecule, improve nucleic acid amplification efficiency, and reduce non-specific amplification.Graphene and nucleic acid action principle are shown in accompanying drawing 2
The present invention's " a kind of Graphene acceleration round pcr " is the nucleic acid amplification technologies of improvement, is not for concrete single product, cannot describes in detail one by one.Its core operation process has: 1, the preparation of graphene-containing reagent: Graphene is dissolved in ultrapure water, stirs gently and makes it dissolve completely, treat that solution returns to room temperature, airtight preservation.2, in being dissolved in by a certain composition (as primer), 15% (w/v) Dextran and the PEG mixing thick substances containing a certain composition is placed in bottom reaction system.3, the preparation of PCR reaction solution.4, the detection such as regular-PCR instrument or quantitative real time PCR Instrument is adopted.
Application Areas citing of the present invention:
(1) transmissible disease gene screening or detection by quantitative: communicable disease comparatively early brings into use the field of Standard PCR and real-time fluorescence quantitative PCR, traditional inspection-free survey of transmissible disease enzyme more and more substitute by corresponding real-time fluorescence PCR detection by quantitative, there is the problem that window phase is undetected hardly.
(2) drug-resistant bacteria or virogene examination or detection by quantitative: antibiotic resistance problems more and more comes into one's own, new drug development speed is unable to catch up with the development of resistance far away, and round pcr will provide early warning in early stage and late detection for drug resistance problems.
(3) examination of food safety check or detection by quantitative: food safety is more and more subject to everybody attention, enterovirus and pathogenic bacterium are food safety check projects of outbalance, as enterovirus EV, norwalk virus, rotavirus, hepatitis A virus (HAV), pathogenic S. aureus L-forms, pathogenic colon bacillus, Salmonellas, Shigellae etc. can adopt the present invention to carry out PCR examination or detection by quantitative.
(4) inherited disease gene screening or detection: some typical heredopathia multi-sources, in congenital genetic flaw, as α-thalassemia, heredity diabetes, Mongolian dementia, can adopt the present invention to carry out PCR examination detection.
(5) genetic expression mRNA detection by quantitative: the research of many gene tests and function, needs a large amount of mRNA reverse transcriptions to become cDNA to carry out functional study.The available reverse transcription of above-mentioned detection parallel amplification two-step approach, also RT-PCR single tube can be adopted to react in an i.e. pipe add the enzyme (reversed transcriptive enzyme and hot resistant DNA polymerase) that two kinds different, or adopt the Tth thermostable enzyme of existing ThermoScript II and DNA polymerase activity to detect.
(6) trace of albumin antigen quantify or by antibody linked Oligo detection by quantitative: traditional antigen-antibody enzyme exempt from ELISA method especially chemoluminescence ELISA be widely applied, but its sensitivity still do not reach immune PCR technique fly a gram rank.The present invention is applied to immuno-PCR, antigen or antibody linked streptavidin, is reacted by the oligonucleotide DNA immunization of biomarker, and corresponding oligonucleotide DNA real-time quantitative PCR detects, and typical curve is corrected.
(7) genetic fingerprinting and medical Gene Type Matching detect: the PCR for significant genes such as STR/microsatellite DNA, Y chromosome gene, chondriogens detects, and restriction fragment length polymorphism analysis or amplified fragment length polymorphism have become the reliable method of legal medical expert's individual recognition and paternity test, tissue matching.
(8) transgene agricultural product examination or detection by quantitative: the biological safety of transgene agricultural product is more and more subject to everybody attention, the detection of nucleic acids of agricultural-food and processed food transgene component has become the important means of food safety check, the general promoter gene common using various transgenosis, as template to be measured, carries out real-time fluorescence PCR rapid detection.
(9) other are for the field of gene amplification, examination, detection by quantitative: as fermentation industry bacterial gene detection by quantitative, the detection of environmental protection unwanted bacteria gene quantification, breeding gene SNP examination or detection, the examination of husbandry disease and pest or detection by quantitative etc.
Accompanying drawing illustrates:
Fig. 1 is single-layer graphene SEM scanning electron microscope result.
Fig. 2 is that Graphene is combined with reagent effective constituent and acts on the schematic diagram of sample.
represent Graphene, ● represent nucleic acid molecule,
represent PCR reaction system.
