CN105399800A - Self-assembled polypeptide, preparation method, nucleic acid complex and uses thereof - Google Patents

Self-assembled polypeptide, preparation method, nucleic acid complex and uses thereof Download PDF

Info

Publication number
CN105399800A
CN105399800A CN201410461320.7A CN201410461320A CN105399800A CN 105399800 A CN105399800 A CN 105399800A CN 201410461320 A CN201410461320 A CN 201410461320A CN 105399800 A CN105399800 A CN 105399800A
Authority
CN
China
Prior art keywords
self
polypeptide
assembly
lys
arg
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410461320.7A
Other languages
Chinese (zh)
Other versions
CN105399800B (en
Inventor
王玉丽
郑学敏
龚珉
徐为人
汤立达
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin Tiancheng new drug evaluation Co.,Ltd.
Original Assignee
Tianjin Institute of Pharmaceutical Research Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin Institute of Pharmaceutical Research Co Ltd filed Critical Tianjin Institute of Pharmaceutical Research Co Ltd
Priority to CN201410461320.7A priority Critical patent/CN105399800B/en
Publication of CN105399800A publication Critical patent/CN105399800A/en
Application granted granted Critical
Publication of CN105399800B publication Critical patent/CN105399800B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Peptides Or Proteins (AREA)

Abstract

The present invention provides a self-assembled polypeptide for transfecting nucleic acid into cells, a preparation method of the self-assembled polypeptide, a self-assembled polypeptide and nucleic acid complex, and a method for transfecting a target nucleic acid into cells. According to the present invention, the self-assembled polypeptide having special physical and chemical properties and DNA or RNA molecules form the complex so as to effectively improve the stability of the nucleic acid; with the carrier, cell transfection can be performed in the presence of serum, and the transfection time can be prolonged to several days; and when the self-assembled polypeptide is used to carry out cell transfection, the deliberate serum removing is not required, such that the toxicity of the reagent on cells during the transfection is substantially reduced.

