CN105412943A - Nano particle composition and anti-tumor application thereof - Google Patents
Nano particle composition and anti-tumor application thereof Download PDFInfo
- Publication number
- CN105412943A CN105412943A CN201510621191.8A CN201510621191A CN105412943A CN 105412943 A CN105412943 A CN 105412943A CN 201510621191 A CN201510621191 A CN 201510621191A CN 105412943 A CN105412943 A CN 105412943A
- Authority
- CN
- China
- Prior art keywords
- nanoparticle compositions
- plasmid
- nano particle
- tumor
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Medicinal Preparation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a nano particle composition and anti-tumor application thereof. The nano particle composition is a nano particle formed by assembling a polymer carrier and plasmid for expressing a therapeutic gene; the polymer carrier is a cyclodextrin-polyethyleneimine-polyethylene glycol-folic acid quaternary assembly-type polycation carrier, and the plasmid for expressing the therapeutic gene is eukaryotic expression plasmid containing an HGFK1 protein DNA sequence for coding a hepatocyte growth factor. Compared with the prior art, the nano particle has the advantages of being efficient and tumor targeted; the nano particle can be automatically assembled in an aqueous solution through electrostatic interaction, and the particle size of the nano particle and the stability in a salt solution has an important effect on the function of the nano particle; it is verified that the nano particle composition can prevent transfer or relapse of a cancer and alleviate or relieve or control or improve or cure a primary cancer or a metastatic cancer or other related symptoms and can also prolong the life or survival time of a cancer patient and reduce the mortality.
Description
Technical field
The invention belongs to field of medicine preparing technology, specifically, relate to a kind of nanoparticle compositions and antitumor application thereof.
Background technology
Malignant tumor (cancer) is the major disease of the mankind, and the research and development tool strengthening new type antineoplastic medicine is of great significance.The existing malignant tumor patient in the whole world, more than 2,200 ten thousand people, is newly examined patient every year and is reached 1,010 ten thousand people, dies from tumor every year more than 6,200,000 examples.The existing malignant tumor patient at least 300 of China is to 4,000,000 people, and newly examine patient every year more than 1,600,000 people, year, death toll was more than 1,300,000.Along with the change of the fast development of China's economy and society, the prolongation of average life, dietary structure and environmental factors, tumor incidence and mortality rate are rapid ascendant trend, spectrum of disease also there occurs great change, the cause of the death the 3rd (107.1/10 ten thousand people) is occupied at present in rural area population tumor, and rank first place in the urban population cause of the death (126.0/10 ten thousand people).Operation, radiation and chemotherapy are the conventional therapy means of tumor.Operation, radiotherapy are suitable only for the tumor locally occurred; To the Advanced cancers occurring to shift, cytotoxic chemotherapy agents is still first-line treatment scheme; But for a long time, it is large to there is toxic and side effects in conventional chemotherapeutic drugs, and patient's toleration is poor, and life-time service causes drug dependence etc. problem always; And to some to the insensitive tumor type of chemotherapeutics, patient is also in the state pasted medical help.Therefore, the anticancer therapy technology of exploitation low toxicity, efficient and tumor-targeting characteristic, becomes the emphasis of current research and treatment.
The gene therapy of tumor is one of focus of current cancer Biotherapeutics research.It utilizes carrier transduction hereditary material (DNA, RNA) to body cell, by expression treatment gene or regulation and control the transcribing and expressing of genes of interest, the growth of specific interference tumor tissues, growth and reach the object suppressing or remove tumor.Clear and definite except having target spot, outside the advantage of the bio-pharmaceutical that low toxicity, patient easily tolerate, genomic medicine also has following advantage compared with protein drug: after 1, transducible gene enters human body cell, utilize completely the protein transcription of cell self and modification system produce treatment albumen and physiological protein function closer to; 2, by transforming the molecular biology of encoding gene open reading frame transcription element, lasting, efficient and the specific treatment protein expression of histiocyte is realized; 3, for the individuation difference of tumor patient, design therapeutic gene, processing technology is simple, can realize fast individual's treatment targetedly.Since nineteen ninety, first gene therapy medicament was carried out clinical trial by U.S. FDA approval, had in American-European countries and carried out clinical trial more than 1000 gene therapy approach, wherein 60% is be used for the treatment of tumor.Multiple therapeutic gene shows clear and definite antitumor efficacy in clinical trial; Or combined chemotherapy, radiotherapy use, its toxic and side effects of minimizingization improves the tolerability of patient.Comprised by the gene of clinical trial: antioncogene, immunotherapy of tumors gene, angiogenesis inhibitor gene, lethal gene etc.But up to now, neither one genomic medicine is come into the market by American-European countries's approval.Lack the subject matter that efficient, safe genomic medicine Transfer Technology is repressor gene treatment clinical practice.
Viral vector is the mainstream carrier that current gene therapy uses.Based on gene transduction system that is inherent, delicate structure, these artificial recombination viruses show high efficiency gene transfection, outstanding biocompatibility.But retro virus gene therapy in 1999 causes two child patients to produce the event of malignant change of cell, makes the biosafety issues of people to genome conformity sexually transmitted disease (STD) poisonous carrier create query! Non-viral gene Transfer Technology is the emerging gene delivery techniques of developed recently.It mainly uses positron polymer (polymer) by electrostatic interaction, and gene (DNA or the RNA) medicine of parcel and concentrated long-chain forms particle, to avoid the degraded of genomic medicine and to promote the transduction of gene.Compared with viral vector, non-virus carrier have biological safety good, make simple, cost is low, immunogenicity is little, and easily carries out the advantages such as chemical modification.Based on these advantages, non-virus carrier obtains the more and more many concerns of gene therapy scholar.Nearly ten years, numerous chemical-biological scholars has synthesized a large amount of non-virus carriers, comprising: multiple liposome and derivant thereof; Multiple poly imines (PEI), poly-D-lysine (PLL), Dentrimers, chitosan (Chitosan) and derivant etc. thereof.But, the gene transfection agent that business provides also exist toxicity large, be only suitable for transient transfection, lack tumor-targeting etc., far can not adapt to clinical gene therapy application demand.
