CN105420238A - Sequence siRNA-136 achieving targeted inhibition of mouse interleukin-17A gene - Google Patents
Sequence siRNA-136 achieving targeted inhibition of mouse interleukin-17A gene Download PDFInfo
- Publication number
- CN105420238A CN105420238A CN201510569611.2A CN201510569611A CN105420238A CN 105420238 A CN105420238 A CN 105420238A CN 201510569611 A CN201510569611 A CN 201510569611A CN 105420238 A CN105420238 A CN 105420238A
- Authority
- CN
- China
- Prior art keywords
- gene
- sirna
- sequence
- mil
- mouse interleukin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a sequence siRNA-136 achieving targeted inhibition of a mouse interleukin-17A gene. The sequence number of siRNA-136 is SEQ.No.1. The sequence siRNA-136 achieving targeted inhibition of the mouse interleukin-17A gene has the advantages that it is shown through related experimental results that the sequence siRNA-136 can inhibit expression of the mouse interleukin-17A gene; meanwhile, it is prompted through the related experimental results that the sequence siRNA-136 can be used for inhibiting pathological damage caused by expression of the mouse interleukin-17A gene and can adjust expression of related cell factors, and the purpose of curing a disease is achieved.
Description
Technical field
The present invention relates to the siRNA-136 sequence of a targeted inhibition mouse interleukin 17A.
Background technology
IL-17 A (interleukin-17A, IL-17A) belongs to IL-17 cytokine family, is the important pro-inflammatory cytokine of discovered in recent years.IL-17 family has 6 members at present, is respectively: IL-17A ~ F, and wherein IL-17A is usually said IL-17, primarily of Th17 emiocytosis.After the corresponding part of IL-17 Receptor recognition, recruit Act1/CIKS [NF κ Bactivator1, nf NF κ B activator 1, also known as TRAF3 action protein 2 (TRAF3IP2), also CIKS (ConnectiontoIKK-complexandSAPK) is claimed], make its phosphorylation, TRAF6 is to downstream transmission of signal in activation, the expression of regulation and control inflammatory molecule and chemotactic molecule, such as: the expression of IL-4, IL-5, IL-6, IL-9, IL-13, TGF-β, CXCL1, CCL2, CCL7, CCL20 and C reactive protein etc.IL-17A has proinflammatory effect, and the expression of the inducible proinflammatory sexual cell factor (as IL-6, TNF-α), chemokine (as MCP-1 and MIP-2) and matrix metalloproteinase, causes histiocytic infiltrate and disorganization.IL-17A also participates in the propagation of neutrophil leucocyte, maturation and chemotactic, plays collaborative hormesis, and can promote the maturation of dendritic cell to the activation of T cell.IL-17A can the expression of inducing mouse scavenger cell and surface of dendritic cells MHCI quasi-molecule, then promotes the propagation of anti-infective cytotoxic T lymphocyte (CTL), makes body better can remove pathogenic agent.IL-17A also can work in coordination with activated NK, strengthens NK cell killing activity, and then strengthens the secretion of NK cell killing molecule I FN-γ and granzyme B, kills and wounds liver cell around.Research shows, IL-17A plays a significant role in the generation evolution of multiple hepatic diseases.In patients with alcoholic liver disease serum, the level of IL-17A will far away higher than normal people.In Chronic HBV related liver disease especially hepatitis b cirrhosis, IL-17A expresses and also obviously raises.Infect Eimeria maxima in the inflammatory cytokine of institute's secretion inducing, IL-17A can raise 1650 times, and aggravates disease.In the acute phase of infection by Trypanosoma cruzi, IL-17A and TNF-α significantly raises.Schistosoma mansoni worm's ovum soluble antigen can produce high-caliber IL-17A and IFN-γ by inducing mouse, and inject IL-17A specific antibody in Mice Body after, liver egg granulomas synergentic inflammation can be subject to obvious suppression, shows to play a significant role in the Liver immunity pathology damage that IL-17A induces at schistosoma mansonii infection.In sum, IL-17A has dual function in immune response, i.e. pathogenic effects and Inflammatory response.RNA interference (RNAinterference, RNAi) is carried out to IL-17A gene, will IL-17A synthesis interrupt, affect the expression of other correlation factors, thus reach body regulate effect.According to mouse IL-17A gene design siRNA target sequence, synthesis siRNA positive-sense strand and antisense strand, and be connected with loop, go out and siRNA same disturbance effect at Intracellular transcription, but the shRNA that interference time is longer (shorthairpinRNA), plays the effect blocking mouse IL-17A and generate.Rare report of expressing based on shRNA perturbation technique targeted inhibition mouse IL-17A at present, relevant siRNA target sequence is worth deeply excavating and application.