Description

A kind of self-assembly polypeptide, its preparation method, its nucleic acid complexes and purposes
Technical field
The present invention relates to cell biology, the reagent that the fundamental research particularly relating to cell biology uses.Specifically, the present invention relates to a kind of self-assembly polypeptide, its preparation method, its nucleic acid complexes and purposes.
Background technology
The process of DNA or RNA fragment insertosome cell or clone is cell transfection technique.Cell transfection technique is divided into chemical process and physical method, Physical and electroporation, available under some condition, but easily causes higher cytotoxicity, chemical method because of its operate easy and cheap and develop rapidly.
Chemical method generally includes lipofection (transfection method that application is maximum at present, as nothing specially indicates that namely chemical method refers to liposome method in a lot of document), calcium phosphate method, DEAE-dextran mediated method.
But liposome technology has its defect, liposome is extremely low in serum existent condition cell transfecting efficiency, and has certain toxicity to cell.In RNA, virus, transfection assay in because RNA is extremely unstable, just cause efficiency when using liposome to carry out RNA transfection lower.
Calcium phosphate method transfectional cell is simple, practical, but has certain limitation, has certain choosing then property to cell, about has the cell capture of 10% external source transfection DNA in average each culture dish.
DEAE-dextran mediated method transfection efficiency is higher, but mutagenicity is also higher, the transfectional cell of inapplicable separating stable, DEAE-dextran is used for the transient expression of clone gene, cells Stable transfection can not be made, it is very effective to clones such as BSC-1, CV-1, COS, but undesirable to the cell transfecting effect of other types.Current RNA transfection still needs continuous trial, and for different clone, the efficiency of transfection is often different, and for identical clone, different transfection reagent results also can be different, therefore need in transfection process constantly to attempt reaching good effect.
Current RNA transfection is applied in every field, for example, cell signal forwards analysis to, redundancy gene is determined, the detection of gene function, gene therapy and medicament research and development.Usual medicament research and development needs target to distinguish, target checking, treatment with exploitation, model animals test, the several process of clinical treatment, emerging RNA mediate rna i becomes last one operation effectively of target mediation.
In order to improve the efficiency of transfection, the stability improving RNA is a problem needing research.
The good physiological functions such as polypeptide, as a kind of biological substance, has bioavailability high, the little and special target of toxicity are more and more subject to the favor of New drug discovery investigator.But polypeptide receives the very big restriction of its physics and chemistry character as medicine application clinically.Polypeptide is as application one of focus becoming new drug development gradually of medicine subsidiary function, and the amphoteric character of polypeptide makes it have possibility by cytolemma, therefore may as the instrument of transfection.
Summary of the invention
Therefore, goal of the invention of the present invention is low for current transfection reagent transfection efficiency, and the deficiency of the nucleic acid instability of transfection provides a kind of nucleic acid transfection to carry reagent, thus improves the stability of nucleic acid, and transfection also can be carried out under serum exists.
Described one by one to various aspects of the present invention in conjunction with object of the present invention:
In one aspect of the invention, the self-assembly polypeptide of the sequence shown in following formula I is provided:
GLWWX 1X 2WWX 3X 4WWX 5X 6X 7WWX 8X 9X 10X 11X 12X 13(n)X 14
Formula I
(SEQIDNO：1)
Wherein, X 1for Lys or Arg;
X 2for Ala or Val or Leu;
X 3for Lys or Arg;
X 4for Ala or Val or Leu;
X 5for Lys or Arg;
X 6for Ser or Thr;
X 7for Leu or Val;
X 8for Lys or Arg;
X 9for Lys or Arg;
X 10for Lys or Arg;
X 11for Lys or Arg or Leu;
X 12for Lys or Arg;
X 13for Lys or Arg;
(n) X 14represent n X 14, wherein n is 0 or 1, X 14for Ala;
Or the variant polypeptide that this self-assembly polypeptide changes on one or more site, and above-mentioned self-assembly polypeptide or variant polypeptide pharmaceutically acceptable salt, ester, ether or acid amides, or its mixture.
The feature of the self-assembly polypeptide of general formula I sequence be synthetic containing 23-24 amino acid whose polypeptide, N-terminal is nonpolar amino acid end, and C-terminal is polare Aminosaeren end simultaneously, and middle W-W is in order to form desired structure.
In the present invention one is preferred,
X 1＝Lys；
X 4=Ala or Leu;
X 6＝Ser；
X 7＝Leu；
X 8＝Arg；
X 9＝Lys；
X 10＝Arg；
X 11=Lys or Leu;
X 12＝Arg；
X 13＝Lys。
Of the present invention one preferred in, described self-assembly polypeptide is selected from:
Self-assembly polypeptide 1 (SEQIDNO:2):
GLWWKAWWKAWWKSLWWRKRKRKA；
Self-assembly polypeptide 2 (SEQIDNO:3):
