CN105388297A - Application of mycobacterium tuberculosis protein Rv1984c in preparing products for diagnosing latent phthisis infection - Google Patents
Application of mycobacterium tuberculosis protein Rv1984c in preparing products for diagnosing latent phthisis infection Download PDFInfo
- Publication number
- CN105388297A CN105388297A CN201510719057.1A CN201510719057A CN105388297A CN 105388297 A CN105388297 A CN 105388297A CN 201510719057 A CN201510719057 A CN 201510719057A CN 105388297 A CN105388297 A CN 105388297A
- Authority
- CN
- China
- Prior art keywords
- rv1984c
- diagnosis
- protein
- examination
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/5695—Mycobacteria
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6884—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids from lung
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/12—Pulmonary diseases
Abstract
The invention provides the application of mycobacterium tuberculosis protein Rv2693c and/or Rv1984c in developing and/or designing products for identification, diagnosis, auxiliary diagnosis, screening and/or auxiliary screening of latent phthisis infection. The invention also provides a protein chip prepared with the two kinds of mycobacterium tuberculosis protein. By the adoption of the protein chip, the levels of IgM antibodies corresponding to the two kinds of protein in serum of latent phthisis infection patients and normal people are detected, the detection results of the corresponding antibodies of the two kinds of protein are analyzed in a combined mode, and whether an inspected person suffers from latent phthisis infection is judged. Detection results show that the specificity of the best operating point of auxiliary diagnosis of latent phthisis infection of the protein chip is 80.3%, sensitivity is 75.6%, and both indexes are higher than those of latent phthisis infection diagnosis in the prior art.
Description
The divisional application that the application is application number is 201310607359.0, the applying date is 2013.11.25, invention and created name is " purposes of Mycobacterium tuberculosis albumen in the product of preparation diagnosis latent tuberculosis infection "
Technical field
The invention belongs to biomedicine field, be specifically related to the purposes of Mycobacterium tuberculosis albumen in the product preparing diagnosis and/or auxiliary diagnosis disease.
Background technology
Since multiple century, tuberculosis continues to become a public health problem that can not be ignored in the whole world.The population in the current whole world existing 1/3rd carries Much's bacillus, and only within 2010 1 year, just increase cases of tuberculosis 8,800,000 newly, dead 1,450,000, on average namely had a people to die from pulmonary tuberculosis less than 22 seconds, tuberculosis is in first of Death of Infectious Diseases number.And China is one of 22 tuberculosis high burden countries in the whole world, tuberculosis patient number is in global second, infected number is more than 500,000,000, only within 2010 1 year, just there are new cases 90 ~ 1,200,000, occupying about 12% of the total new cases in the whole world, as adopted an effective measure not in time, 3,000 ten thousand people's morbidities may be had within Future Ten year, serious public health problem and social concern will be caused, so must realize as early as possible phthisical effective control from national strategy aspect.
Scientific evidence shows, after tuberculosis infection human body, in most of the cases, can be subject to immune control in human body, thus be in a latent infection state, likely be converted into active tuberculosis at any time.Considering global tuberculosis infection population, is even all a very huge numeral in China, and in conjunction with transmissibility lungy and social harm, in healthy population, the examination tuberculosis patient that hides just seems particularly important.Existing research confirms that latent tuberculosis infects (latenttuberc μ losisinfection, LTBI) prophylactic treatment can reduce the risk (BucherHC that HIV/TB double infection crowd progress is activity TB, GriffithLE, GuyattGH, etal:Isoniazidprophylaxisfortuberc μ losisinHIVinfection:ameta-analysisofrandomizedcontrolled trails [J] .AIDS, 1999,13:501-508).But the result of current domestic diagnosis latent infection Main Basis tuberculin skin test (PPD skin test), it is generally acknowledged PPD strong positive or transfers the positive person that is latent tuberculosis infection to from feminine gender in a short time.But because PPD skin test cannot distinguish the immune response and the responsing reaction that produces of latent infection that the BCG inoculation extensively promoted in China produces.And based on the serodiagnosis of antigen-antibody reaction, due to its simplicity, rapidity, be that important latent tuberculosis infects clinical complementary diagnostic means.Therefore, from a long-term perspective, should be devoted to find Sensitivity and Specificity tuberculosis mark all preferably.
Desirable Diagnosis of Tuberculosis mark should meet following condition: (1) susceptibility is high; (2) specificity is high; (3) be present in body fluid, particularly in blood, be easy to detect.But at present Mycobacterium tuberculosis serodiagnosis for antigen as antigen 5,38KD antigen, 30/31KD antigen and antigen 60 etc., all there is positive rate low, with problems such as the cross-immunities of other mycobacterium, although have certain value in the generaI investigation of curative effect monitoring, prompting recurrence, judging prognosis and people at highest risk, what still can not be used for that latent tuberculosis infects at present makes a definite diagnosis.In order to realize the high sensitivity infected latent tuberculosis, the diagnosis of high specific, be badly in need of searching out more responsive, more special latent tuberculosis infection biological mark on a molecular scale.