Summary of the invention
Object of the present invention is exactly for above-mentioned defect of the prior art, provides the siRNA-136 sequence of a targeted inhibition mouse interleukin 17A, and it shows the be situated between expression of plain 17A gene of mouse cell inhibited in relevant experiment.
To achieve these goals, technical scheme provided by the invention is: the siRNA-136 sequence of a targeted inhibition mouse interleukin 17A, and the sequence of siRNA-136 is SEQ.No.1.
Gene order siRNA-136 is: GCGATCATCCCTCAAAGCTCA (SEQ.No.1).
Beneficial effect of the present invention is: the siRNA-136 sequence of a targeted inhibition mouse interleukin 17A provided by the invention, shown by related experiment result, it can suppress mouse cell to be situated between the expression of plain 17A gene, simultaneously, related experiment result is pointed out, sequence siRNA-136 can be used for the pathology damage suppressing the expression being situated between plain 17A gene by mouse cell to cause, and can regulate the expression of associated cytokine, reaches the object of cure diseases.
Accompanying drawing explanation
Fig. 1 is shown as pGPU6/GFP/Neo-shRNA-136 interference plasmid BamHI and PstI enzyme cuts qualification result.
Wherein 1-5 is that the PstI enzyme of pGPU6/GFP/Neo-shRNA-136 cuts result, and 6-10 is that the BamHI enzyme of pGPU6/GFP/Neo-shRNA-136 cuts result.Positive recombinant vector can be cut by BamHI, and can not be cut by PstI.
Fig. 2 is shown as pcDNA3.1-mIL-17A over-express vector enzyme and cuts qualification result.
Wherein 1,2 is that the enzyme of pcDNA3.1-mIL-17A positive plasmid 1,2 cuts result.
After Fig. 3 is shown as pcDNA3.1-mIL-17A over-express vector of the present invention and pGPU6/GFP/Neo-shRNA-136 interference carrier cotransfection 24h, RT-PCR detects the amplification curve of GAPDH (glyceraldehyde-3-phosphate dehydrogenase)/mIL-17AmRNA transcriptional level, and result display pcr amplification specificity is high.
After Fig. 4 is shown as pcDNA3.1-mIL-17A over-express vector of the present invention and pGPU6/GFP/Neo-shRNA-136 interference carrier cotransfection 48h, RT-PCR detects the amplification curve of GAPDH/mIL-17AmRNA transcriptional level, and result display pcr amplification specificity is high.
After Fig. 5 is shown as transfection 24h, each test group mIL-17AmRNA transcriptional level compares.
Wherein, 24H-N is interference negative control+process LAN group, and 24H-N1 is process LAN negative control group, and 24H-N0 is process LAN group, and 24H-B is blank group, and 24H-1 is process LAN and interference carrier group.Result shows, after pGPU6/GFP/Neo-shRNA-136 interference carrier+pcDNA3.1-mIL-17A over-express vector group cotransfection 24h, mIL-17AmRNA transcriptional level is far below feminine gender interference contrast+process LAN group (P=0.000<0.05).
After Fig. 6 is shown as transfection 48h, each test group mIL-17AmRNA transcriptional level compares.
Wherein, 48H-N is negative interference contrast+process LAN group, and 48H-N1 is process LAN negative control group, and 48H-N0 is process LAN group, and 48H-B is blank group, and 48H-1 is process LAN and interference carrier group.Result shows, after pGPU6/GFP/Neo-shRNA-136 interference carrier+pcDNA3.1-mIL-17A over-express vector group cotransfection 48h, mIL-17AmRNA transcriptional level is far below feminine gender interference contrast+process LAN group (P=0.000<0.05).
After Fig. 7 is shown as transfection 24h, each test group mIL-17A protein expression level compares.