GLWWKVWWKLWWKSLWWRKRLRKA；
Self-assembly polypeptide 3 (SEQIDNO:4):
GLWWKLWWKLWWKSLWWRKRKRKA；
Self-assembly polypeptide 4 (SEQIDNO:5):
GLWWKLWWKLWWKSLWWRKRLRK。
Self-assembly polypeptide 5 (SEQIDNO:6):
GLWWKAWWRAWWKSLWWRKRKRKA；
Self-assembly polypeptide 6 (SEQIDNO:7):
GLWWKVWWRLWWKSLWWRKRLRKA；
Self-assembly polypeptide 7 (SEQIDNO:8):
GLWWKLWWRLWWKSLWWRKRKRKA；
Self-assembly polypeptide 8 (SEQIDNO:9):
GLWWKAWWKAWWRSLWWRKRKRKA；
Self-assembly polypeptide 9 (SEQIDNO:10):
GLWWKVWWKLWWRSLWWRKRLRKA；
Self-assembly polypeptide 10 (SEQIDNO:11):
GLWWKLWWKLWWRSLWWRKRKRKA; With
Self-assembly polypeptide 11 (SEQIDNO:12):
GLWWKLWWKLWWRSLWWRKRLRK。
In present invention further optimization, described self-assembly polypeptide is selected from:
Self-assembly polypeptide 1:GLWWKAWWKAWWKSLWWRKRKRKA (SEQIDNO:2),
Self-assembly polypeptide 2:GLWWKVWWKLWWKSLWWRKRLRKA (SEQIDNO:3),
Self-assembly polypeptide 3:GLWWKLWWKLWWKSLWWRKRKRKA (SEQIDNO:4), and
Self-assembly polypeptide 4:GLWWKLWWKLWWKSLWWRKRLRK (SEQIDNO:5);
Of the present invention further preferred in, described self-assembly polypeptide is self-assembly polypeptide 1:GLWWKAWWKAWWKSLWWRKRKRKA (SEQIDNO:2).
In another aspect of the present invention, provide above-mentioned self-assembly polypeptide, the variant polypeptide that this self-assembly polypeptide changes on one or more site, the salt of above-mentioned self-assembly polypeptide or variant polypeptide, ester, ether or acid amides, or the preparation method of its mixture, the method takes chemical synthesis to carry out; Preferably, its method adopted comprises the step of HPLC purifying and desalination; Again preferably, described chemical synthesis is selected from Fmoc method or Boc method.
Of the present invention one preferred in, described preparation takes Fmoc method to carry out, and comprises step:
1) using chloromethyl polystyrene resin as insoluble solid phase self-assembly.
2) amino acid amino being closed radical protection is covalently bound in solid phase self-assembly.
3) under the effect of trifluoroacetic acid, the protecting group of desamidizate;
4) amino acid whose amino reacts second amino acid activated by DCC by carboxyl with first that is connected on solid phase self-assembly again;
5) repeat above-mentioned peptide bond forming reactions, make peptide chain from C end to the growth of N end, until reach required peptide chain length;
6) use the piperidines DMF of 20% ~ 50% to slough protecting group Fmoc, be hydrolyzed the ester bond between peptide chain and solid phase self-assembly with HF.
Of the present invention one preferred in, described preparation takes Boc method to carry out, and comprises step:
1) using PAM resin or Merrifield as insoluble solid phase self-assembly;
2) amino acid amino being closed radical protection is covalently bound in solid phase self-assembly;
3) under the effect of hydrofluoric acid, the protecting group of desamidizate;
4) amino acid whose amino reacts second amino acid activated by DCC by carboxyl with first that is connected on solid phase self-assembly again;
5) repeat above-mentioned peptide bond forming reactions, make peptide chain from C end to the growth of N end, until reach required peptide chain length;
6) slough protecting group Boc with TFA, be hydrolyzed the ester bond between peptide chain and solid phase self-assembly with HF.
In one embodiment of the invention, use Fmoc method to carry out the solid phase synthesis of the self-assembly polypeptide described in patent, the solid phase synthesis process of polypeptide is universal method in field.Product is suitable for HPLC and carries out purifying and desalination.
The DNA related in the present invention or RNA molecule do not have the restriction of sequence, the restriction of size.
In another aspect of the present invention, provide self-assembly polypeptide, variant polypeptide or above-mentioned self-assembly polypeptide or variant polypeptide pharmaceutically acceptable salt, ester, ether or acid amides, or the mixture that its mixture and nucleic acid molecule are formed.
Of the present invention one preferred in, described nucleic acid is DNA or RNA.
Of the present invention one preferred in, nucleic acid and self-assembly polypeptide, variant polypeptide or above-mentioned self-assembly polypeptide or variant polypeptide pharmaceutically acceptable salt, ester, ether or acid amides, or the mol ratio of its mixture is 25:1 ~ 1:100; Preferably, described mol ratio is 1:1 ~ 1:25; Again preferably, described mol ratio is 1:10.
In another aspect of the present invention, provide the method be transfected into by target nucleic acid in cell, it is characterized in that comprising step: 1) by target nucleic acid and above-mentioned self-assembly polypeptide, variant polypeptide or above-mentioned self-assembly polypeptide or variant polypeptide pharmaceutically acceptable salt, ester, ether or acid amides, or its mixture carries out being mixed to form mixture; 2) cell is cultivated under the existence of this mixture.
Of the present invention one preferred in, described target nucleic acid is DNA or RNA;
The present invention has following advantage:
1, the self-assembly polypeptide of special physico-chemical character of the present invention and DNA or RNA molecule form mixture, effectively can improve the stability of nucleic acid.