Tumor-targeting nano gene drug delivery techniques is mainly by nano carrier material and engineering, therapeutic gene is made into the drug particle of nanoscale (1-100 nanometer), by the control to nano-particle size and form, the modification on surface and the grafting of tumor-targeting part, and realize the technical method of genomic medicine tumor-targeting transmission.The physiological foundation of nanoparticle tumor-targeting is tumor vascular architectural feature.Tumor is the tissue of height heterogeneity, and the gap between its vascular endothelial cell is often greater than 100 nanometers, and basement membrane unsound, lack perivascular tissue, the nanoparticle being conducive to 100 ran by and infiltration; And normal tissue blood vessel endothelial gap is 5-10nm, the larger particle penetration of particle diameter can be stoped and pass through, reducing normal cell to the absorption of cancer therapy drug, reduce its toxicity; Secondly, tumor tissues lymphatic return phylogeny imperfection, the even shortage lymphoid tissue had, cause the nanoparticle penetrating into tumor tissues to be not easy to be drained, effect (ER) is delaied in this prolongation being called as tumor.Will arrive tumor tissues smoothly, nanoparticle also needs to overcome several physiology restrictions of body, comprising: the engulfing of reticuloendothelial system, remove, the blood filtration effect etc. of snius lienis, sinus hepaticus.Nanometer particle size size and finishing are the key factors overcoming these physiological barrier.Conventionally, particle diameter is less than 5nm and easily discharges from kidney, and micro-size particles can be removed by reticuloendothelial system, and being greater than 200nm particle usually can not through sinus hepaticus or snius lienis.Except particle diameter, nanoparticle surface Hydrophilic modification and charge characteristic also affect reticuloendothelial system to the identification of nanoparticle and removing.Conventionally, modify through hydrophilic blocker, or the nanoparticle that surface charge is low, can avoid identification and the removing of reticuloendothelial system in body, the blood circulatory half-life in prolong drug particle body, the targeting increasing tumor tissues is assembled.After nanoparticle gathers tumor, the absorption increasing tumor cell is also the key improving drug effect.By connecting tumor cell specific part to nanoparticle, making its cell endocytic approach regulated by receptors ligand enter tumor cell, the absorption of tumor cell to medicine can be increased.
Angiogenesis inhibitor is widely used solid tumor resisting Biotherapeutics scheme.Conventionally, when gross tumor volume is less, tumor cell can by osmosis obtain its growth needed for nutrition.When diameter of tumor exceedes infiltration restriction (1-2mm), tumor-blood-vessel growth will occur.After this, it will promote or accelerate the growth of solid tumor, and provide passage for the transfer of tumor.Since the seventies in last century, the people such as Folkman opened antineoplastic vascular research, a large amount of angiogenesis inhibitors has been found and has reported, they can be summarized as exogenous and endogenous angiogenesis inhibitor inhibitor two class.Exogenous angiogenesis inhibitor inhibitor more mainly has the micromolecular compound of protease inhibit feature, and its blood vessel formation against function is obvious, and toxic and side effects is also very large simultaneously.And endogenous anti-angiogenesis toxic and side effects is less, but, therapeutic effect be reached, usually need the administration continued repeatedly.The target drug of some angiogenesis inhibitor is carried out clinical experiment by multiple state approval, but curative effect is not as expected.Nearest research finds: after an angiogenesis path is suppressed, and tumor cell can set up other path, induces new angiogenesis; Tumor suppression angiogenesis causes tumor hypoxia, can the activation of induced tumor stem cell, thus causes tumor recurrence.These may be the not good enough main causes of angiogenesis inhibitor inhibitor clinical efficacy.
Recently, research finds, the three ring plate sections (thekringle1domainofhumanHGF α-chain, HGFK1) of adeno-associated virus transduction human quasi-liver cell somatomedin are by interference EGFR, VEGFR2 and bFGFR signal path, and play antihepatocarcinoma effect.But, still there is the bio-safety and body that are caused by genome conformity to problems such as the immunoreation of viral vector in the gene therapy approach of these viral vector.And polypeptide drug will reach therapeutic effect needs lasting high dose repeat administration, this will have a strong impact on the effect for the treatment of, increase treatment cost.
Summary of the invention
For solving the problems of the technologies described above, the invention provides a kind of safe, efficient, long-acting nanoparticle compositions and antitumor application thereof.
A kind of nanoparticle compositions of the present invention, described nanoparticle compositions is the nanoparticle of the plasmid self assembly of polymer support and expression treatment gene; Described polymer support is cyclodextrin-polymine-Polyethylene Glycol-folic acid quaternary assembled Poly-cation; The plasmid of described expression treatment gene is the eukaryon expression plasmid of the HGFK1 protein DNA sequence comprising coding hepatocyte growth factor.
A kind of nanoparticle compositions of the present invention, the structural formula of described quaternary assembled Poly-cation is selected from formula 1 or formula 2; The structural formula of described formula 1 is specially:
The structural formula of described formula 2 is specially:
In formula 1 or formula 2, n is the cellular construction number of cyclodextrin-polymine-folic acid-Polyethylene Glycol, span 5-10, m1 is the secondary amino group cellular construction number in polymine, the value tertiary amino unit structure number that to be 4-8, m2 be in polymine, value is 2-5, L is oxirane unit structure number in Polyethylene Glycol, span 42-105.