Result shows, after pGPU6/GFP/Neo-shRNA-136 interference carrier+pcDNA3.1-mIL-17A over-express vector cotransfection 24h, red fluorescence amount is far below feminine gender interference contrast+process LAN group and process LAN group, illustrate under the effect of interference fragment, mIL-17A protein expression level more negative interference contrast+process LAN group and process LAN group low.
After Fig. 8 is shown as transfection 48h, each test group mIL-17A protein expression level compares.
Result shows, after pGPU6/GFP/Neo-shRNA-136 interference carrier and pcDNA3.1-mIL-17A over-express vector cotransfection 48h, red fluorescence amount is far below feminine gender interference contrast+process LAN group and process LAN group, illustrate under the effect of interference fragment, mIL-17A protein expression level more negative interference contrast+process LAN group and process LAN group low.
Embodiment
Embodiment 1:
Below in conjunction with embodiment, the present invention will be described.
1, sequences Design:
For mIL-17A gene design siRNA interference sequence, be SEQ.No.1 for the synthesis of shRNA, siRNA-136 gene order.
2, mIL-17A interference carrier builds:
2.1OligoDNA design and synthesis:
Loop structure in shRNA template has selected TTCAAGAGA to avoid the formation of termination signal, and the transcription termination sequence of shRNA adopts T6 structure.5 ' end of positive-sense strand template with the addition of CACC, and the cohesive end cutting rear formation with BbsI enzyme is complementary; 5 ' end of antisense strand template with the addition of GATCC, and the cohesive end cutting rear formation with BamHI enzyme is complementary; If first of shRNA base is not G, then after CACC, add a G.Mouse IL-17A gene shRNA oligonucleotide sequence (shRNA-136oligoDNA) is as shown in table 1, and Design and synthesis is completed by Sangon Biotech (Shanghai) Co., Ltd..
Table 1
| Title | Sequence 5 '-3 ' | |
| shRNA-136 | Upstream | CACCGCGATCATCCCTCAAAGCTCATTCAAGAGATGAGCTTTGAGGGATGATCGCTTTTTTG |
| Downstream | GATCCAAAAAAGCGATCATCCCTCAAAGCTCATCTCTTGAATGAGCTTTGAGGGATGATCGC |
The annealing of 2.2shDNA template:
Used by oligoDNA TE (pH8.0) to dissolve respectively, concentration is 100 μm of ol/L.Get corresponding positive-sense strand and antisense strand oligoDNA solution, positive-sense strand and antisense strand oligoDNA annealing reaction system as shown in table 2, according to the proportioning configuration annealing reaction system of table 2.
Table 2
PCR instrument carries out anneal according to following program: 95 DEG C of 5min; 85 DEG C of 5min; 75 DEG C of 5min; 70 DEG C of 5min; 4 DEG C of preservations.The shRNA template that concentration is 10 μm of ol/L is obtained after anneal.Gained template solution is diluted 50 times, and final concentration is 200nmol/L, for ligation.
The linearizing of 2.3pGPU6/GFP/Neo carrier:
Get 10 μ gpGPU6/GFP/Neo carriers, carry out enzyme according to the pGPU6/GFP/Neo carrier endonuclease reaction system shown in table 3 and cut process, 37 DEG C of enzymes cut 1h, agarose gel electrophoresis, AgaroseGelDNAPurificationKitVer2.0 is used to reclaim, electrophoresis detection estimated concentration, weaker concn is to 50ng/ μ L.
Table 3
The structure of 2.4pGPU6/GFP/Neo-shRNA-136 carrier:
Carry out the connection of carrier and fragment according to the ligation system of the pGPU6/GFP/Neo carrier shown in table 4 and shRNA-136 interference fragment, 22 DEG C connect 1h, transform Top10 competent cell.
Table 4
2.5 the qualification of positive colony and order-checking:
Picking 5 bacterium colonies from every block flat board, are inoculated in the LB substratum containing 50 μ g/mLKanamycin, cultivate 16h for 37 DEG C, use alkaline lysis extracting plasmid.Gained plasmid BamHI, PstI respectively enzyme cuts qualification, as shown in Figure 1.Positive recombinant vector should be cut by BamHI, and can not be cut by PstI.Select two clones that enzyme cuts result correct and carry out sequencing.