2, adopt supporting agent of the present invention, cell transfecting can carry out under serum existent condition, and transfection time can extend to a couple of days.When using that self-assembly polypeptide carries out cell transfecting in the present invention, without the need to specially place to go serum, thus the toxicity that when greatly reducing transfection, agents on cellular causes.
3, in the present invention, the formation of the mixture of self-assembly polypeptide and nucleic acid molecule does not need special testing sequence, only need carry out in cell culture medium.
Accompanying drawing explanation
Below, describe embodiment of the present invention in detail by reference to the accompanying drawings, wherein:
Fig. 1 is the high performance liquid chromatography of the mixture of DNA molecular of the present invention and self-assembly polypeptide, and wherein said self-assembly polypeptide is self-assembly polypeptide 8; Particularly: Figure 1A is the liquid chromatogram of DNA01, Figure 1B is the color atlas of self-assembly polypeptide 8, Fig. 1 C is DNA01 and self-assembly polypeptide 8 ratio is the color atlas of 1:100, Fig. 1 D is DNA01 and self-assembly polypeptide 8 ratio is the color atlas of 15:1, can find out can obtain mixture when ratio is 15:1;
Fig. 2 is that RNA compares through the rear stability of parcel, choose lipolink2005 in contrast, for SEQIDNO:9, ratio of choosing respectively is 15:1, 1:10, 1:20, the mixture (detailed in Example 6) of 1:50, after transfection success, 8 hours are chosen in 72 hours, 12 hours, 24 hours, 36 hours, 48 hours, it within 72 hours, is test point, extract and compare rna content, when found that use self-assembly polypeptide carries out cell transfecting, the mixture of self-assembly polypeptide and nucleic acid the concentration in serum can all be greater than the mixture of RNA and liposome lipolink2005.Further, still can detect at 48 hours, the mixture of RNA molecule and the self-assembly polypeptide concentration in serum is at more than 80ug/ul, and namely stable existence more than 48 hours, considerably increases transfection efficiency and security.
Fig. 3 is that RNA is at hepeG2 transit cell dye efficiency comparison, with lipo2000 in contrast, for polypeptide SEQIDNO:8, choose the mixture (detailed in Example 7) that ratio is 25:1,1:100,1:1,1:10 respectively, as seen in Figure 3, four selected ratios all comparatively lipo2000 have better effects, and wherein 1:10 transfection efficiency is the highest.
Embodiment
Below in conjunction with embodiment, the present invention is further illustrated.Embodiment is only indicative content, never means that it limits the scope of the invention by any way.
the preparation of embodiment 1 self-assembly polypeptide 1 (SEQIDNO.2)
In the preparation process of self-assembly polypeptide 1, it is as follows that the reagent used is purchased approach:
CEMliberitity Peptide synthesizer is taked in the synthesis of self-assembly polypeptide 1, carries out according to the specification sheets of instrument manufacturer facility business.
1) using chloromethyl polystyrene resin as insoluble solid phase self-assembly.
The resin particle diameter selected: 100 ~ 200mesh, carrying capacity: 0.10 ~ 0.34
2) amino is closed the amino acid that group (G) protects covalently bound in solid phase self-assembly.
Selected amino acid is: Fmoc-Tyr (tBu)-OH, Fmoc-Ile-OHFmoc-leu (tBu)-OH, Fmoc-Ala-OH, Fmoc-Thr (tBu)-OH, Fmoc-Val-OH, Fmoc-Lys (Boc)-OH, Fmoc-Phe-OH, Fmoc-Arg (pbf)-OH, Fmoc-Ser (tBu)-OH, Fmoc-Trp-OH, Fmoc-Cys (Trt)-OH, Fmoc-Gln (Trt)-OH, Fmoc-Asn (trt)-OH, Fmoc-Trp (tBu)-OH, Fmoc-Asp-OH, Fmoc-His (Trt)-OH, Fmoc-Gly-OH, the reaction conditions in succession selected is: 1. benzotriazole-N, N, N', N'-tetramethyl-urea hexafluorophosphate/I-hydroxybenzotriazole (HOBT), or 2. 2-(7-azo benzotriazole)-N, N, N', N'-tetramethyl-urea phosphofluoric acid ester/I-hydroxybenzotriazole (HOBT), 3. N, N'-DIC.1. or the 2. plant coupling reagent if use the, so should add activator alkali in process in reaction: DIEA, stirring reaction 20min or microwave reaction 5min, use DMF or methylene dichloride as washings.]
3) under the effect of trifluoroacetic acid, the protecting group of desamidizate, such first amino acid has just been received in solid phase self-assembly.The cutting of selecting is TFA/ thioanisole/water/phenol/1，2-ethandithiol, and ratio is: 82.5:5:5:5; 2.5.If or not containing halfcystine in polypeptide, methionine(Met), arginine can select TFA/ Tutofusin tris/water, and ratio is 95:2.5:2.5.
4) then amino second the amino acid whose carboxyl be closed passes through N, N ˊ-dicyclohexylcarbodiimide (DCC, Dicyclohexylcarbodiimide) activate, amino acid whose amino reacts and forms peptide bond second amino acid (L) that carboxyl is activated by DCC with first that is connected on solid phase self-assembly again, stir 20min, with ninhydrin method or 2,4,6-trinitro-benzene-sulfonic acid method or tetrachloro band benzene paraquinones method detection reaction terminal.
6) in solid phase self-assembly, a dipeptides with protecting group is just generated like this.Repeat above-mentioned peptide bond forming reactions, make peptide chain from C end to the growth of N end, until reach required peptide chain length.