A kind of nanoparticle compositions of the present invention, the plasmid of described expression treatment gene is phEF1-HTLV-Igk-HGFK1-SV40, obtains by being subcloned into phEF1-HTLV-Igk-XXX-SV40 plasmid again after the DNA profiling from Human normal hepatocyte LO2 extraction expression people HGFK1.
A kind of nanoparticle compositions of the present invention, described phEF1-HTLV-Igk-XXX-SV40 comprises: 1) hybrid promoters: 5 ' the nontranscribed domain sequence of people's elongation factor-1α promoter and human T-cell leukemia virus, see SEQIDNO1, it can start the expression of controlling gene for a long time in mammalian cell; 2) DNA sequence of coding secreting, expressing signal peptide IgK chain homing sequence, is shown in SEQIDNO2; 3) coding expresses therapeutic gene DNA sequence: Endostatin DNA sequence, sees SEQIDNO3; 4) simian virus polyA sequence: see SEQIDNO4; SEQIDNO1：GGATCTGCGATCGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGCTGAAGCTTCGAGGGGCTCGCATCTCTCCTTCACGCGCCCGCCGCCCTACCTGAGGCCGCCATCCACGCCGGTTGAGTCGCGTTCTGCCGCCTCCCGCCTGTGGTGCCTCCTGAACTGCGTCCGCCGTCTAGGTAAGTTTAAAGCTCAGGTCGAGACCGGGCCTTTGTCCGGCGCTCCCTTGGAGCCTACCTAGACTCAGCCGGCTCTCCACGCTTTGCCTGACCCTGCTTGCTCAACTCTACGTCTTTGTTTCGTTTTCTGTTCTGCGCCGTTACAGATC；SEQIDNO2：ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGAC；SEQIDNO3：CATGAACTGCATCATTGGTAAAGGACGCAGCTACAAGGGAACAGTATCTATCACTAAGAGTGGTATCAAATGTCAGCCCTGGAGTTCCATGATACCACACGAACACAGCTTTTTGCCTTCGAGCTATCGGGGTAAAGACCTACAGGAAAACTACTGTCGAAATCCTCGAGGGGAAGAAGGGGGACCCTGGTGTTTCACAAGCAATCCAGAGGTACGCTACGAAGTCTGTGACATTCCTCAGTGTTAAGAAGTTGAATGCATGACCTGCTAA,SEQIDNO4：AGTTTGCCCTGAGAGACCCAGCAGGCAACTGTGTGCACTTTGTGGCAGAGGAGCAGGACTGAGGATAAGAATTCGCTAGCTCGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTA。
The preparation method of a kind of nanoparticle compositions of the present invention, described preparation method concrete steps are: synthesis cyclodextrin-polymine-folic acid-Polyethylene Glycol quaternary assembled Poly-cation, are called for short PCPFA; The plasmid of construction expression therapeutic gene, is called for short pHGFK1; The above-mentioned quaternary assembled Poly-cation obtained and plasmid are dissolved in the glucose solution of 2.5-5wt% respectively, again according to (5-40): the nitrogen/phosphorus of 1, than by two solution mixing, forms the PCPFA/pHGFK nanoparticle compositions of diameter in 80-120 nanometer.
The application of a kind of nanoparticle compositions of the present invention, described nanoparticle compositions is used for by eukaryotic cell expression and secretes the preparation of therapeutic gene HGFK1 medicine.
The application of a kind of nanoparticle compositions of the present invention, described nanoparticle compositions is for preventing or the preparation of Therapeutic cancer medicine.
The application of a kind of nanoparticle compositions of the present invention, described nanoparticle compositions is for preventing or treat the preparation of preinvasive cancer or metastatic carcinoma disease drug.
The application of a kind of nanoparticle compositions of the present invention, described nanoparticle compositions is for preventing or the preparation of Hepatoma therapy medicine.
The application of a kind of nanoparticle compositions of the present invention, described nanoparticle compositions is for preventing or the preparation of combined radiotherapy or chemotherapeutics in Therapeutic cancer process.
Compared with prior art, nanoparticle compositions of the present invention PCPFA in liquid environment can wrap up and concentrated plasmid of expressing genes of interest, form a kind of nano-particle PCPFA/pDNA, by systemic vivo medicine-feeding, and PCPFA/pDNA has feature that is efficient and cancer target; Can be nanoparticle by electrostatic interaction self assembly in aqueous, and the stability in the particle diameter of nanoparticle and saline solution, the function of nanoparticle is played an important role; Empirical tests, can the transfer of prophylaxis of cancer or recurrence, alleviates, alleviates, controls, improves or cures preinvasive cancer or metastatic cancer or its relevant symptom, also can extend life-span or the Survival Time of cancer patient, reduce mortality rate.
Accompanying drawing explanation
Fig. 1: PCPFA functional MRI characterizes overall diagram; Fig. 2: phEF1-HTLV-Igk-HGFK1-SV40 plasmid construction schematic diagram; Fig. 3: the grain-size graph of nanoparticle compositions; Fig. 4: nanoparticle compositions surface charge figure; Fig. 5: gene expression in vivo efficiency-Time dynamic figure after lumbar injection various dose nanoparticle compositions; Fig. 6: after systemic injections nanoparticle compositions, reporter gene targeting poly combines in the cartogram of expression of tumor tissue; Fig. 7: nanoparticle compositions remarkable Tumor suppression growth result figure; Fig. 8: nanoparticle compositions treatment extends the time diagram of mice with tumor existence; Fig. 9: nanoparticle compositions treatment reduces microvessel density figure; Figure 10: nanoparticle compositions treatment reduces tumor stem cell number figure.