3, mIL-17A over-express vector builds:
Synthesize mIL-17A gene order by TaKaRa company, add BamHI and NotI two restriction enzyme sites respectively at sequence two ends simultaneously, and be connected to pMD18-Tsimple carrier.Carry out double digestion with BamHI and NotI enzyme to pMDl8-Tsimple plasmid, glue reclaims object fragment.Be connected to through BamHI and NotI double digestion with T4DNA ligase enzyme and the pcDNA3.1 carrier of purifying recovery, transform JM109 competent cell, coat the LB culture medium flat plate containing 100mg/ml penbritin, be placed in 37 DEG C of incubator incubated overnight.Picking colony is placed in LB substratum and shakes bacterium propagation, prepared by mini-scale plasmid, BamHI and NotI double digestion is identified, positive plasmid send company to carry out sequencing, determines that construction expression plasmid pcDNA3.1-mIL-17A sequence is correct and it is errorless to insert reading frame.
4, mIL-17A process LAN and interference carrier cotransfection:
By 293T cell at 10cm
2when being cultured to 80% ~ 90% fusion in culture dish, inoculate 6 orifice plates.Incline nutrient solution, with 2mLPBS washed cell twice.Add 2mLTrypsin-EDTAsolution, after mixing, place 3 ~ 5min for 37 DEG C.Carefully suck trypsin solution, adding the DMEM nutrient solution of 2mL containing 10%FBS, piping and druming makes cell form single cell suspension.Blood counting chamber counts, by cell dilution to 1.5 × 10
6cell/mL.By 1.5 × 10
6the concentration of cells/well inoculates 6 orifice plates, after mixing at 37 DEG C 5%CO
224h is cultivated under culture condition.In 1.5mLEP pipe, add 250 μ LOpti-MEMI, add 1 μ gpcDNA3.1-mIL-17A process LAN plasmid, and add 1 μ gpGPU6/GFP/Neo-shRNA-136 interference plasmid.Get another 1.5mLEP to manage, add 250 μ LOpti-MEMI, add 6 μ Llipofectamin2000, mixing, two pipes mix after placing 5min by room temperature, and room temperature places 20min.Experiment establishes process LAN negative control group, process LAN group, and feminine gender disturbs contrast+process LAN group and blank group.Suck the nutrient solution in 6 orifice plates, every hole adds the DMEM nutrient solution of 1mL serum-free.Transfection mixture is dropwise added in 6 orifice plates, after mixing, incubation 4-6h in incubator.Transfection liquid is abandoned in suction, adds the DMEM nutrient solution of 1.5mL containing 10%FBS.37 DEG C of 5%CO
2continue under culture condition to cultivate 24h and 48h, receive sample.Gained cell is used for Real-TimePCR and detects.
5, the extraction of total serum IgE:
Inhale the nutrient solution abandoned in 6 orifice plates, every hole adds 1mLTrizolReagent, makes the complete cracking of cell with the piping and druming of rifle head.Be transferred to by lysate in 1.5mLEP pipe, room temperature places 10min.Add 200 μ L trichloromethanes, concuss mixes, and room temperature places 10min.12000 × g4 DEG C of centrifugal 10min, draws in supernatant liquid to new centrifuge tube, adds isopyknic Virahol, precipitation at room temperature 10min.12000 × g4 DEG C of centrifugal 15min, abandons supernatant.Precipitate with 500 μ L75% washing with alcohol once.12000 × g4 DEG C of centrifugal 5min, reclaims precipitation, abandons supernatant.Normal temperature is inverted and is dried 10min.With 20 μ LDEPC-H
2o dissolution precipitation, measures OD260, OD280, calculates RNA concentration.Agarose electrophoresis checks the integrity of RNA.
6, Real-timePCR analyzes:
Reverse transcription reaction system is as shown in table 5, and response procedures is 42 DEG C of 30min; 85 DEG C of 10min.
Table 5
Real-time fluorescence quantitative PCR reaction system is as shown in table 6.Quantitative PCR response procedures is 95 DEG C of 3min sex change; 95 DEG C, 12s; 62 DEG C, 40s; 40 circulations.