Fig. 3 is the fluorescent quantitative PCR experiment normal reaction time not adding Graphene.
Fig. 4 is the fluorescent quantitative PCR experiment reduction reaction times adding and do not add Graphene.
Embodiment:
Following embodiment illustrates the content of the present invention's " a kind of Graphene acceleration round pcr " further, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, the amendment make the inventive method, condition, step and application or replacement, all belong to scope of the present invention.
The manner of formulation of main graphene-containing reagent:
(1) preparation of primer Graphene mixture: primarily of primer (one of upstream and downstream primer can be selected), 15% (w/v) Dextran and PEG mixture, ultrapure water, high-quality Graphene composition.Concrete process for preparation is as follows: add in ultrapure water by the one of upstream and downstream primer, fully mix, and adds appropriate high-quality Graphene, and finally adding 15% (w/v) Dextran and PEG mixture can use.
(2) preparation of reaction solution Graphene mixture: primarily of dUTP or dNTP, SYBRGreenI (25 ×), Taq enzyme, 10 × PCRbuffer, ultrapure water (adding appropriate high-quality Graphene in advance), abundant mixing, can use.
Above-mentioned two kinds of preparation of reagents modes, be only used to citing convenient described in, every Graphene is added in nucleic acid amplification system by different way, is all interpreted as the justice that should have of Graphene preparation of reagents, i.e. described scope of the present invention.Following examples are example in the second, i.e. reaction solution Graphene mixture preparation.
Specific embodiment one: viruses of human hepatitis B's real-time fluorescence quantitative PCR
Hepatitis B (referred to as hepatitis B) is the communicable disease of a kind of worldwide wide-scale distribution caused by hepatitis B virus.The detection method of current hepatitis B mainly contains that enzyme is exempted from method, put the method for exempting from, chemoluminescence method, nucleic acid amplification (PCR) fluorescent quantitation, the latter can accurately detect hepatitis B virus gene content, and the detection for patient's virus replication level, infectivity, curative effect of medication is significant.The present invention selects the common conserved sequence of HBV as primer sequence to be measured, and selected hepatitis B virus (HBV) core Core district's gene (GenBank:X04615.1) is as templet gene to be measured, and its sequence is as follows:
241acagagtctaga
ctcgtggtggacttctctcaattttctagggggagcacccacgtgtcc
301tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttg
361tcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgct.
Preferred HBVc primer sequence is as follows:
HBVcF(LEFTPRIMER):5’-ctcgtggtggacttctctca-3’
HBVcR(RIGHTPRIMER):5’-agcagcaggatgaagaggaa-3’
SYBRGreenI real-time fluorescence PCR is quantitative: get appropriate high-quality Graphene and be first dissolved in ultrapure water (dH
2o) after, with this dH
2o is formulated as follows reaction solution, for 50 μ l systems:
Bottom each PCR pipe, first add the slowly-releasing primer (primer namely containing 15%Dextran and PEG mixture) that 4 μ l prepare, then add the above-mentioned reaction system liquid of 36 μ l, add serial sample to be tested and standard substance 10 μ l respectively.Carefully add 50 μ l mineral oil or whiteruss again with capping liquid level, carry out PCR reaction to 94 DEG C in, primer can slow release out.Arrange simultaneously do not add Graphene all the other systems with above-mentioned reaction in contrast.
Be positioned over real-time fluorescence quantitative PCR instrument, by specification operates.First sex change 94 DEG C of 2min are 45 circulations: 94 DEG C of 15s, 54 DEG C of 15s, 72 DEG C of 15s later.Read fluorescent value in 72 DEG C, and solubility curve analysis is set.Above-mentioned experiment also can with the reaction solution not adding SYBRGreenI, and amplification condition is constant, and mineral oil carries out regular-PCR after closing, and after 30-35 circulation, product 1-2% agarose gel electrophoresis detects.
Interpretation: using manual simulation's positive plasmid pHBVc as plasmid standards for quantitation, dilutes 10 times successively as typical curve, the conversion of its series concentration and copy number and have linear relationship with the Ct value that real-time fluorescence quantitative PCR produces.