Detailed description of the invention
Below in conjunction with specific embodiment, nanoparticle compositions of the present invention and application thereof are described further, but protection scope of the present invention is not limited to this.
Embodiment 1
1, the preparation of PEI-CyD-PEG-FA
Priority patent has synthesized one with cyclodextrin (CyD) for cross-linked scaffold, connect low-molecular-weight polymine (PEI), coupling has the Poly-cation (called after H1) of the specific small-molecule drug folic acid of cancer target.H1 has been proved to be the plasmid that can wrap up, concentrate expression genes of interest in liquid environment and has become a kind of nano-particle at 100 ran.In kinds of tumor cells system, this nano-particle shows the gene delivery capabilities of low toxicity, efficient and targeting specific.H1 transduction is used to express the nanoparticle Therapeutic cancer, particularly malignant melanoma of the antitumor cell factor.
Polyethylene Glycol (PEG) is a kind of hydrophilic polymer, it can improve the stability in the hydrophilic of colloidal grain surface and solion, thus reduce the removing of complement opsonic action and reticuloendothelial system, improve colloid ion circulation time in blood.For increasing the body internal stability of nanoparticle, extending its blood circulation time, increasing the targeting ability of aggregation of tumor tissues, on the basis of H1, add PEG functional module, synthesize new cationic polymer (PEI-CyD-PEG-FA is called for short PCPFA).Research proves: the nano-particle (PCPFA/pDNA) that PCPFA can wrap up in liquid environment, concentrated plasmid of expressing genes of interest becomes a kind of 100 ran; By systemic vivo medicine-feeding, PCPFA/pDNA has feature that is efficient and cancer target.
Synthetic method 1: 1. according to application number be described in the patent of 200810058345.9 method synthesis PEI600-CyD; 2. PEG and CDI is pressed 1:1 molecular proportion mixed dissolution in the dimethyl sulfoxide of 20-50 times of volume, nitrogen at room protection stirring 2 hours, PEG after being activated by CDI joins in the PEI600-CyD containing the amino number of equivalent, PEG molecular weight can be 2000Da to 5000Da, add catalyst ethylenediamine, stirring reaction 24 hours, product lyophilization 2 days, synthesis PEI600-CyD-PEG; 3. folic acid and CDI are pressed 1:1 molecular proportion mixed dissolution in the dimethyl sulfoxide of 20-50 times of volume; nitrogen at room protection stirring 2 hours; folic acid after being activated by CDI joins in the PEI600-CyD-PEG containing the amino number of equivalent; add catalyst ethylenediamine; stirring reaction 24 hours; product lyophilization 2 days, all folic acid reactions are all carried out under lucifuge condition, synthesis PEI600-CyD-PEG-FA.Synthetic route is as follows:
Synthetic method 2: 1. according to the method synthesis PEI600-CyD-FA that application number is described in the patent of 200810058345.9; 2. the PEI600-CyD-FA that 1. PEI600-CyD-PEG step in synthetic method 1 2. obtained and this synthetic method step obtain mixes by amino molecule 1:1 and generates PEI600-CyD-PEG-FA.Step 1. synthetic route is as follows:
Synthetic method 3: 1. folic acid is mixed with the CDI of 2-5 times of molecular proportion and be dissolved in dimethyl sulfoxide, nitrogen at room protection lucifuge stirring reaction 2 hours, reaction afterproduct is added in the amino dimethyl sulphoxide solution of PEG of equimolecular quantity, nitrogen at room protection lucifuge stirring reaction 12 hours, lyophilization 2 days after product dialysis; 2. the CDI of OH-PEG-FA and 2-5 times of molecular proportion mixing is dissolved in dimethyl sulfoxide; nitrogen at room protection lucifuge stirring reaction 2 hours; reaction afterproduct is added in the PEI-CyD dimethyl sulphoxide solution of equimolecular quantity; nitrogen at room protection lucifuge stirring reaction 12 hours, lyophilization 2 days after product dialysis.Synthetic route is as follows:
In above-mentioned all synthetic routes, n is the cellular construction number of cyclodextrin-polymine-folic acid-Polyethylene Glycol, value 5-10, m1 is the secondary amino group cellular construction number in polymine, the value tertiary amino unit structure number that to be 6, m2 be in polymine, value is about 3, L is oxirane unit structure number in Polyethylene Glycol, value 42-105.Synthesize the PCPFA functional MRI phenogram obtained and see accompanying drawing 1.