Summary of the invention
An object of the present invention is to provide the product that detects anti-Rv2693c antibody and/or anti-Rv1984c antibody horizontal in serum and there is in preparation application in the product of discriminatings, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latent tuberculosis infection purposes.
In described application, described Rv2693c is following albumen a) or b):
The protein of the amino acid sequence composition shown in the SEQIDNo.1 a) in sequence table;
B) by the amino acid residue sequence of the SEQIDNo.1 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQIDNo.1 have identical function by a) derivative protein;
Described Rv1984c is following albumen c) or d):
The protein of the amino acid sequence composition shown in the SEQIDNo.2 c) in sequence table;
D) by the amino acid residue sequence of the SEQIDNo.2 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQIDNo.2 have identical function by c) derivative protein;
And/or, described have discriminating, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latent tuberculosis to infect in the product of purposes, comprise the instructions being described below content: compared with normally not suffering from the people of any disease, latent tuberculosis infects in people, and in anti-Rv2693c antibody horizontal and anti-Rv1984c antibody horizontal, at least one significantly raises.
Described antibody is IgM.
Another object of the present invention be to provide a kind of for differentiating, diagnosing, the mark composition that infects of auxiliary diagnosis, examination and/or auxiliary examination latent tuberculosis, be made up of the antibody of anti-Rv2693c and the antibody of anti-Rv1984c;
In described mark composition, antibody described in each is behaved the antibody in vitro serum;
Described antibody is IgM.
Described Rv2693c is following albumen a) or b):
The protein of the amino acid sequence composition shown in the SEQIDNo.1 a) in sequence table;
B) by the amino acid residue sequence of the SEQIDNo.1 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQIDNo.1 have identical function by a) derivative protein;
Described Rv1984c is following albumen c) or d):
The protein of the amino acid sequence composition shown in the SEQIDNo.2 c) in sequence table;
D) by the amino acid residue sequence of the SEQIDNo.2 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQIDNo.2 have identical function by c) derivative protein.
Another object of the present invention is to provide the antibody of the anti-Rv2693c in serum and/or the antibody of anti-Rv1984c and has application in the product of discriminatings, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latent tuberculosis infection purposes as mark in exploitation, design and/or preparation; Described Rv2693c is following albumen a) or b):
The protein of the amino acid sequence composition shown in the SEQIDNo.1 a) in sequence table;
B) by the amino acid residue sequence of the SEQIDNo.1 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQIDNo.1 have identical function by a) derivative protein;
Described Rv1984c is following albumen c) or d):
The protein of the amino acid sequence composition shown in the SEQIDNo.2 c) in sequence table;
D) by the amino acid residue sequence of the SEQIDNo.2 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQIDNo.2 have identical function by c) derivative protein;
Described have discriminating, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latent tuberculosis to infect in the product of purposes, comprise the instructions being described below content: compared with normally not suffering from the people of any disease, latent tuberculosis infects in people, and in anti-Rv2693c antibody horizontal and anti-Rv1984c antibody horizontal, at least one significantly raises.
Described antibody is IgM.
In described arbitrary application, described discriminating, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latent tuberculosis infect and specifically refer to whether discriminating, diagnosis and/or auxiliary diagnosis people to be measured suffer from latent tuberculosis and infect; Or in examination and/or auxiliary examination crowd to be measured, suffer from the situation that latent tuberculosis infects.
Also object of the present invention be to provide a kind of for differentiating, diagnosing, the kit that infects of auxiliary diagnosis, examination and/or auxiliary examination latent tuberculosis, comprise detection chip, described detection chip is connected with at least a kind of albumen in Rv2693c and Rv1984c albumen, often kind of albumen sets up separately a check point; Preferably, described detection chip is connected with Rv2693c and Rv1984c albumen;
Described Rv2693c is following albumen a) or b):
The protein of the amino acid sequence composition shown in the SEQIDNo.1 a) in sequence table;
B) by the amino acid residue sequence of the SEQIDNo.1 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQIDNo.1 have identical function by a) derivative protein;
Described Rv1984c is following albumen c) or d):
The protein of the amino acid sequence composition shown in the SEQIDNo.2 c) in sequence table;
D) by the amino acid residue sequence of the SEQIDNo.2 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQIDNo.2 have identical function by c) derivative protein.
In described kit, described detection chip is made on carrier slide by the solution point sample respectively containing Rv2693c and/or Rv1984c albumen.
In described kit, the described solution respectively containing Rv2693c and/or Rv1984c albumen, by solute and solvent composition, described solute and the concentration in described solution thereof are:
In described solution, also comprise: the NaN that the glycerine that percent by volume is 25%, percent by volume are BSA and 0.1g/L of Tween20,0.05mg/ml of 0.02%
3.
Described point sample specifically adopts biochip point sample instrument point sample; The point sample volume of described point sample is 0.3-1nl; Preferred 0.5-1nl; Most preferably 1nl
What described carrier slide specifically adopted is three-dimensional H carrier slide.