Ct | 16 | 19.3 | 22.6 | 26 | 29.5 | 33 | 37 |
Copy | 3×10 9 | 3×10 8 | 3×10 7 | 3×10 6 | 3×10 5 | 3×10 4 | 3×10 3/ml |
Con | 10ng | 1ng | 100pg | 10pg | 1pg | 0.1pg | 10fg/ml |
Arrange the parallel fluorescent quantitative PCR experiment that the normal reaction time (30s) adds Graphene simultaneously, only make its reaction times be adjusted to: first sex change 94 DEG C of 4min, be 45 circulations: 94 DEG C of 30s, 54 DEG C of 30s, 72 DEG C of 30s later.Fluorescent value is read in 72 DEG C.
The fluorescent quantitative PCR experiment (accompanying drawing 3) that the normal reaction time (30s) does not add Graphene is set.Its reaction times is adjusted to: first sex change 94 DEG C of 4min, is 45 circulations: 94 DEG C of 30s, 54 DEG C of 30s, 72 DEG C of 30s later.Fluorescent value is read in 72 DEG C.Accompanying drawing 3 illustrates: 1 representative is with plasmid pHBVc2.0 × 10
7/ ml is template, the fluorescent quantitative PCR experiment not adding Graphene of normal reaction time (30s); 2 representatives are with plasmid pHBVc2.0 × 10
4/ ml is template.
The fluorescent quantitative PCR experiment (accompanying drawing 4) that reduction reaction times (30s) adds and do not add Graphene is set.Accompanying drawing 4 illustrates: 3 representatives are with plasmid pHBVc2.0 × 10
7/ ml is template, the fluorescent quantitative PCR experiment adding Graphene of Reaction time shorten (15s); 4 representatives are with plasmid pHBVc2.0 × 10
7/ ml is template, the fluorescent quantitative PCR experiment not adding Graphene of Reaction time shorten (15s); 5 representatives are with plasmid pHBVc2.0 × 10
4/ ml is template, the fluorescent quantitative PCR experiment adding Graphene of Reaction time shorten (15s); 6 representatives are with plasmid pHBVc2.0 × 10
4/ ml is template, the fluorescent quantitative PCR experiment not adding Graphene of Reaction time shorten (15s);
Accompanying drawing 3,4 analysis: 1 compares display with 3, adds Graphene and after Reaction time shorten, the fluorescent quantitative PCR experiment not adding Graphene of its result and normal reaction time has no notable difference; 2 compare display with 4, and when sample size is less, adding Graphene can reduce non-specific amplification.3 compare display with 4, are adding and do not adding the Graphene reduction reaction times in the fluorescent quantitative PCR experiment of 15s, and its reaction of reaction solution not adding Graphene not exclusively, causes Ct value to be delayed; 3 compare display with 4, are adding and do not adding the Graphene reduction reaction times in the fluorescent quantitative PCR experiment of 15s, and its reaction of reaction solution not adding Graphene not exclusively, causes Ct value obviously to be delayed.In summary, when other conditions are constant, add Graphene and obviously can accelerate PCR reaction, and non-specific amplification can be reduced accordingly.
Claims (14)
1. a Graphene accelerates round pcr, it is characterized in that, the new capability of a kind of integration that a kind of novel material Graphene combines with PCR accelerates the improvement round pcr of nucleic acid amplification, Graphene is utilized to have absorption and high-ratio surface characteristic, in PCR reaction system, increase the contact between nucleic acid molecule, accelerate PCR process and reduce non-specific amplification.
2. a kind of Graphene according to claim 1 accelerates round pcr, it is characterized in that, described novel material Graphene narrow sense concept refers to the two dimensional crystal only having a carbon atom thickness being made up of hexangle type honeycomb lattice structure carbon atom with sp2 hybridized orbital, also broad sense Graphene (multilayer) can be adopted to be good with the multi-layer graphene within 10 layers especially, and there is the Graphene of higher absorption and high-ratio surface characteristic.
3. a kind of Graphene according to claim 1 accelerates round pcr, it is characterized in that, its English of described PCR is expressed as PolymeraseChainReaction, its Chinese is expressed as polymerase chain reaction, refer to provide the suitable reactions systems such as oligonucleotide primer, archaeal dna polymerase, DNA profiling and buffer system, through DNA sex change, renaturation, extension can the process of section of DNA molecule of known two terminal sequences of exponential amplification.