2, the structure of phEF1-HTLV-Igk-HGFK1-SV40
Obtaining by being subcloned into phEF1-HTLV-Igk-XXX-SV40 plasmid again after the DNA profiling from Human normal hepatocyte LO2 extraction expression people HGFK1, seeing accompanying drawing 1.Described phEF1-HTLV-Igk-XXX-SV40 comprises: 1) hybrid promoters: 5 ' the nontranscribed domain sequence of people's elongation factor-1α promoter and human T-cell leukemia virus, see SEQIDNO1, it can start the expression of controlling gene for a long time in mammalian cell; 2) DNA sequence of coding secreting, expressing signal peptide IgK chain homing sequence, is shown in SEQIDNO2; 3) coding expresses therapeutic gene DNA sequence: Endostatin DNA sequence, sees SEQIDNO3; 4) simian virus polyA sequence: see SEQIDNO4; SEQIDNO1：GGATCTGCGATCGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGCTGAAGCTTCGAGGGGCTCGCATCTCTCCTTCACGCGCCCGCCGCCCTACCTGAGGCCGCCATCCACGCCGGTTGAGTCGCGTTCTGCCGCCTCCCGCCTGTGGTGCCTCCTGAACTGCGTCCGCCGTCTAGGTAAGTTTAAAGCTCAGGTCGAGACCGGGCCTTTGTCCGGCGCTCCCTTGGAGCCTACCTAGACTCAGCCGGCTCTCCACGCTTTGCCTGACCCTGCTTGCTCAACTCTACGTCTTTGTTTCGTTTTCTGTTCTGCGCCGTTACAGATC；SEQIDNO2：ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGAC；SEQIDNO3：CATGAACTGCATCATTGGTAAAGGACGCAGCTACAAGGGAACAGTATCTATCACTAAGAGTGGTATCAAATGTCAGCCCTGGAGTTCCATGATACCACACGAACACAGCTTTTTGCCTTCGAGCTATCGGGGTAAAGACCTACAGGAAAACTACTGTCGAAATCCTCGAGGGGAAGAAGGGGGACCCTGGTGTTTCACAAGCAATCCAGAGGTACGCTACGAAGTCTGTGACATTCCTCAGTGTTAAGAAGTTGAATGCATGACCTGCTAA,SEQIDNO4：AGTTTGCCCTGAGAGACCCAGCAGGCAACTGTGTGCACTTTGTGGCAGAGGAGCAGGACTGAGGATAAGAATTCGCTAGCTCGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTA。
3, the preparation of nanoparticle compositions
PCPFA, PCP, PCFA or PCP+PCFA two kinds of polymer mixed in equal amounts are dissolved in the glucose solution of 2.5-5%, under rotational case, said polycation solution are joined in the solution of equal-volume plasmid; Mix than by gained solution according to the nitrogen/phosphorus of 5-40:1 again, form diameter at the PCPFA/pDNA nanoparticle compositions of 100 ran, obtain PCP+PCFA/pDNA matched group simultaneously.
Nano-particle size analysis instrument is used to characterize diameter and the surface charge of nanoparticle compositions, use the transmission electron microscope observing form of nanoparticle compositions, result is presented at the diameter of PCPFA/pDNA in the glucose solution of physiology 5% in 100 nanometer effects, and surface charge is at+30mv; In physiological solt solution (PBS), the surface charge of PCPFA/pDNA nanoparticle is about-5mv, and particle diameter remained unchanged in 30 minutes.Shown in accompanying drawing 3, PCPFA/pDNA (N/P:20:1) nanoparticle particle diameter in physiological solt solution is about 100nm, and along with fostering the prolongation particle diameter of time to remain unchanged; And the nanoparticle that matrix polymer PCFA and PC of non-grafting PEG packs, its particle diameter prolongation in time in physiological solt solution and progressively increasing; Illustrate that PEG grafting increases the stability of nanoparticle in saline solution.As shown in Figure 4, at 5% glucose (5%GLU), in phosphate buffer (PBS) and pure water (water) solution, the surface charge of PCPFA/pDNA (N/P:20:1) nanoparticle.These illustrate that PCPFA/pDNA nanoparticle is highly stable in physiological solt solution, and also indicate it highly stable in vivo, have longer blood circulation time, these provide physical basis for realizing nanoparticle solid tumor targeting.
The distribution in vivo of experiment one: PCPFA/pDNA nano-particle compound and efficiency
For distribution in vivo and the efficiency of Study system injection nano-particle compound, we construct phEF1-HTLV-Luciferase-SV40 (being abbreviated as: the pLuc) plasmid of expressing luciferase gene.According to aforementioned manner, PCFA and pLuc plasmid is mixed, is made into PCFA/pLuc nanoparticle.H1/pLuc nanoparticle is divided two dosage 1) DNA50ug and DNA100ug, by Intraperitoneal injection Balb/c mice, each dosage 3 mices.Then utilize living body biological fluorescence detecting system (InVivoimaging) in multiple time point monitoring bio luciferase expression efficiency and distribution.We find intraperitoneal injection PCFA/pLuc nanoparticle, and genomic medicine Assembled distribution is at liver organization, and single injection, gene expression can be continued above 45 days.As shown in Figure 5, blank rectangular histogram and diagonal line hatches rectangular histogram respectively illustrated through lumbar injection PCFA/pLuc (DNA100ug) and PCFA/pLuc (DNA50ug) nanoparticle in the gene transduction efficiency of normal BALB/C mice and persistent period; One intra-peritoneal injection PCFA/pLuc (DNA100ug) nanoparticle, its highest gene expression efficiency is latter 3 days of injection, reaches 4 × 10
5photons/min; Gene expression efficiency reduces to 50% of peak efficiency and is maintained to 35 days subsequently; 45 days after injection, gene expression efficiency was attenuated to 1/4 of peak efficiency; And one intra-peritoneal injection PCFA/pLuc (DNA50ug) nanoparticle 24 hours after treatment, gene expression efficiency is up to 1 × 10
5photons/min; Be attenuated to half after 5 days, after 15 days, gene expression disappears.For the cancer target ability of research PCPFA/pDNA nanoparticle, establish mouse liver original position liver cancer model.Nanoparticle is after 48 hours for lumbar injection PCPFA/pEGFP (express and strengthen fluorescin), and we extract liver and liver in situ cancerous tissue cooks frozen section, and use the expression of GFP in fluorescence microscope tumor tissues and normal liver tissue.Result shows, and have a large amount of GFP to express, and normal liver tissue is little in tumor tissues around blood vessel.This illustrates that PCPFA/pEGFP targeting can transmit therapeutic gene to tumor tissues, reduces toxic and side effects, improves drug effect.