After described point sample terminates, also need the plastics fence sticking 12 holes, and after remaining on and spending the night in 30%RH-40%RH humidity 4 DEG C of environment, slide is positioned in plastic casing and seals-80 DEG C of Cord blood; Preferably, humidity is 35%RH.
Described kit also comprises IgM positive control and/or Cy5 marks anti-human second antibody;
Described kit also comprises instructions, and described instructions is described below content:
Compared with normally not suffering from the people of any disease, latent tuberculosis infects in people, and in anti-Rv2693c antibody horizontal and anti-Rv1984c antibody horizontal, at least one antibody significantly raises.
In described anti-Rv2693c antibody horizontal and anti-Rv1984c antibody horizontal, at least one antibody significantly raises and judges as follows: in the testing result of testing sample, in anti-Rv2693c antibody and/or anti-Rv1984c antibody, has a kind of antibodies positive at least, then judge that this testing sample is that latent tuberculosis infects the positive, otherwise be that latent tuberculosis infects feminine gender;
Be between following value if the criterion of described antibodies positive is the snr value of each antibody, then think this antibodies positive: the snr value of the antibody of Rv2693c is between 2.30 and 2.35, comprises 2.30 and 2.35; The snr value of the antibody of Rv1984c is between 2.24 and 2.38, comprises 2.24 and 2.38.
Described anti-Rv2693c antibody and/or anti-Rv1984c antibody specific are IgM.
The computing formula of described snr value is:
In formula, S and B represents the background value in signal value that in described detection chip, scanner directly shows and non-sample spot region respectively, and σ is then the standard deviation representing this original signal; The experiment number that described σ is corresponding is 3 times; Described S and B value scanner obtains at 635nm Channel scan; Described scanner is GenePix.
In described kit, described kit also comprises the reagent coordinating detection chip to use together, and described reagent comprises following 1)-4):
1) pH7.4PBS solution, it consists of:
2) the PBST solution of pH7.4, it consists of:
3) containing the pH7.4PBS solution of BSA:
4) fluorescently-labeled anti-human second antibody.
Described anti-human second antibody is specially anti-human IgM second antibody.
Last object of the present invention be to provide above-mentioned arbitrary described kit preparation have discriminatings, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latent tuberculosis infection purposes product in application.
Accompanying drawing explanation
Fig. 1 is the silver dye quantitative result figure of 2 prepared antigen protein Rv2693c, Rv1984c.
Fig. 2 is the Western-Blotting qualification result figure of 2 prepared antigen protein Rv2693c, Rv1984c.
Fig. 3 is specificity and the susceptibility statistics figure of the method that application protein-chip auxiliary diagnosis latent tuberculosis infects.
Embodiment
The experimental technique used in following embodiment if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
The preparation of embodiment 1, protein-chip
(1) preparation of Mycobacterium tuberculosis antigen protein Rv2693c, Rv1984c
1, express
Utilize galactose to induce overexpression by the saccharomyces cerevisiae of genetic engineering modified mistake, detailed process is:
First from mycobacterium Much's bacillus (MycobacteriumM.tuberculosis) H37Rv bacterial strain (Beijing Strain), from the beginning cloned by PCR and obtain albumen Rv2693c, the gene code fragment of Rv1984c, by the BP enzyme of Invitrogen company, fragment is connected on pDONR221 carrier (purchased from Invitrogen), be transformed in bacillus coli DH 5-Alpha and increase, extract carrier again by LR enzyme (Invitrogen) change to through transformation the pEGH-A carrier can expressing GST label (this carrier is at " JianZhu, HengZhu, etal:J.Virol.May2009vol.83no.105219-5231 " in be disclosed, the public can obtain from Ti Bikang bio tech ltd, Guangdong), again be transformed in bacillus coli DH 5-Alpha and increase, (this bacterial strain is at document " HengZhu to Pep4 Wine brewing yeast strain to extract Plastid transformation, MichaelSnyder, etal:NatureGenetics26, 283 – 289 (2000) doi:10.1038/81576 " in be disclosed, the public can obtain from Ti Bikang bio tech ltd, Guangdong).Cultivate in inducing culture, when its OD600 is 0.6-0.8, add the galactose that final concentration is 2g/L, induction 6h, 4000rpm collected by centrifugation bacterium ,-80 DEG C of preservations.