Table 6
7, Immunofluorescence test:
By 293T cell at 10cm
2when being cultured to 80% ~ 90% fusion in culture dish, inoculate 12 orifice plates.Incline nutrient solution, with 2mLPBS washed cell twice.Add 2mLTrypsin-EDTAsolution, after mixing, place 3 ~ 5min for 37 DEG C.Carefully suck trypsin solution, add the DMEM nutrient solution of 2mL containing 10%FBS, piping and druming makes cell form single cell suspension.Blood counting chamber counts, by cell dilution to 1.5 × 10
6cell/mL.By 2 × 10
5the concentration of cells/well inoculates 12 orifice plates, in 37 DEG C of 5%CO after mixing
224h is cultivated under culture condition.In 1.5mLEP pipe, add 250 μ LOpti-MEMI, add 0.4 μ gpcDNA3.1-mIL-17A process LAN plasmid, and add 0.4 μ gpGPU6/GFP/Neo-shRNA-136 interference plasmid.Get another 1.5mLEP to manage, add 250 μ LOpti-MEMI, add 3 μ Llipofectamin2000, mixing, two pipes mix after placing 5min by room temperature, and room temperature places 20min.Experiment establishes process LAN negative control group, process LAN group, and feminine gender disturbs contrast+process LAN group and blank group.Suck the nutrient solution in 12 orifice plates, every hole adds the DMEM nutrient solution of 1mL serum-free.Transfection mixture is dropwise added in 12 orifice plates, after mixing, incubation 5h in incubator.Transfection liquid is abandoned in suction, adds the DMEM nutrient solution of 1.5mL containing 10%FBS.37 DEG C of 5%CO
2cultivation 24 and 48h is continued under culture condition.Take out 12 orifice plates, PBS cleans three times, each 10min.4% paraformaldehyde, room temperature fixes 30min, and remove stationary liquid, PBS washes three times, each 10min.With containing penetrating process 15min, PBS rinsing three times under the PBS room temperature of 0.2%TritonX-100, each 10min.Primary antibodie 1:600 dilutes, two anti-1:150 dilutions, and adds 1%BSA, 4 DEG C of overnight incubation.Take out 12 orifice plates, PBS cleans unconjugated antibody diluent, and basis of microscopic observation is taken pictures.
Last it is noted that the foregoing is only the preferred embodiments of the present invention, be not limited to the present invention, although with reference to previous embodiment to invention has been detailed description, for a person skilled in the art, it still can be modified to the technical scheme described in foregoing embodiments, or carries out equivalent replacement to wherein portion of techniques feature.Within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.
<110> Lanzhou Veterinary Inst., Chinese Acedemy of Agaricultural Sciences
The sequence siRNA-136 of <120> targeted inhibition mouse interleukin 17A gene
<210>1
<211>21
<212>DNA
<213> artificial sequence (siRNA-136)
<400>1
gcgatcatccctcaaagctca21
Claims (1)
1. the siRNA-136 sequence of a targeted inhibition mouse interleukin 17A, is characterized in that, the sequence of siRNA-136 is SEQ.No.1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510569611.2A CN105420238A (en) | 2015-09-08 | 2015-09-08 | Sequence siRNA-136 achieving targeted inhibition of mouse interleukin-17A gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510569611.2A CN105420238A (en) | 2015-09-08 | 2015-09-08 | Sequence siRNA-136 achieving targeted inhibition of mouse interleukin-17A gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105420238A true CN105420238A (en) | 2016-03-23 |
Family
ID=55498779
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510569611.2A Pending CN105420238A (en) | 2015-09-08 | 2015-09-08 | Sequence siRNA-136 achieving targeted inhibition of mouse interleukin-17A gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105420238A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006088833A2 (en) * | 2005-02-14 | 2006-08-24 | Wyeth | Interleukin-17f antibodies and other il-17f signaling antagonists and uses therefor |
| WO2008153610A2 (en) * | 2007-02-12 | 2008-12-18 | Schering Corporation | Use of il-23 antagonists for treatment of infection |
| CN102188707A (en) * | 2011-02-25 | 2011-09-21 | 中国医学科学院基础医学研究所 | Application of IL-17 inhibitor in preparing medicament for treating influenza |