Experiment two: PCPFA/pHGFK1 and PCPFA/pLuc nanoparticle compare tumor tumor killing effect
For observing the tumor killing effect of above-mentioned nanoparticle, first we set up homotransplantation original position hepatocarcinoma mouse experiment animal model.
Preliminary experiment: after 12 normal Balb/c mouse anesthesias of 6-8 week large immunity, operative incision abdominal cavity, and liver median lobe is exposed, under direct-view, with microsyringe, 10ulPBS is comprised 5 × 10
6murine hepatocarcinoma cell system ML-1 be injected into liver median lobe, injection terminate rear electric knife closed injection hole, then close abdominal cavity.Open abdomen after one week and confirm that 100% mouse liver becomes tumor.
Embodiment: the method that 48 Balb/c mices describe according to preliminary experiment, sets up the original position hepatocarcinoma mouse experiment animal model of ML-1 cell inoculation.Post operation 7 days, mice is divided into 5 groups by randomness, often organizes 12 mices, gives intraperitoneal injection PCPFA/pLuc (DNA100ug) respectively, PCPFA/pHGFK1 (DNA100ug).Treat latter one month, often group is random extracts 4 mices extraction tumor tissues out, weighs and draws materials for follow-up mechanism research; Residue mice continues observation and does survival research.
Result shows: 30 days after the treatment, the meta weight of PCPFA/pLuc processed group tumor tissues was 520mg respectively; PCPFA/pHGFK1 processed group, the median of tumor tissue weight is 180mg.This illustrates: PCPFA/pHGFK1 process significantly suppress the growth of hepatocyte in situ inoculated tumour.Accompanying drawing 6 shows, suppress on tumor model in mouse liver original position hepatocarcinoma, lumbar injection PCPFA/pEGFP (DNA100ug) nanoparticle is after 48 hours, and extraction normal liver tissue and tumor tissues cook frozen section, by the expression efficiency of fluorescence microscope GFP; Statistical result showed, in tumor tissues, GFP positive cell number about 22 times is higher than normal structure, illustrates that PCPFA/pEGFP nanoparticle energy targeting gathers tumor tissues.Survival research display, PCPFA/pLuc processed group, the meta time-to-live of experimental mouse is 50 days; PCPFA/pHGFK1 processed group, the meta time-to-live of experimental mouse is 100 days.Accompanying drawing 6 illustrates, the time-to-live of PCPFA/pHGFK1 treatment equal energy significant prolongation mice with tumor.In position on liver cancer mouse model, use PCPFA/pHGFK1 respectively, PCPFA/pLuc nanoparticle is treated; One month after the treatment, often organize 8 mices and be condemned to death, extract tumor tissues and weigh.Accompanying drawing 7 illustrates that PCPFA/pHGFK1 nanoparticle significantly suppress liver cancer tissue growth.
Subsequently, the tumor tissues that we extract, and use immunohistochemistry technology to have studied blood capillary in different disposal group tumor tissues and tumor stem cell number.Result shows: compared with matched group, PCPFA/pHGFK1 process decreases the microvessel density of about 60%.These illustrate that PCPFA/pHGFK1 nanoparticle inhibits the generation of tumor vascular endothelium, thus Tumor suppression growth.In position on liver cancer mouse model, use PCPFA/pHGFK1 respectively, PCPFA/pLuc nanoparticle is treated, and often organizes 8 mices and is used to time-to-live research.As shown in Figure 8: compared with matched group, PCPFA/pHGFK1 nanoparticle obviously extends the life span of original position liver cancer mouse.In position on liver cancer mouse model, use PCPFA/pHGFK1 respectively, PCPFA/pLuc nanoparticle is treated; One month after the treatment, often organize 8 mices and be condemned to death, extract tumor tissues, row CD31 antibody immunohistochemistry dyeing after fixing.Utilize application microscope to carry out observing the expression density of CD31 in tumor tissues, use Gasparini ' scriteria stereology statistical method, calculate the unit are MVD density in tumor tissues.As accompanying drawing 9 and 10 shows, compared with matched group, the treatment of PCPFA/pHGFK1 nanoparticle all significantly reduces tumor microvessel density in tumor tissues in unit are and CD90+ liver-cancer stem cell number.
Claims (10)
1. a nanoparticle compositions, is characterized in that, described nanoparticle compositions is the nanoparticle of the plasmid self assembly of polymer support and expression treatment gene; Described polymer support is cyclodextrin-polymine-Polyethylene Glycol-folic acid quaternary assembled Poly-cation; The plasmid of described expression treatment gene is the eukaryon expression plasmid of the HGFK1 protein DNA sequence comprising coding hepatocyte growth factor.
2. a kind of nanoparticle compositions according to claim 1, is characterized in that, the structural formula of described cyclodextrin-polymine-Polyethylene Glycol-folic acid quaternary assembled Poly-cation is selected from formula 1 or formula 2; The structural formula of described formula 1 is specially:
PEI
600-CyD-PEG-FA；
The structural formula of described formula 2 is specially:
PEI
600-CyD-PEG-FA；
In formula 1 and formula 2, n is the cellular construction number of cyclodextrin-polymine-folic acid-Polyethylene Glycol, span 5-10, m1 is the secondary amino group cellular construction number in polymine, the value tertiary amino unit structure number that to be 4-8, m2 be in polymine, value is 2-5, L is oxirane unit structure number in Polyethylene Glycol, span 42-105.