The PCR primer sequence used during from the beginning PCR clones is as follows:
The primer pair of the gene code fragment of amplification Rv2693c albumen:
Upstream primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAAACGCTAACCGCACTAGCGCCCA
Downstream primer: GGGGACCACTTTGTACAAGAAAGCTGGGTACTACTCGCGGCCGGCGTCG
The primer pair of the gene code fragment of amplification Rv1984c albumen:
Upstream primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACTCCACGCAGCCTTGTT
Downstream primer: GGGGACCACTTTGTACAAGAAAGCTGGGTATCATCCGGCGTGATCGAG
The component contained in every 1L inducing culture (solvent is water) is as shown in table 1:
Table 1
2, purifying
1), lysate is prepared:
50 μ l mercaptoethanols are added, 125 μ lPMSF and two panels Roche protein inhibitor in 50ml lysate;
2), take out in-80 DEG C of refrigerators above-mentioned steps 1 collect bacterium (cultivating the thalline collected from 120ml inducing culture), add 400 μ l zirconium oxide beads and 400 μ l lysates, shake 30s in 4 DEG C of environment, rearmounted 2min on ice, repeat four times;
3), take out after the centrifugal 2min of 11,000rpm, get supernatant in a new 15ml centrifuge tube;
4), repeat 2 and 3 step four times, supernatant is collected in same centrifuge tube;
5), lysate is added to 1/10 of 12ml and original inducing culture volume, simultaneously with not having the lysate of inhibiting that glutathione beads is cleaned 3 times.The beads of 300 μ l is added in 12ml lysate;
6), add the lysate after beads and hatch 2h in 4 DEG C;
7), get supernatant after 11,000rpm centrifugal 2min and be stored in 4 DEG C.Beads cleaning fluid Ι and cleaning fluid II respectively washes 3 times;
8), add after 300 μ l eluents hatch 15min, centrifuging and taking supernatant is collected in a new centrifuge tube, repeats once.
Namely the eluent obtained is dissolved with this albumen.
The composition of damping fluid (solvent is water) used in above-mentioned purge process is in Table 2-table 5.
Table 2 lysate (1L)
Table 3 cleaning fluid I (1L)
Table 4 cleaning fluid II (1L)
Table 5 eluent (1L)
3, identify
In following experimentation, described solvent or the percentage of liquid are percent by volume.
1), material preparation
Configure the SDS-PAGE glue of two piece 12%, 1.0mm, 15 holes.One piece of silver dye, one piece of WesternBlotting.Get each 20 μ l of the good albumen of above-mentioned purifying, add 4 μ l6XLoadingbuffer, the BSA sample simultaneously preparing specification concentration gradient contaminates quantitative control as silver, boils sample 5min.
2), glue is run
Every hole adds the above-mentioned sample prepared of 12 μ l, BSA gradient sample successively, and 2.5 μMs of arker (Takara) record order.80V30min，140V1h。
3) silver dye operation steps:
Fixing: 30min or longer time 40% ethanol 10% glacial acetic acid add water 250ml
Sensitization: 30min75ml ethanol 30% ethanol 17g sodium acetate 28.2g sodium acetate trihydrate 0.5g sodium thiosulfate (dodium thiosulfate) adds water final volume 250ml
Washing: 3x10min
Silver dye: 20min0.625gAgNO3100 μ l37% formaldehyde (adding before use) adds water final volume 250ml
Washing: 2x1min
Colour developing: the time depends on the circumstances 6.25gNa
2cO
350 μ l37% formaldehyde (adding before use) add water final volume 250ml
Stop: 10min1g glycocoll adds water final volume 250ml
Preserve: 1% glacial acetic acid, 4 DEG C
4) Western-Blotting step:
Transferring film: 15V40min (half-dried turn, Bio-Rad).Transferring film damping fluid: glycocoll 2.9g; Tris5.8g; SDS0.37g; Methyl alcohol 200ml; Add ddH
2o is settled to 1000ml
Close: 5% skim milk (Bio-Rad) 1h.
First antibody is hatched: Anti-GST mouse-anti (NovaGen) final concentration 1 μ g/ml1h
Second antibody is hatched: sheep mouse-anti fluorescence 800 passage (Odyssey) final concentration 1 μ g/ml1h
Odyssey scanner scanning, preserves picture.
Carry out silver dye quantitatively and the result difference of Western-Blotting qualification as depicted in figs. 1 and 2.Fig. 1 result shows that the amount of prepared Rv2693c and Rv1984c albumen is 50 μ g/ml; Fig. 2 result proves, prepared Rv2693c and Rv1984c albumen is correct.
Through order-checking, prepared Rv2693c, Rv1984c albumen has the amino acid sequence shown in SEQ ID No .1-2 respectively successively.
(2) preparation of the protein-chip of pre-some antigen
In the eluate solution of the Rv2693c antigen protein of the 50 μ g/ml containing above-mentioned preparation, add the NaN of BSA and 0.1g/L of Tween20,0.05mg/ml of glycerine that final concentration is 25% (percent by volume), 0.02% (percent by volume)
3.Adopt biochip point sample instrument by above-mentioned mixed liquor point on carrier slide (carrier slide is commercial three-dimensional H carrier slide, purchased from CapitalBio Corporation), often some point sample is about 1nL, 2 parallel points.Adopt biochip point sample instrument (purchased from CapitalBio Corporation) some system.
Above-mentioned Rv2693c antigen protein replaced with Rv1984c antigen protein (being 50 μ g/ml), mark anti-human second antibody (20 μ g/ml) as IgM (1mg/ml) standard items of positive control or Cy5, in mixed liquor other component and final concentration constant, prepare and mark the mixed liquor of anti-human second antibody containing Rv1984c antigen protein, IgM standard items or Cy5 respectively.