4. a kind of Graphene according to claim 1 accelerates round pcr, it is characterized in that, the new capability of a kind of integration that described Graphene combines with PCR accelerates the improvement round pcr of nucleic acid amplification, Cheng Qian can be crossed in preparation PCR reaction system, in, appropriate Graphene is added afterwards according to concrete solution properties, to shorten the nucleic acid amplification time, the problem of non-specific amplification solving PCR primary first-order equation overlong time (needing 2 ~ 3 hours) and cause thus, the PCR reaction times can be shortened, greatly reduce the generation of non-specific amplification simultaneously, reduce the possibility that false positive occurs, make to understand experiment or detected result within a short period of time and obtain more reliable data to become possibility.
5. a kind of Graphene according to claim 1 accelerates round pcr, it is characterized in that, described nucleic acid molecule refers to the biomacromolecule compound become by many nucleotide polymerization, it is one of most base substance of life, extensively be present in all animal and plant cellss, the cell of microorganism and artificial culture or breeding, organ, organize in grade or other life entity bodies, the hybrid molecule that nucleic acid is divided into thymus nucleic acid (being called for short DNA) and Yeast Nucleic Acid (being called for short RNA) and RNA and DNA to combine according to chemical constitution difference, or the DNA single chain in reaction system, RNA single strand.
6. a kind of Graphene according to claim 1 accelerates round pcr, it is characterized in that, contact between described increase nucleic acid molecule refers to by Graphene absorption, dispersed nucleic acid molecule, to increase the contact probability between nucleic acid molecule, improves nucleic acid amplification efficiency.
7. a kind of Graphene according to claim 1 accelerates round pcr, it is characterized in that on the PCR reaction solution liquid level prepared, add mineral oil or the closed isolated external environment of whiteruss, and make dUTP replace dTTP substrate, adding uracil-DNA glycosylase (UDG enzyme) in PCR system digests micro-aerosol glue stain simultaneously.Combine and adopt a certain or Multiple components hot start method of PCR slowly-releasing, a certain composition (as primer) can be dissolved in 15% (w/v) Dextran and PEG mixture, 15% (w/v) Dextran and the PEG mixing thick substances containing a certain composition is made to be placed in bottom reaction system, add other composition of PCR more successively, inviolent mixing is in order to avoid destroy slowly-releasing layered structure, combine above-mentioned mineral oil or whiteruss to close isolated external environment strategy and Graphene and to combine with PCR this strategy of contact probability increased between nucleic acid molecule, reaction times and the problem such as PCR non-specific amplification and aerosol glue stain can be greatly reduced, be applicable to Graphene combine with PCR and accelerate the herding of PCR strategy, agricultural, food, clinical diagnosis, the field of nucleic acid amplification of scientific research detection and enzyme immunodetection and diagnosis.
8. a kind of Graphene according to claim 1 accelerates round pcr, it is characterized in that, this improvement round pcr is used for external diagnosis reagent III-1 series products namely " with pathogenic pathogen antigen, antibody and nucleic acid etc. detect relevant reagent " in detection of nucleic acids related reagent, as hbv nucleic acid detection reagent, hepatitis B virus surface antigen (HBsAg) detection reagent, hepatitis C virus (HCV) nucleic acid detection reagent, hepatitis D virus (HDV) nucleic acid detection reagent, human immunodeficiency virus (HIV) nucleic acid detection reagent, the serial nucleic acid detection reagent such as human papillomavirus (HPV) genotype tests reagent.
9. a kind of Graphene according to claim 1 accelerates round pcr, it is characterized in that, this improvement round pcr is used for Standard PCR, real-time fluorescence quantitative PCR, Multiple detection PCR, inverse PCR, anchor PCR, PCR, the Bubble-PCR of link mediation, nest-type PRC, synthesizes PCR, immuno-PCR, gene type PCR, high GC content PCR, LA-PCR, heat start PCR, fusion DNA vaccine, clone PCR, bacterium colony PCR, reverse transcription PCR to the PCR that suddenlys change, order-checking and DNA based on the field of nucleic acid amplification of polymerase chain reaction.