3. a kind of nanoparticle compositions according to claim 1, it is characterized in that, the plasmid of described expression treatment gene is phEF1-HTLV-Igk-HGFK1-SV40, obtains by being subcloned into phEF1-HTLV-Igk-XXX-SV40 plasmid again after the DNA profiling from Human normal hepatocyte LO2 extraction expression people HGFK1.
4. a kind of nanoparticle compositions according to claim 3, it is characterized in that, described phEF1-HTLV-Igk-XXX-SV40 comprises: 1) hybrid promoters: 5 ' the nontranscribed domain sequence of people's elongation factor-1α promoter and human T-cell leukemia virus, see SEQIDNO1, it can start the expression of controlling gene for a long time in mammalian cell; 2) DNA sequence of coding secreting, expressing signal peptide IgK chain homing sequence, is shown in SEQIDNO2; 3) coding expresses therapeutic gene DNA sequence: Endostatin DNA sequence, sees SEQIDNO3; 4) simian virus polyA sequence: see SEQIDNO4;
SEQIDNO1：GGATCTGCGATCGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGCTGAAGCTTCGAGGGGCTCGCATCTCTCCTTCACGCGCCCGCCGCCCTACCTGAGGCCGCCATCCACGCCGGTTGAGTCGCGTTCTGCCGCCTCCCGCCTGTGGTGCCTCCTGAACTGCGTCCGCCGTCTAGGTAAGTTTAAAGCTCAGGTCGAGACCGGGCCTTTGTCCGGCGCTCCCTTGGAGCCTACCTAGACTCAGCCGGCTCTCCACGCTTTGCCTGACCCTGCTTGCTCAACTCTACGTCTTTGTTTCGTTTTCTGTTCTGCGCCGTTACAGATC，SEQIDNO2：ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGAC，SEQIDNO3：CATGAACTGCATCATTGGTAAAGGACGCAGCTACAAGGGAACAGTATCTATCACTAAGAGTGGTATCAAATGTCAGCCCTGGAGTTCCATGATACCACACGAACACAGCTTTTTGCCTTCGAGCTATCGGGGTAAAGACCTACAGGAAAACTACTGTCGAAATCCTCGAGGGGAAGAAGGGGGACCCTGGTGTTTCACAAGCAATCCAGAGGTACGCTACGAAGTCTGTGACATTCCTCAGTGTTAAGAAGTTGAATGCATGACCTGCTAA，SEQIDNO4：AGTTTGCCCTGAGAGACCCAGCAGGCAACTGTGTGCACTTTGTGGCAGAGGAGCAGGACTGAGGATAAGAATTCGCTAGCTCGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTA。
5. according to the preparation method of described nanoparticle compositions arbitrary in claim 1-4, it is characterized in that, described preparation method concrete steps are: synthesis cyclodextrin-polymine-folic acid-Polyethylene Glycol quaternary assembled Poly-cation, are called for short PCPFA; The plasmid of construction expression therapeutic gene, is called for short pHGFK1; The above-mentioned quaternary assembled Poly-cation obtained and plasmid are dissolved in the glucose solution of 2.5-5wt% respectively, again according to (5-40): the nitrogen/phosphorus of 1, than by two solution mixing, forms the PCPFA/pHGFK nanoparticle compositions of diameter in 80-120 nanometer.
6. according to the application of described nanoparticle compositions arbitrary in claim 1-4, it is characterized in that, described nanoparticle compositions is used for by eukaryotic cell expression and secretes the preparation of therapeutic gene HGFK1 medicine.
7. according to the application of described nanoparticle compositions arbitrary in claim 1-4, it is characterized in that, described nanoparticle compositions is for preventing or the preparation of Therapeutic cancer medicine.
8., according to the application of described nanoparticle compositions arbitrary in claim 1-4, it is characterized in that, described nanoparticle compositions is for preventing or treat the preparation of preinvasive cancer or metastatic carcinoma disease drug.
9. according to the application of described nanoparticle compositions arbitrary in claim 1-4, it is characterized in that, described nanoparticle compositions is for preventing or the preparation of Hepatoma therapy medicine.