With above-mentioned identical spotting methods, will mark the mixed liquor point of anti-human second antibody on above-mentioned identical carrier slide respectively, and form microarray containing Rv1984c albumen, IgM standard items or Cy5, every slide can be put 12 and repeat parallel seal interval.Stick the plastics fence in 12 holes after point sample terminates, and to remain in 35%RH humidity 4 DEG C of environment after 16h, slide is positioned in plastic casing and seals-80 DEG C of Cord blood.
Embodiment 2, application protein-chip auxiliary diagnosis latent tuberculosis infect
(1) preparation of test serum sample
Whole blood sample after room temperature places 2 hours or 4 DEG C are spent the night in 1000g centrifugal about 20 minutes, getting supernatant can detect immediately; Or carry out packing, and sample is put in-20 DEG C or-80 DEG C of preservations, but should multigelation be avoided.4 DEG C thaw after sample should be again centrifugal, then detect.
(2) involved in diagnostic procedure various damping fluid and the preparation of reagent
(1) sample diluting liquid (see table 6): pH7.4PBS solution
Table 6
(2) the PBST solution of cleansing solution (see table 7): pH7.4
Table 7
(3) chip confining liquid (see table 8): containing the pH7.4PBS solution of BSA
Table 8
(4) Cy5 marks the concentrate of anti-human second antibody: use commercially available anti-human IgM-Cy5 fluorescence labeling two to resist, being diluted to concentration is 1mg/ml, is sub-packed in lucifuge tubule.
(3) method that protein-chip auxiliary diagnosis latent tuberculosis infects is applied
The protein-chip using embodiment 1 to prepare can to detect in tested person's blood sample the level of 2 proteantigens Rv2693c, Rv1984c IgM antibody accordingly separately, the testing result of the corresponding antibodies of these 2 protein of Conjoint Analysis, can judge whether tested person is that latent tuberculosis infects.
1, concrete operation step
1) embodiment 1 is made the chip of sealing from-80 DEG C of taking-ups, room temperature rewarming 10 minutes.
2) close: chip is put into sink, adds about 50ml chip confining liquid (see table 8), shaking table 50rpm, room temperature 1h.
3) get rid of liquid unnecessary on chip fast, be placed in wet box.
4) dilution of testing sample and application of sample: by test serum sample by volume the 1:100 sample diluting liquid (see table 6) of above-mentioned preparation dilute, get 30 μ L dilute after the solution containing test serum join in closed fence-enclosing space.Reaction 1h, room temperature.Detected sample is prepared in 15 minutes before use.
5) chip is taken out from wet box, be placed in sink, add the cleansing solution of the above-mentioned preparation of about 50ml, shaking table 50rpm, room temperature 5min, repeat 3 times.
6) get rid of liquid unnecessary on chip fast, be placed in wet box.
7) each enclosure space adds the Cy5 fluorescence anti-human two that 30 μ L have been diluted to final concentration 1 μ g/ml and resists on chip, lucifuge reaction 1h.
8) chip is taken out from wet box, be placed in sink, add the cleansing solution of the above-mentioned preparation of about 50ml, shaking table 50rpm, room temperature 5min, repeat 3 times.Use the ultrapure washing of about 50ml more once, 5min.
9) centrifugal drying, reads data with Genepix scanner under 635nm passage.
2, testing sample is respectively to the judgement of 2 kinds of antigen protein resistances
Be weighed by the signal to noise ratio (S/N ratio) (SNR) of point of sample with Genepix scanner in the result that 635nm Channel scan obtains, signal to noise ratio (S/N ratio) (SNR) computing formula of point of sample is:
In formula, S and B represents signal value (being the numerical value that scanner directly shows) original in chip and background value (signal value in non-sample spot region) respectively, and σ is then the standard deviation (experiment number that σ is corresponding is 3 times) representing this original signal.
The snr value of point of sample on protein-chip and the following signal to noise ratio (S/N ratio) interval (described signal to noise ratio (S/N ratio) interval comprises the endpoints thereof in given signal to noise ratio (S/N ratio) interval) showing 9-table 10 are contrasted, to carry out the positive of testing sample to corresponding antigens resistance, the judgement of negative findings:
Anti-Rv2693c (see table 9):
Table 9
Anti-Rv1984c (see table 10):
Table 10
3, the judgement of testing sample assay
Criterion:
Compared with normally not suffering from the people of any disease, latent tuberculosis infects in people, and in anti-Rv2693c antibody horizontal and anti-Rv1984c antibody horizontal, at least one antibody significantly raises, and is embodied in:
If in the testing result of testing sample, (judge that whether antibody be positive standard: when 2 parallel point of samples of same antigen are all judged to be the positive on protein-chip prepared by embodiment 1, this antibody be the positive to anti-Rv2693c antibody horizontal with having a kind of antibodies positive in anti-Rv1984c antibody at least.), then judge that this testing sample is that latent tuberculosis infects the positive, otherwise be that latent tuberculosis infects feminine gender.