10. a kind of Graphene according to claim 1 accelerates round pcr, it is characterized in that, this improvement round pcr adds the slowly-releasing PCR of immobilization AsOligo, Nano microsphere is cross-linked AsOligo and Graphene adsorbs different primers to adding silicon chip in advance through overlay film, exposure, development, in array garden well reaction chamber after photoetching, solid phase slowly-releasing primer is split warm start in the well of garden and is just discharged, there is different target primer in different gardens well, micro-sphere crosslinked AsOligo and Graphene, preparation does not contain the PCR reaction solution of primer and adds sample of nucleic acid, make it to be distributed in uniformly in chip PCR chamber, add mineral oil or whiteruss again in chip surface airtight garden well in case primer interference after slowly-releasing, silicon encloses thin transparent diaphragm, and keep airtight as far as possible, poly array PCR or quantitative fluorescent PCR is carried out with whole silicon.
11. a kind of Graphenes according to claim 1 accelerate round pcr, it is characterized in that, the application of policies of the contact acceleration PCR increased between nucleic acid molecule by a kind of absorption and high-ratio surface characteristic of novel material Graphene is write in computer software programs and network program, improve PCR detection efficiency, reduction PCR reaction times and reduce nucleic acids non-specific amplification, improving the nucleic acid amplification technologies of the acceleration PCR process that Graphene combines with PCR further.
12. a kind of Graphenes according to claim 1 accelerate round pcr, it is characterized in that, being used alone or conbined usage of isolated external environment strategy closed by the contact acceleration round pcr, PCR reacted constituent slow release method, mineral oil or the whiteruss that are increased between nucleic acid molecule by a kind of absorption and high-ratio surface characteristic of novel material Graphene, accelerates PCR process further and or reduce non-specific amplification effect.
13. a kind of Graphenes according to claim 1 accelerate round pcr, it is characterized in that, the application of policies accelerating PCR by the contact increased between nucleic acid molecule of a kind of absorption of novel material Graphene and high-ratio surface characteristic provides instruments design and the exploitation of thermal cycling in regular-PCR instrument, quantitative real time PCR Instrument etc., improve the efficiency of PCR reaction and or reduce non-specific nucleic acid amplification.
14. a kind of Graphenes according to claim 1 accelerate round pcr, it is characterized in that, the application of this improvement round pcr is as gene amplification detection kit, main component comprises sample nucleic acid and extracts reagent, substrate dNTPs or dUTPs, primer, heat-resisting polymerase and damping fluid thereof, also can contain fluorescence dye, fluorescent probe.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510945883.8A CN105420364A (en) | 2015-12-18 | 2015-12-18 | Graphene accelerated PCR (polymerase chain reaction) technology |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510945883.8A CN105420364A (en) | 2015-12-18 | 2015-12-18 | Graphene accelerated PCR (polymerase chain reaction) technology |
Publications (1)
Publication Number | Publication Date |
---|---|
CN105420364A true CN105420364A (en) | 2016-03-23 |
Family
ID=55498899
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510945883.8A Pending CN105420364A (en) | 2015-12-18 | 2015-12-18 | Graphene accelerated PCR (polymerase chain reaction) technology |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105420364A (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107384765A (en) * | 2016-05-03 | 2017-11-24 | 韩国科学技术研究院 | Porous matrix comprising nucleic acid primer carbon material composite and the PCR using the porous matrix |
CN110184184A (en) * | 2019-05-07 | 2019-08-30 | 宁波大学 | A kind of preparation method and applications integrating nucleic acid extraction, enrichment and the nucleic acid reaction device in situ expanded |
CN110423796A (en) * | 2019-08-19 | 2019-11-08 | 上海纳米技术及应用国家工程研究中心有限公司 | A method of improving nucleic acid in vitro amplified reaction efficiency |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103205425A (en) * | 2012-01-17 | 2013-07-17 | 北京万达因生物医学技术有限责任公司 | Antisense interference oligonucleotide used for inhibiting primer non-specific amplification |
CN104977194A (en) * | 2014-04-10 | 2015-10-14 | 北京雷根生物技术有限公司 | Method of accelerating sample treatment with addition of graphene |