10. according to the application of described nanoparticle compositions arbitrary in claim 1-4, it is characterized in that, described nanoparticle compositions is for preventing or the preparation of combined radiotherapy or chemotherapeutics in Therapeutic cancer process.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510621191.8A CN105412943A (en) | 2015-09-25 | 2015-09-25 | Nano particle composition and anti-tumor application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510621191.8A CN105412943A (en) | 2015-09-25 | 2015-09-25 | Nano particle composition and anti-tumor application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105412943A true CN105412943A (en) | 2016-03-23 |
Family
ID=55491774
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510621191.8A Pending CN105412943A (en) | 2015-09-25 | 2015-09-25 | Nano particle composition and anti-tumor application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105412943A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108611367A (en) * | 2018-04-24 | 2018-10-02 | 北京诺思兰德生物技术股份有限公司 | The gene therapy recombinant vector that one kind is mediated by plasmid vector |
| CN108840863A (en) * | 2018-06-07 | 2018-11-20 | 日照市普达医药科技有限公司 | A kind of tetrahydrofuran substituted uracil kind compound that treating liver cancer and its pharmaceutical composition and application |
| CN115414494A (en) * | 2022-08-17 | 2022-12-02 | 南京中医药大学 | Polypeptide nano vaccine and preparation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101338318A (en) * | 2008-01-25 | 2009-01-07 | 林李家宓 | Polycation transgene vector and method for synthesizing same |
| CN102038958A (en) * | 2009-10-19 | 2011-05-04 | 姚宏 | Nano particle composition and application thereof |
| CN102205133A (en) * | 2011-05-16 | 2011-10-05 | 姚宏 | Preparation method and application of polycation-coated adenovirus composition |
-
2015
- 2015-09-25 CN CN201510621191.8A patent/CN105412943A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101338318A (en) * | 2008-01-25 | 2009-01-07 | 林李家宓 | Polycation transgene vector and method for synthesizing same |
| CN102038958A (en) * | 2009-10-19 | 2011-05-04 | 姚宏 | Nano particle composition and application thereof |
| CN102205133A (en) * | 2011-05-16 | 2011-10-05 | 姚宏 | Preparation method and application of polycation-coated adenovirus composition |
Non-Patent Citations (3)
| Title |
|---|
| HAK SOO CHOI ET AL.: "block-selective movement of α-cyclodextrins in polyrotaxanes of pei-b-peg-b-pei copolymer", 《MACROMOLECULES》 * |
| 刘君: "偶合靶向配体的β-环糊精-低分子量聚乙烯亚胺作为基因载体系统的研究", 《中国优秀硕士学位论文全文数据库 医药卫生科技辑》 * |
| 聂常富等: "肝细胞靶向性半乳糖-聚乙二醇-聚乙烯亚胺纳米基因载体的合成及其理化特性", 《中国组织工程研究与临床康复》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108611367A (en) * | 2018-04-24 | 2018-10-02 | 北京诺思兰德生物技术股份有限公司 | The gene therapy recombinant vector that one kind is mediated by plasmid vector |
| CN108840863A (en) * | 2018-06-07 | 2018-11-20 | 日照市普达医药科技有限公司 | A kind of tetrahydrofuran substituted uracil kind compound that treating liver cancer and its pharmaceutical composition and application |
| CN115414494A (en) * | 2022-08-17 | 2022-12-02 | 南京中医药大学 | Polypeptide nano vaccine and preparation method and application thereof |
| CN115414494B (en) * | 2022-08-17 | 2024-04-26 | 南京中医药大学 | Polypeptide nanometer vaccine and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mohammadinejad et al. | In vivo gene delivery mediated by non-viral vectors for cancer therapy | |
| Liaw et al. | Dendrimer size effects on the selective brain tumor targeting in orthotopic tumor models upon systemic administration | |
| Li et al. | Nanotechnology: breaking the current treatment limits of lung cancer | |
| Fu et al. | Tumor cell membrane-camouflaged responsive nanoparticles enable MRI-guided immuno-chemodynamic therapy of orthotopic osteosarcoma | |
| Wahab et al. | Current trends and future perspectives of nanomedicine for the management of colon cancer | |
| Xu et al. | A near-infrared light-responsive extracellular vesicle as a “Trojan horse” for tumor deep penetration and imaging-guided therapy | |
| Pishavar et al. | Co-delivery of doxorubicin and TRAIL plasmid by modified PAMAM dendrimer in colon cancer cells, in vitro and in vivo evaluation | |
| Yan et al. | Recent progress of supramolecular chemotherapy based on host–guest interactions | |
| Hao et al. | Hybrid membrane-coated nanosuspensions for multi-modal anti-glioma therapy via drug and antigen delivery | |
| Wang et al. | Precise engineering of prodrug cocktails into single polymeric nanoparticles for combination cancer therapy: extended and sequentially controllable drug release | |
| Liang et al. | Specific activation of cGAS-STING pathway by nanotherapeutics-mediated ferroptosis evoked endogenous signaling for boosting systemic tumor immunotherapy | |
| Geng et al. | Combining anti-PD-1 antibodies with Mn2+-drug coordinated multifunctional nanoparticles for enhanced cancer therapy | |
| Allard et al. | Local delivery of ferrociphenol lipid nanocapsules followed by external radiotherapy as a synergistic treatment against intracranial 9L glioma xenograft | |
| Ding et al. | A novel strategy based on a ligand-switchable nanoparticle delivery system for deep tumor penetration | |
| Lin et al. | Efficiency against multidrug resistance by co-delivery of doxorubicin and curcumin with a legumain-sensitive nanocarrier | |
| Wang et al. | A tumor targeted near-infrared light-controlled nanocomposite to combat with multidrug resistance of cancer | |
| Zhu et al. | Reduction-responsive core-crosslinked hyaluronic acid-b-poly (trimethylene carbonate-co-dithiolane trimethylene carbonate) micelles: synthesis and CD44-mediated potent delivery of docetaxel to triple negative breast tumor in vivo | |
| Yang et al. | Lung cancer specific and reduction-responsive chimaeric polymersomes for highly efficient loading of pemetrexed and targeted suppression of lung tumor in vivo | |
| Xiong et al. | Dacarbazine-loaded targeted polymeric nanoparticles for enhancing malignant melanoma therapy | |
| CN111479593A (en) | Quinic acid-modified nanoparticles and uses thereof | |
| Shu et al. | Drug resistance reversal by interventing cancer bioenergetics with spherical helical polypeptide-potented gene silencing | |
| CN105412943A (en) | Nano particle composition and anti-tumor application thereof | |
| Li et al. | Polysialic acid-functionalized liposomes for efficient honokiol delivery to inhibit breast cancer growth and metastasis | |
| Song et al. | Dual-targeting nanovesicles enhance specificity to dynamic tumor cells in vitro and in vivo via manipulation of αvβ3-ligand binding | |
| Fan et al. | Lignin-assisted construction of sub-10 nm supramolecular self-assembly for photothermal immunotherapy and potentiating anti-PD-1 therapy against primary and distant breast tumors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160323 |
|
| RJ01 | Rejection of invention patent application after publication |