(4) specificity and the susceptibility of the method that protein-chip auxiliary diagnosis latent tuberculosis infects, is applied
(clinical diagnosis is the patient 100 parts that latent tuberculosis infects, Healthy People 100 parts to adopt 200 parts of latent tuberculosis to infect the serum of associated patient; Serum sample is provided by Tubercufosis control center, Guangdong Province, the informed consent obtained all through patient and examinee of serum sample.) specificity and sensitivity Detection have been carried out to the protein-chip of embodiment 1, judge whether person to be measured infects as latent tuberculosis with above-mentioned criterion positive.
Testing result as shown in Figure 3.Horizontal ordinate false positive rate representative (1-specificity) in Fig. 1, ordinate True Positive Rate represents susceptibility.The specificity calculating the best operating point of the protein-chip auxiliary diagnosis latent tuberculosis infection of embodiment 1 according to positive likelihood ratio and susceptibility/(1-specificity) is 80.3%, susceptibility is 75.6%, is all much higher than the index of latent tuberculosis Infect And Diagnose in prior art.
In 100 parts of latent tuberculosis infected patients, 80 parts are detected the positive; In 100 parts of Healthy Peoples, 24 parts are had to be detected the positive.
Claims (9)
1. in detection serum anti-Rv1984c antibody horizontal product preparation have discriminatings, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latent tuberculosis infection purposes product in application.
2. application according to claim 1, is characterized in that:
Described Rv1984c is following albumen c) or d):
The protein of the amino acid sequence composition shown in the SEQIDNo.2 c) in sequence table;
D) by the amino acid residue sequence of the SEQIDNo.2 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQIDNo.2 have identical function by c) derivative protein;
Described have discriminating, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latent tuberculosis to infect in the product of purposes, comprise the instructions being described below content: compared with normally not suffering from the people of any disease, latent tuberculosis infects in people, and anti-Rv1984c antibody horizontal significantly raises.
3. the antibody of the anti-Rv1984c in serum to have the application in the product of discriminatings, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latent tuberculosis infection purposes in exploitation, design and/or preparation as mark;
Described Rv1984c is following albumen c) or d):
The protein of the amino acid sequence composition shown in the SEQIDNo.2 c) in sequence table;
D) by the amino acid residue sequence of the SEQIDNo.2 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQIDNo.2 have identical function by c) derivative protein;
Described have discriminating, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latent tuberculosis to infect in the product of purposes, comprise the instructions being described below content: compared with normally not suffering from the people of any disease, latent tuberculosis infects in people, and anti-Rv1984c antibody horizontal significantly raises.
4. for differentiating, diagnosing, the kit that infects of auxiliary diagnosis, examination and/or auxiliary examination latent tuberculosis, comprise detection chip, described detection chip is connected with Rv1984c albumen, described Rv1984c albumen is a check point;
Described Rv1984c is following albumen c) or d):
The protein of the amino acid sequence composition shown in the SEQIDNo.2 c) in sequence table;
D) by the amino acid residue sequence of the SEQIDNo.2 in sequence table through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and with albumen shown in SEQIDNo.2 have identical function by c) derivative protein.
5. kit according to claim 6, is characterized in that: described detection chip is made on carrier slide by the solution point sample containing Rv1984c albumen.
6. the kit according to claim 4 or 5, is characterized in that: described kit also comprises instructions, and described instructions is described below content:
Compared with normally not suffering from the people of any disease, latent tuberculosis infects in people, and anti-Rv1984c antibody horizontal significantly raises.
7. kit according to claim 6, is characterized in that:
Described anti-Rv1984c antibody horizontal significantly raises and judges as follows: in the testing result of testing sample, anti-Rv1984c antibodies positive, then judge that this testing sample is that latent tuberculosis infects the positive, otherwise be that latent tuberculosis infects feminine gender;
Be between following value if the criterion of described antibodies positive is the snr value of the antibody of Rv1984c, then think this antibodies positive: the snr value of the antibody of Rv1984c is between 2.24 and 2.38, comprises 2.24 and 2.38.
8. the kit according to claim 4 or 5, is characterized in that: described kit also comprises the reagent coordinating detection chip to use together, and described reagent comprises following 1)-4):
1) pH7.4PBS solution, it consists of:
2) the PBST solution of pH7.4, it consists of:
3) containing the pH7.4PBS solution of BSA:
4) fluorescently-labeled anti-human second antibody.