7) finally slough protecting group Fmoc, be hydrolyzed the ester bond between peptide chain and solid phase self-assembly, just obtain synthetic peptide with HF, Fmoc uses the piperidines DMF of 20% ~ 50% to remove, and HF is hydrolyzed concentration more than 95%.
Polypeptide HPLC is carried out purifying, use phenomenexC18 post 2.5um250*4.6mm, under room temperature, moving phase is acetonitrile and water, and adding trifluoroacetic acid as ion pair reagent, thick elution requirement is: 20% acetonitrile (0.1% trifluoroacetic acid) ~ 80% acetonitrile (0.1% trifluoroacetic acid).Eventually pass desalination and lyophilize obtains polypeptides freeze-dry powder.
the synthesis of embodiment 2 self-assembly polypeptide 2 (SEQIDNO:3)
Self-assembly polypeptide 1 (SEQIDNO in the synthetic method of self-assembly polypeptide 2 and embodiment 1 :2) synthetic method is identical, except connect each amino acid is:
First amino acid: Ala
Second amino acid: Lys
3rd amino acid: Arg
4th amino acid: Leu
Five amino acid: Arg
6th amino acid: Lys
Seven amino acid: Arg
8th amino acid: Trp
9th amino acid: Trp
Tenth amino acid: Leu
11 amino acid: Ser
12 amino acid: Lys
13 amino acid: Trp
14 amino acid: Trp
Tenth five amino acid: Leu
16 amino acid: Lys
Tenth seven amino acid: Trp
18 amino acid: Trp
Nineteen amino acid: Val
20 amino acid: Lys
21 amino acid: Trp
22 amino acid: Trp
23 amino acid: Leu
24 amino acid: Gly
the BOC method synthesis of embodiment 3 self-assembly polypeptide 3 (SEQIDNO:4)
In the preparation process of self-assembly polypeptide 3, it is as follows that the reagent used is purchased approach:
The synthesis of polypeptide 3 takes Activo-P14 semi-automatic polypeptide synthesizer to carry out Peptide systhesis, and synthesis step carries out according to the specification sheets of instrument manufacturer.
Protected amino acid required for Peptide systhesis process is: Arg (Mts), Arg (NO2), Arg (Tos), Asp (OBzl), Asp (OcHx), Cys (pMeBzl), Cys (Acm), Cys (pMeOBzl), Glu (OBzl), Glu (OcHx), His (Bom), His (Dnp), His (Tos), His (Z), Lys (2-Cl-Z), Ser (Bzl), Thr (Bzl), Trp (For) and Tyr (2-Br-Z).
Experiment concrete steps:
1) Choice of Resin: PAM resin, with few DMF or the methylene dichloride swellable resins of trying one's best
2) the removing of N-terminal BOC: N-must be held Boc blocking group TFA to remove before HF cutting.Because it not only can hinder HF cutting removing t-bu group below, but also can be excised the amino acid of Boc radical protection in all peptide chains by ion-exchange, cutting agent selects TFA/DCM than being 1:1.
3) peptide sequence extends: the prolongation of holding N to hold from C, is followed successively by: Ala, Lys, Arg, Lys, Arg, Lys, Arg, Trp, Trp, Leu, Ser, Lys, Trp, Trp, Leu, Lys, Trp, Trp, Leu, Lys, Trp, Trp, Leu, Gly.
4) cut: cutting reagent ratio: the polypeptide HF/ methyl-phenoxide/DMS/p-benzene methylthio phenol (10:1:1:0.2) containing Cys cuts, and cutting with HF/DMS/ methyl-phenoxide (10:1:1) not containing Cys.
5) purifying: polypeptide HPLC is carried out purifying, use phenomenexC18 post 2.5um250*4.6mm, flow at room temperature is acetonitrile and water mutually, and add trifluoroacetic acid as ion pair reagent, thick elution requirement is: 20% acetonitrile (0.1% trifluoroacetic acid) ~ 80% acetonitrile (0.1% trifluoroacetic acid), eventually passes desalination and lyophilize obtains polypeptides freeze-dry powder.
the BOC method synthesis of embodiment 4 self-assembly polypeptide 4 (SEQIDNO5)
In the present embodiment, the synthetic method of self-assembly polypeptide 4 is with embodiment 3, just peptide sequence is different, is followed successively by: Lys, Arg, Leu, Arg, Lys, Arg, Trp, Trp, Leu, Ser, Lys, Trp, Trp, Leu, Lys, Trp, Trp, Ala, Lys, Trp, Trp, Leu, Gly.
the preparation of the mixture of embodiment 5 nucleic acid molecule and self-assembly polypeptide
In the present embodiment, a series of nucleic acid molecule and self-assembly polypeptide of the present invention is adopted to be mixed and made into mixture.Nucleic acid molecule described in following group and self-assembly polypeptide of the present invention are mixed according to the amount limited in each group and are dissolved in RPMI-1640 cell culture medium 1ml, and fully mixes.
RNA and DNA used in following group all leads to Trade Co., Ltd. purchased from Beijing six directions, and its sequence is respectively:
RNA-01(SEQIDNO：13)：CAAUAACUGUGAGGUGGUCC；
RNA-02(SEQIDNO：14)：
UGCCCGGCGAGUCGGGCUCUGGAGGAAAAGAAAGUUUGCC；
DNA-01(SEQIDNO：15)：CGAGGGCTGCTGGGGCCCGG；
DNA-02(SEQIDNO：16)：
CGCCGCCCAGACCGGACGACAGGCCACCTCGTCGGCGTCCCCCGAGTCCCCGCCTCGCC。According to above-mentioned method, and the material proportion recorded in table 1 prepares the mixture of each group:
The mixture of table 1:RNA molecule and self-assembly polypeptide prepares the material proportion of embodiment
The mixture of table 2:DNA molecule and self-assembly polypeptide prepares the material proportion of embodiment
After mixing thoroughly, detected by high performance liquid chromatography, knownly there occurs self-assembly at self-assembly polypeptide and define mixture with nucleic acid molecule.For mixture No. 5 mixtures of DNA molecular and self-assembly polypeptide, high-efficient liquid phase chromatogram display as in Fig. 1: Figure 1A is the liquid chromatogram of DNA01, Figure 1B is the color atlas of self-assembly polypeptide 8, Fig. 1 C is DNA01 and self-assembly polypeptide 8 ratio is the color atlas of 1:100, Fig. 1 D is DNA01 and self-assembly polypeptide 8 ratio is the color atlas of 15:1, can find out can obtain mixture when ratio is 15:1.