-
2015
- 2015-09-08 CN CN201510569611.2A patent/CN105420238A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006088833A2 (en) * | 2005-02-14 | 2006-08-24 | Wyeth | Interleukin-17f antibodies and other il-17f signaling antagonists and uses therefor |
| CN101218254A (en) * | 2005-02-14 | 2008-07-09 | 惠氏公司 | Interleukin-17F antibodies and other IL-17F signaling antagonists and uses therefor |
| WO2008153610A2 (en) * | 2007-02-12 | 2008-12-18 | Schering Corporation | Use of il-23 antagonists for treatment of infection |
| CN102188707A (en) * | 2011-02-25 | 2011-09-21 | 中国医学科学院基础医学研究所 | Application of IL-17 inhibitor in preparing medicament for treating influenza |
Non-Patent Citations (4)
| Title |
|---|
| HAYATA K ET AL: "Inhibition of IL-17A in tumor microenvironment augments cytotoxicity of tumor-infiltrating lymphocytes in tumor-bearing mice", 《PLOS ONE》 * |
| JOSEPH J ET AL: "IL-17 silencing does not protect nonobese diabetic mice from autoimmune diabetes", 《THE JOURNAL OF IMMUNOLOGY》 * |
| 李燕 等: "《细胞与分子生物学常用实验技术》", 31 July 2009 * |
| 汪海东: "I白介素-17调节致糖尿病性T细胞介导的NOD鼠1型糖尿病的发生II长期饮酒减少大鼠睾丸间质细胞PBR和StAR表达", 《中国博士学位论文全文数据库》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101307085A (en) | SiRNA and recombination lentivirus from preventing hepcidin from regulating protein and uses thereof | |
| CN103757026A (en) | Gene sequence and polypeptide of FGFR2b ectodomain and application thereof | |
| CN103667286B (en) | The siRNA of Schistosoma japonicum PGMRC2 gene and application thereof | |
| CN104031884B (en) | The protein arginine transmethylase 7 application in cancer cell metastasis | |
| Lively et al. | Effect of chemically modified IL-13 short interfering RNA on development of airway hyperresponsiveness in mice | |
| CN103834691A (en) | Construction method of target RNA-interfered recombinant lentivirus vector for IL-33 gene | |
| CN105727311A (en) | Application of RNASE4 serving as drug target to brain glioma inhibition drugs | |
| CN113416768A (en) | Application of PRKRA gene as target in inhibiting replication of peste des petits ruminants virus | |
| CN105420238A (en) | Sequence siRNA-136 achieving targeted inhibition of mouse interleukin-17A gene | |
| CN105420236A (en) | Sequence siRNA-288 achieving targeted inhibition of mouse interleukin-17A gene | |
| CN105420237A (en) | Sequence siRNA-180 achieving targeted inhibition of mouse interleukin-17A gene | |
| CN102085378B (en) | Application of hfgl2 (Human Fibrinogen-like protein 2) inhibitor in preparation of medicaments for treating liver cancer | |
| Ni et al. | Suppression of bovine viral diarrhea virus replication by single and dual short hairpin RNA-mediated RNA interference | |
| CN102154290B (en) | SiRNAs for inhibiting epidemic encephalitis B viruses | |
| CN101906417B (en) | shRNA for hepatitis B virus and recombinant adeno-associated virus vector treating vector carrying same | |
| CN102018959B (en) | Method and reagent for preventing and treating heart disease | |
| CN104922697B (en) | Reduce pyridoxine phosphate oxidation enzyme treatment oophoroma | |
| CN102399780A (en) | Interfering RNA (Ribonucleic Acid) for suppressing hand-foot-and-mouth disease virogene, vector containing the same and application thereof | |
| CN104740634A (en) | Application of miR-93 and inhibitor thereof in preparation of anti-virus infection medicines | |
| CN104830864B (en) | Act on shRNA structures of PNPO genes and application thereof | |
| CN114574486B (en) | siRNA, DNA, construct and application acting on OPLAH | |
| CN112626068B (en) | LncRNA of targeted Notch1 gene and application thereof | |
| CN110607299B (en) | 887S RNA and application thereof in tumor inhibition | |
| Mićanović et al. | Ethyl pyruvate ameliorates acute respiratory distress syndrome in mice | |
| CN101748120A (en) | Interference RNA interfering muscle specific E3 ubiquitin protein ligase gene, carrier containing same and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160323 |
|
| RJ01 | Rejection of invention patent application after publication |