9. the arbitrary described kit of claim 4-8 preparation have discriminatings, diagnosis, auxiliary diagnosis, examination and/or auxiliary examination latent tuberculosis infection purposes product in application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510719057.1A CN105388297B (en) | 2013-11-25 | 2013-11-25 | Purposes of the Mycobacterium tuberculosis albumen Rv1984c in the product for preparing diagnosis latent tuberculosis infection |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310607359.0A CN103698511B (en) | 2013-11-25 | 2013-11-25 | The purposes of Mycobacterium tuberculosis albumen in the product of preparation diagnosis latent tuberculosis infection |
| CN201510719057.1A CN105388297B (en) | 2013-11-25 | 2013-11-25 | Purposes of the Mycobacterium tuberculosis albumen Rv1984c in the product for preparing diagnosis latent tuberculosis infection |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310607359.0A Division CN103698511B (en) | 2013-11-25 | 2013-11-25 | The purposes of Mycobacterium tuberculosis albumen in the product of preparation diagnosis latent tuberculosis infection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105388297A true CN105388297A (en) | 2016-03-09 |
| CN105388297B CN105388297B (en) | 2017-06-06 |
Family
ID=50360110
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510719057.1A Active CN105388297B (en) | 2013-11-25 | 2013-11-25 | Purposes of the Mycobacterium tuberculosis albumen Rv1984c in the product for preparing diagnosis latent tuberculosis infection |
| CN201310607359.0A Active CN103698511B (en) | 2013-11-25 | 2013-11-25 | The purposes of Mycobacterium tuberculosis albumen in the product of preparation diagnosis latent tuberculosis infection |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310607359.0A Active CN103698511B (en) | 2013-11-25 | 2013-11-25 | The purposes of Mycobacterium tuberculosis albumen in the product of preparation diagnosis latent tuberculosis infection |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN105388297B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111521819A (en) * | 2016-12-30 | 2020-08-11 | 首都医科大学附属北京胸科医院 | Application of mycobacterium tuberculosis protein in preparing product for diagnosing latent tuberculosis infected person and/or active tuberculosis |
| CN111551742A (en) * | 2016-12-30 | 2020-08-18 | 首都医科大学附属北京胸科医院 | Application of mycobacterium tuberculosis protein in preparing product for diagnosing latent tuberculosis infected person and/or active tuberculosis |
| CN112630447A (en) * | 2020-12-20 | 2021-04-09 | 中国医学科学院病原生物学研究所 | Glutathione used for identification and diagnosis of active tuberculosis |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107202882B (en) * | 2016-03-17 | 2019-02-22 | 广东体必康生物科技有限公司 | Purposes of the Rv0440 albumen in diagnosis latency/active tuberculosis |
| CN109406777B (en) * | 2017-08-18 | 2022-02-18 | 中国科学院生物物理研究所 | Protein Rv2824c for specific detection of mycobacterium tuberculosis infection |
| CN108226535A (en) * | 2018-01-19 | 2018-06-29 | 中国人民解放军第三〇九医院 | Application of the system of detection adhesion molecule and cytokine content in retreat tuberculosis patient outcomes are detected |
| CN110724182B (en) * | 2019-11-15 | 2022-04-08 | 上海交通大学 | Marker combination for improving detection sensitivity of bacterial scrotum infection and application thereof |
| CN111157745A (en) * | 2020-01-17 | 2020-05-15 | 上海交通大学 | Application of human SNRPA protein in lung cancer recurrence or metastasis monitoring |
| CN114152746A (en) * | 2021-08-27 | 2022-03-08 | 江西省胸科医院 | Use of Rv1860 protein, Rv3881c protein, Rv2031c protein and Rv3803c protein in the diagnosis of active tuberculosis infection |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101492497A (en) * | 2008-01-21 | 2009-07-29 | 范雄林 | Expression purification process for tubercle bacillus differential recombinant protein and uses thereof |
| CN101638430A (en) * | 2009-07-10 | 2010-02-03 | 郑州大学 | Anti-tuberculosis CTL epitope peptide |
| WO2012057904A1 (en) * | 2010-10-27 | 2012-05-03 | Infectious Disease Research Institute | Mycobacterium tuberculosis antigens and combinations thereof having high seroreactivity |
| WO2012164088A1 (en) * | 2011-06-03 | 2012-12-06 | Universite Montpellier 2 Sciences Et Techniques | Diagnosis method of active tuberculosis |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030236393A1 (en) * | 2002-03-22 | 2003-12-25 | United States Of America Dept Of Vetrans Affairs | Virulence genes of M. marinum and M. tuberculosis |
-
2013
- 2013-11-25 CN CN201510719057.1A patent/CN105388297B/en active Active
- 2013-11-25 CN CN201310607359.0A patent/CN103698511B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101492497A (en) * | 2008-01-21 | 2009-07-29 | 范雄林 | Expression purification process for tubercle bacillus differential recombinant protein and uses thereof |
| CN101638430A (en) * | 2009-07-10 | 2010-02-03 | 郑州大学 | Anti-tuberculosis CTL epitope peptide |
| WO2012057904A1 (en) * | 2010-10-27 | 2012-05-03 | Infectious Disease Research Institute | Mycobacterium tuberculosis antigens and combinations thereof having high seroreactivity |