the coated stability of embodiment 6RNA compares
Choose the mixture of the mixture 5-8 group of RNA molecule and self-assembly polypeptide, carry out the coated stability test of RNA.
1, the centrifuge tube 5 of 1.5 milliliters is prepared, 400ul stoning acid, enzyme water are added in pipe, shook for 10 seconds, experimental group is respectively 5 ~ 8 groups of mixtures, and control group is the mixture of RNA (leading to Trade Co., Ltd. purchased from Beijing six directions) and liposome lipolink2005 (1000:1) (purchased from the excellent thing company limited that rather supports one's family in Shanghai).
2, mixed solution is placed 10-15 minute in room temperature.
3, respectively at 8,12,24,36,48,72 hours, get 20ul feed liquor at every turn and carry out content detection mutually.
As shown in Figure 2, when using self-assembly polypeptide to carry out cell transfecting, the mixture of self-assembly polypeptide and nucleic acid the concentration in serum can all be greater than the mixture of RNA01 and liposome lipolink2005 to result.Further, still can detect at 48 hours, the mixture of RNA molecule and the self-assembly polypeptide concentration in serum is at more than 80ug/ul, and namely stable existence more than 48 hours, considerably increases transfection efficiency and security.
the mixture of embodiment 7RNA/DNA molecule and self-assembly polypeptide 7 (SEQIDNO8) carries out cell transfecting
In the present embodiment, compared for the difference of transfection efficiency when RNA01, RNA02 use liposome and use self-assembly polypeptide of the present invention to carry out transfection.
Particularly, first by the RNA molecule of following group and self-assembly polypeptide according to the ratio defined in each group, mix with hepeG2 cell culture medium according to the method described in embodiment 5, and according to the condition of each group, the cell in each group is cultivated in this substratum.
Select hepeG2 cell to carry out the experiment of the present embodiment.The multiple plasma proteins of hepeG2 emiocytosis: white protein, alpha2-macroglobulin, profibr(in)olysin, siderophilin etc.This cell energy Large Copacity is cultivated, and hepeG2 is typically used as the model of cell transfecting owing to can secrete multiple protein.Its probability applied in transfection is only second to Chinese hamster ovary celI.
Wherein, hepeG2 cell is purchased from Chinese Academy of Sciences's Shanghai cell bank.
Lipo2000 is in contrast a kind of artificial membrane, and it is purchased from You Ningwei Shanghai bio tech ltd, and commodity are called LipofectamineTM2000Reagent.Lipo2000 be a kind of known for by nucleic acid transfection to intracellular Lipid carriers.
Select the mixture of the 1-4 group of the mixture of RNA molecule and self-assembly polypeptide in embodiment 5 to test, investigate transfection efficiency during transfection, use the mixture of lipo2000 and RNA-01 in contrast simultaneously.Its concrete material proportion is as shown in table 3 below.
The preparation method of the mixture of lipo2000 and RNA-01 is: by going nuclease water to add in pipe the concentration being dissolved to needs, shook for 10 seconds, dissolves smectic thing, reagent is placed on-20 degrees Celsius of preservations after concussion, also need concussion before using, wherein, the ratio of lipo2000 and RNA-01 is 1000:1
Table 3: the material proportion of nucleic acid molecule-self-assembly polypeptide complex transfectional cell
The concrete steps of transfection are:
1, transfection is carried out in 24 orifice plates, carries bed board the day before yesterday, and controlling cell is 10000/ hole.Cell is put into CO2gas incubator cultivate.
2, nuclease water will be gone to add in pipe, shake for 10 seconds, dissolve mixture and smectic thing.Get 20ul to add in the serum free medium of suitable volumes.
3, after concussion, reagent is placed on-20 degrees Celsius of preservations, before using, also needs concussion.
4, suck the substratum in culture plate, clean once with PBS or serum free medium.
5, add mixed solution, cell is put back in incubator and cultivate one hour.
6, add perfect medium after one hour to continue to cultivate.
7, the point be respectively 8 hours, 12 hours, 24 hours, 36 hours, 48 hours, 72 hours at transfection time gets transfectional cell sample, uses RT-PCR method to detect transfection efficiency.
First propose total serum IgE (test kit is purchased from invitrogen), select OligodT (16) primer, amplification number of times at least 45 ~ 50 times, the reagent used and primer are except specified otherwise is all purchased from Shanghai biotechnology company limited.As seen in Figure 3, four selected ratios all comparatively lipo2000 have better effects, and under the ratio of wherein 1:10, transfection efficiency is the highest.
Result confirms, the fluorocyte ratio after flow cytomery is calculated after adopting self-assembly polypeptide of the present invention to carry out transfection efficiency, can show that self-assembly polypeptide carries out transfection up to 95%, and adopt general liposome to be only 27% at intraserous transfection efficiency.