-
2015
- 2015-12-18 CN CN201510945883.8A patent/CN105420364A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103205425A (en) * | 2012-01-17 | 2013-07-17 | 北京万达因生物医学技术有限责任公司 | Antisense interference oligonucleotide used for inhibiting primer non-specific amplification |
CN104977194A (en) * | 2014-04-10 | 2015-10-14 | 北京雷根生物技术有限公司 | Method of accelerating sample treatment with addition of graphene |
Non-Patent Citations (1)
Title |
---|
《SMALL》 * |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107384765A (en) * | 2016-05-03 | 2017-11-24 | 韩国科学技术研究院 | Porous matrix comprising nucleic acid primer carbon material composite and the PCR using the porous matrix |
CN110184184A (en) * | 2019-05-07 | 2019-08-30 | 宁波大学 | A kind of preparation method and applications integrating nucleic acid extraction, enrichment and the nucleic acid reaction device in situ expanded |
CN110184184B (en) * | 2019-05-07 | 2022-03-11 | 浙江正合谷生物科技有限公司 | Preparation method and application of nucleic acid reactor integrating nucleic acid extraction, enrichment and in-situ amplification |
CN110423796A (en) * | 2019-08-19 | 2019-11-08 | 上海纳米技术及应用国家工程研究中心有限公司 | A method of improving nucleic acid in vitro amplified reaction efficiency |
CN110423796B (en) * | 2019-08-19 | 2024-02-13 | 上海纳米技术及应用国家工程研究中心有限公司 | Method for improving nucleic acid in-vitro amplification reaction efficiency |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Takahashi et al. | A low-cost paper-based synthetic biology platform for analyzing gut microbiota and host biomarkers | |
Fuks et al. | Combining 16S rRNA gene variable regions enables high-resolution microbial community profiling | |
Yue et al. | Advances in clustered, regularly interspaced short palindromic repeats (CRISPR)-based diagnostic assays assisted by micro/nanotechnologies | |
Bodrossy et al. | Oligonucleotide microarrays in microbial diagnostics | |
D’Agata et al. | Peptide nucleic acid-based biosensors for cancer diagnosis | |
Qian et al. | Prognostic cancer gene expression signatures: current status and challenges | |
Franke-Whittle et al. | Design and application of an oligonucleotide microarray for the investigation of compost microbial communities | |
Abdou Mohamed et al. | Diagnosing antibiotic resistance using nucleic acid enzymes and gold nanoparticles | |
Artika et al. | Real-time polymerase chain reaction: Current techniques, applications, and role in COVID-19 diagnosis | |
Pan et al. | Impacts of inter-and intralaboratory variations on the reproducibility of microbial community analyses | |
Nelson et al. | Label‐free detection of 16S ribosomal RNA hybridization on reusable DNA arrays using surface plasmon resonance imaging | |
AU5740400A (en) | Genomic profiling: a rapid method for testing a complex biological sample for the presence of many types of organisms | |
Veselinyová et al. | Selected in situ hybridization methods: principles and application | |
Roth | Quantifying gene expression | |
Ng et al. | Current perspectives on high-throughput sequencing (HTS) for adventitious virus detection: upstream sample processing and library preparation | |
CN105420364A (en) | Graphene accelerated PCR (polymerase chain reaction) technology | |
Gilbride | Molecular methods for the detection of waterborne pathogens | |
CN111521781B (en) | Detection kit for SARS-CoV-2 nucleic acid of new coronary pneumonia virus and detection method thereof | |
Wydro | Soil microbiome study based on DNA extraction: a review | |
Freitas et al. | Molecular biomarkers predict pathological complete response of neoadjuvant chemotherapy in breast cancer patients | |
Alamri et al. | Era of molecular diagnostics techniques before and after the COVID-19 pandemic | |
Wang et al. | Microarray analysis in drug discovery and clinical applications | |
Saxena et al. | Development and clinical validation of RT-LAMP-Based lateral-flow devices and electrochemical sensor for detecting multigene targets in SARS-CoV-2 | |
CN106033087B (en) | The method system of built-in property standard curve detection substance molecular number | |
WO2016119448A2 (en) | Artificial exogenous reference molecule for comparing types and natural abundance between microorganisms of different species and genera |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
DD01 | Delivery of document by public notice |
Addressee: BEIJING LEAGENE BIOTECH CO., LTD. Document name: Notification of Passing Preliminary Examination of the Application for Invention |
|
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160323 |
|
WD01 | Invention patent application deemed withdrawn after publication |