| WO2012164088A1 (en) * | 2011-06-03 | 2012-12-06 | Universite Montpellier 2 Sciences Et Techniques | Diagnosis method of active tuberculosis |
Non-Patent Citations (2)
| Title |
|---|
| BELINDA BRUST，ET AL: "Mycobacterium tuberculosis Lipolytic Enzymes as Potential Biomarkers for the Diagnosis of Active Tuberculosis", 《PLOS ONE》 * |
| SHAJO KUNNATH-VELAYUDHAN，ET AL: "Dynamic antibody responses to the Mycobacterium", 《PNAS》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111521819A (en) * | 2016-12-30 | 2020-08-11 | 首都医科大学附属北京胸科医院 | Application of mycobacterium tuberculosis protein in preparing product for diagnosing latent tuberculosis infected person and/or active tuberculosis |
| CN111551741A (en) * | 2016-12-30 | 2020-08-18 | 首都医科大学附属北京胸科医院 | Application of mycobacterium tuberculosis protein in preparing product for diagnosing latent tuberculosis infected person and/or active tuberculosis |
| CN111551742A (en) * | 2016-12-30 | 2020-08-18 | 首都医科大学附属北京胸科医院 | Application of mycobacterium tuberculosis protein in preparing product for diagnosing latent tuberculosis infected person and/or active tuberculosis |
| CN111551741B (en) * | 2016-12-30 | 2023-06-16 | 首都医科大学附属北京胸科医院 | Use of mycobacterium tuberculosis proteins in the preparation of a product for diagnosing tuberculosis latency infected persons and/or active tuberculosis |
| CN112630447A (en) * | 2020-12-20 | 2021-04-09 | 中国医学科学院病原生物学研究所 | Glutathione used for identification and diagnosis of active tuberculosis |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105388297B (en) | 2017-06-06 |
| CN103698511B (en) | 2016-01-27 |
| CN103698511A (en) | 2014-04-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103698511B (en) | The purposes of Mycobacterium tuberculosis albumen in the product of preparation diagnosis latent tuberculosis infection | |
| CN103698512B (en) | The purposes of Mycobacterium tuberculosis albumen in the product of preparation diagnosis latent tuberculosis infection | |
| Muma et al. | Evaluation of three serological tests for brucellosis in naturally infected cattle using latent class analysis | |
| Mat Jusoh et al. | Performance evaluation of commercial dengue diagnostic tests for early detection of dengue in clinical samples | |
| Chirathaworn et al. | Detection of Leptospira in urine using anti-Leptospira-coated gold nanoparticles | |
| CN105572353A (en) | Antibody chip reagent kit for detecting hepatoma marker | |
| CN104330575A (en) | Troponin I detection reagent and preparation method thereof | |
| CN104020297A (en) | Kit for detecting mycobacterium tuberculosis infection and monitoring clinical treatment effect and application of kit | |
| CN103698531B (en) | The purposes of Rv1860, Rv0173 and/or Rv1812c albumen in the phthisical product of preparation diagnostic activities | |
| CN103760345B (en) | A kind of kit and application thereof utilizing peripheral blood detection m tuberculosis infection | |
| CN110726846A (en) | Application of HBP protein as diagnostic marker of Kawasaki disease | |
| CN106191286A (en) | Brucellar detection method, test kit and application thereof | |
| CN103675293B (en) | The purposes of Rv3872, Rv0164 and/or Rv1926c albumen in the phthisical product of preparation diagnostic activities | |
| CN103698530B (en) | The purposes of Mycobacterium tuberculosis albumen in the phthisical product of preparation diagnostic activities | |
| CN105424941A (en) | AKR1B10 protein and reagent kit for liver cirrhosis diagnosis | |
| CN103675292B (en) | The purposes of Rv0174, Rv1729c and/or Rv3835 albumen in the phthisical product of preparation diagnostic activities | |
| CN102590502B (en) | Kit for auxiliary diagnosis of tuberculosis patients | |
| CN107202882B (en) | Purposes of the Rv0440 albumen in diagnosis latency/active tuberculosis | |
| CN105622735B (en) | One group of mycobacterium tuberculosis protein and its encoding gene and application | |
| Song et al. | Analytical and clinical performance of a new point of care LABGEOIB D-dimer test for diagnosis of venous thromboembolism | |
| CN107202894B (en) | Purposes of the Rv1078 albumen in diagnosis latency/active tuberculosis | |
| CN105671188A (en) | Molecular marker and primer set for diagnosing Mycobacterium tuberculosis infection, and application thereof | |
| Neesgaard et al. | Determination of anti-HCV and quantification of HCV-RNA and IP-10 from dried blood spots sent by regular mail | |
| CN103149356B (en) | A kind of Test paper card utilizing sandwich method to detect Brucella abortus antigen | |
| Johnson | Screening for gastrointestinal and pancreatic diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200819 Address after: 4 / F, building a, China Europe center, No.2 South Lingnan Avenue, Lecong Town, Shunde District, Foshan City, Guangdong Province 528300 Patentee after: GUANGZHOU BCBIO BIOTECHNOLOGY Co.,Ltd. Address before: 1 No. 528000 Guangdong city of Foshan province Foshan City Hing Road Patentee before: TB Healthcare Co.,Ltd. |