Claims (9)

1. one kind has the self-assembly polypeptide of the sequence shown in following formula I:
GLWWX 1X 2WWX 3X 4WWX 5X 6X 7WWX 8X 9X 10X 11X 12X 13(n)X 14
Formula I
Wherein, X 1for Lys or Arg;
X 2for Ala or Val or Leu;
X 3for Lys or Arg;
X 4for Ala or Val or Leu;
X 5for Lys or Arg;
X 6for Ser or Thr;
X 7for Leu or Val;
X 8for Lys or Arg;
X 9for Lys or Arg;
X 10for Lys or Arg;
X 11for Lys or Arg or Leu;
X 12for Lys or Arg;
X 13for Lys or Arg;
(n) X 14represent n X 14, wherein n is 0 or 1, X 14for Ala; Or
The variant polypeptide that this self-assembly polypeptide changes on one or more site, the salt of above-mentioned self-assembly polypeptide or variant polypeptide, ester, ether or acid amides, or its mixture.
2. self-assembly polypeptide as claimed in claim 1, the variant polypeptide that this self-assembly polypeptide changes on one or more site, the salt of above-mentioned self-assembly polypeptide or variant polypeptide, ester, ether or acid amides, or its mixture, is characterized in that:
X 1＝Lys；
X 4=Ala or Leu;
X 5＝Lys；
X 6＝Ser；
X 7＝Leu；
X 8＝Arg；
X 9＝Lys；
X 10＝Arg；
X 11=Lys or Leu;
X 12＝Arg；
X 13＝Lys。
3. self-assembly polypeptide as claimed in claim 1 or 2, the variant polypeptide that this self-assembly polypeptide changes on one or more site, the salt of above-mentioned self-assembly polypeptide or variant polypeptide, ester, ether or acid amides, or its mixture, it is characterized in that, described self-assembly polypeptide is selected from:
Self-assembly polypeptide 1:GLWWKAWWKAWWKSLWWRKRKRKA (SEQIDNO:2),
Self-assembly polypeptide 2:GLWWKVWWKLWWKSLWWRKRLRKA (SEQIDNO:3),
Self-assembly polypeptide 3:GLWWKLWWKLWWKSLWWRKRKRKA (SEQIDNO:4), and
Self-assembly polypeptide 4:GLWWKLWWKLWWKSLWWRKRLRK (SEQIDNO:5);
Preferably, described self-assembly polypeptide is
Self-assembly polypeptide 1:GLWWKAWWKAWWKSLWWRKRKRKA (SEQIDNO:2).
4. prepare the arbitrary described self-assembly polypeptide of claim 1-3, the variant polypeptide that this self-assembly polypeptide changes on one or more site, the salt of above-mentioned self-assembly polypeptide or variant polypeptide, ester, ether or acid amides, or the method for its mixture, it is characterized in that, comprise the step of chemical synthesis;
Preferably, its method adopted comprises the step of HPLC purifying and desalination;
Again preferably, described chemical synthesis is selected from Fmoc method or Boc method.
5. method as claimed in claim 4, is characterized in that, adopt Fmoc method, this Fmoc method comprises step:
1) using chloromethyl polystyrene resin as insoluble solid phase self-assembly;
2) first amino acid amino being closed radical protection is covalently bound in solid phase self-assembly;
3) under the effect of trifluoroacetic acid, the protecting group of desamidizate;
4) amino acid whose amino reacts second amino acid activated by DCC by carboxyl with first that is connected on solid phase self-assembly again;
5) repeat above-mentioned peptide bond forming reactions, make peptide chain from C end to the growth of N end, until reach required peptide chain length;
6) use the piperidines DMF of 20% ~ 50% to slough protecting group Fmoc, be hydrolyzed the ester bond between peptide chain and solid phase self-assembly with HF.
6. method as claimed in claim 4, is characterized in that, adopt Boc method, this Boc method comprises step:
1) using PAM resin or Merrifield as insoluble solid phase self-assembly;
2) amino acid amino being closed radical protection is covalently bound in solid phase self-assembly;
3) under the effect of hydrofluoric acid, the protecting group of desamidizate;
4) amino acid whose amino reacts second amino acid activated by DCC by carboxyl with first that is connected on solid phase self-assembly again;
5) repeat above-mentioned peptide bond forming reactions, make peptide chain from C end to the growth of N end, until reach required peptide chain length;
6) slough protecting group Boc with TFA, be hydrolyzed the ester bond between peptide chain and solid phase self-assembly with HF.
7. claim 1-3 arbitrary described self-assembly polypeptide, variant polypeptide or above-mentioned self-assembly polypeptide or variant polypeptide pharmaceutically acceptable salt, ester, ether or acid amides, or the mixture that its mixture and nucleic acid molecule are formed;
Preferably, described nucleic acid molecule is DNA or RNA.
8. mixture as claimed in claim 7, it is characterized in that, described self-assembly polypeptide, variant polypeptide or above-mentioned self-assembly polypeptide or variant polypeptide pharmaceutically acceptable salt, ester, ether or acid amides, or the mol ratio of its mixture and nucleic acid molecule is 25:1 ~ 1:100; Preferably, described mol ratio is 1:1 ~ 1:25; Again preferably, described mol ratio is 1:10.
9. target nucleic acid is transfected into the method in cell, it is characterized in that, comprise step:
1) by the self-assembly polypeptide described in target nucleic acid and any one of claim 1-3, variant polypeptide or above-mentioned self-assembly polypeptide or variant polypeptide pharmaceutically acceptable salt, ester, ether or acid amides, or its mixture carries out being mixed to form mixture;
2) cell is cultivated under the existence of this mixture;
Preferably, described target nucleic acid is DNA or RNA.
CN201410461320.7A 2014-09-11 2014-09-11 A kind of self assembly polypeptide, preparation method, its nucleic acid complexes and purposes Active CN105399800B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410461320.7A CN105399800B (en) 2014-09-11 2014-09-11 A kind of self assembly polypeptide, preparation method, its nucleic acid complexes and purposes

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410461320.7A CN105399800B (en) 2014-09-11 2014-09-11 A kind of self assembly polypeptide, preparation method, its nucleic acid complexes and purposes

Publications (2)

Publication Number Publication Date
CN105399800A true CN105399800A (en) 2016-03-16
CN105399800B CN105399800B (en) 2019-07-19

Family

ID=55465595

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410461320.7A Active CN105399800B (en) 2014-09-11 2014-09-11 A kind of self assembly polypeptide, preparation method, its nucleic acid complexes and purposes

Country Status (1)

Country Link
CN (1) CN105399800B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106317163A (en) * 2016-08-23 2017-01-11 安徽天达谱申生物科技有限公司 High-efficiency automatic polypeptide synthesis method
CN111647626A (en) * 2020-06-08 2020-09-11 中国石油大学(华东) Self-assembly of multi-sulfhydryl peptide and application of gene vector thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102558308A (en) * 2010-12-31 2012-07-11 天津药物研究院 Carrier polypeptide for forming medical compositions and preparation method and application of carrier polypeptide
CN103833833A (en) * 2012-11-20 2014-06-04 天津药物研究院 Self-assembled polypeptide, preparation method and application thereof
CN103897043A (en) * 2012-12-28 2014-07-02 天津药物研究院 Preparation and application of transmembrane polypeptide connected lapatinib

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102558308A (en) * 2010-12-31 2012-07-11 天津药物研究院 Carrier polypeptide for forming medical compositions and preparation method and application of carrier polypeptide
CN103833833A (en) * 2012-11-20 2014-06-04 天津药物研究院 Self-assembled polypeptide, preparation method and application thereof
CN103897043A (en) * 2012-12-28 2014-07-02 天津药物研究院 Preparation and application of transmembrane polypeptide connected lapatinib

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
YING LI ET AL.: "Self-assembled peptide(CADY-1) improved the clinical application of doxorubicin, International journal of phrmaceutics", 《INTERNATIONAL JOURNAL OF PHARMACEUTICS》 *
邵明香等: "自组装多肽在新型药物制剂研发领域中的应用", 《中国生物工程杂志》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106317163A (en) * 2016-08-23 2017-01-11 安徽天达谱申生物科技有限公司 High-efficiency automatic polypeptide synthesis method
CN111647626A (en) * 2020-06-08 2020-09-11 中国石油大学(华东) Self-assembly of multi-sulfhydryl peptide and application of gene vector thereof
CN111647626B (en) * 2020-06-08 2022-07-22 中国石油大学(华东) Self-assembly of multi-sulfhydryl peptide and application of gene vector thereof

Also Published As

Publication number Publication date
CN105399800B (en) 2019-07-19

Similar Documents

Publication Publication Date Title
Martin et al. Greening the synthesis of peptide therapeutics: an industrial perspective
Stawikowski et al. Introduction to peptide synthesis
Bruckdorfer et al. From production of peptides in milligram amounts for research to multi-tons quantities for drugs of the future
Petrou et al. Peptide synthesis: Methods, trends, and challenges
JPH11507648A (en) Conformationally restricted combinatorial library compositions and methods
CN101899092B (en) Novel peptide-link base-conjugate and solid phase synthesis method thereof
US20120270808A1 (en) Compositions and methods related to synchronous selection of homing peptides for multiple tissues by in vivo phage display
CN104428310A (en) Cell penetrating peptides & methods of identifying cell penetrating peptides
Rocquigny et al. Two short basic sequences surrounding the zinc finger of nucleocapsid protein NCp10 of Moloney murine leukemia virus are critical for RNA annealing activity
CN108395471A (en) Inhibit the polypeptide of MERS-CoV infection
CN113402590A (en) KHL polypeptide and application thereof in preparation of TABP-EIC cells
EP1622930A1 (en) Template-fixed peptidomimetics as medicaments against hiv and cancer
CN105399800A (en) Self-assembled polypeptide, preparation method, nucleic acid complex and uses thereof
CN106554391A (en) A kind of synthetic method of Marine biologic peptide Xen2174
EP3315508A1 (en) Polypeptide compound and preparation method and use thereof
EP3414257A1 (en) Method for preparation of liraglutide using bal linker
Kates et al. Solid-phase synthesis of cyclic peptides
EP3323825A1 (en) Polypeptide compound and preparation method and use thereof
Qvit et al. Development of a backbone cyclic peptide library as potential antiparasitic therapeutics using microwave irradiation
Harris et al. Toward the total chemical synthesis of the cancer protein NY‐ESO‐1
JPH111493A (en) Peptide and medical material obtained by immobilizing the same
US20090142768A1 (en) Perforin-2 proteins
CN111320671B (en) P201 optimized peptide, anti-tumor polypeptide, medicine prepared from same and targeted inhibitor
CN109503701A (en) A kind of cyclic peptide and its application in preparation of anti-tumor drugs
CN102124026A (en) Peptides and derivatives thereof, the manufacturing thereof as well as their use for preparing a therapeutically and/or preventively active pharmaceutical composition

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CP01 Change in the name or title of a patent holder
CP01 Change in the name or title of a patent holder

Address after: 300193 Tianjin City, Nankai District Anshan West Road No. 308

Patentee after: Tianjin Institute of Pharmaceutical Research Co.,Ltd.

Address before: 300193 Tianjin City, Nankai District Anshan West Road No. 308

Patentee before: Tianjin Institute of Pharmaceutical Research

TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20210603

Address after: 308 Huiren Road, Binhai Science Park, Binhai New Area, Tianjin 300301

Patentee after: Tianjin Tiancheng new drug evaluation Co.,Ltd.

Address before: 300193 Tianjin City, Nankai District Anshan West Road No. 308

Patentee before: Tianjin Institute of Pharmaceutical Research Co.,Ltd.