CN105385706A - Eukaryotic expression method of sea cucumber cathepsin - Google Patents
Eukaryotic expression method of sea cucumber cathepsin Download PDFInfo
- Publication number
- CN105385706A CN105385706A CN201510919334.3A CN201510919334A CN105385706A CN 105385706 A CN105385706 A CN 105385706A CN 201510919334 A CN201510919334 A CN 201510919334A CN 105385706 A CN105385706 A CN 105385706A
- Authority
- CN
- China
- Prior art keywords
- sequence
- sea cucumber
- gene
- expression
- kethepsin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an eukaryotic expression method of sea cucumber cathepsin. The method comprises the following steps: screening a cathepsin gene EST sequence on the basis of an Apostichopus japonicus transcriptome database obtained through early stage working according to a bioinformatics analysis result; acquiring gene full-length sequence information by adopting an RACE full-length cloning technology on the basis of a fragment sequence; predicating and analyzing the structure characters and function activity of an encoded protein according to the full-length sequence information, and searching and determining a key structural domain; determining a gene sequence fragrance accessed to an expression system according to the predication and analysis result; constructing a Pichia pastoris eukaryotic expression system, and expressing a target protein in vitro; and detecting and explicating the activity and function characters of the protease obtained after expression. The sea cucumber protease expressed through the method has the characteristics of low production cost, easy quality control, increase of the selectable kinds of collagen proteolysis proteases, increase of the enzymatic hydrolysis production benefit, and important economic and social values.
Description
Technical field
The present invention relates to bio protease preparation field, particularly relate to a kind of eukaryon expression of sea cucumber kethepsin.
Background technology
Virgin rubber albumen is the structural protein of body tissue, and its many physiological function is by systematic study and extensively accreditation.Along with the fast development of collagen protein industry, the demand of the crucial production factors-proteolytic enzyme in collagen protein enzymolysis technique also constantly increases.The shortcoming that enzyme classes ubiquity collagen protein enzymolysis efficiency comparatively conventional is at present not high, and use genetic engineering technique development of new Collagenase can make up this critical defect, and the Collagenase product quality adopting biotechnology to produce easily is controlled, low production cost.Stichopus japonicus has extremely strong self-dissolving ability, and namely study carefully its essence be the efficient enzymolysis of histocyte endoproteinase to body wall tissue albumen (being mainly collagen protein).But, about the screening of stichopus japonicus cathepsin gene, functional study and the exploitation of associated protein enzyme product but not yet system carry out.
Summary of the invention
Another technical problem to be solved by this invention is to provide a kind of eukaryon expression of sea cucumber kethepsin, the sea cucumber proteolytic enzyme of being expressed by the method has the features such as production cost is low, quality is easily controlled, the optional kind of Collagenase proteolytic enzyme will be increased, improve enzymolysis productivity effect, there is important economy and social value.
Technical problem to be solved by this invention is to provide a kind of sea cucumber kethepsin, and this proteolytic enzyme has the features such as production cost is low, quality is easily controlled.
The technical scheme that the present invention solves the problems of the technologies described above is as follows: a kind of eukaryon expression of sea cucumber kethepsin, comprises the following steps:
(1) screen cathepsin gene est sequence, based on the fragment sequence filtered out, adopt RACE full-length clone method to obtain full length gene sequence information;
(2) by full length sequence information prediction analysis of encoding protein structure feature and functionally active, search and determine key structure territory;
(3) according to predictive analysis results, the gene order fragment accessing expression system is determined; Build the eukaryotic expression system of Host Strains, vivoexpression target protein; Detect and illustrate the protease activity functional character of expressing and obtaining.
A kind of sea cucumber kethepsin, prepared by the eukaryon expression according to above-mentioned a kind of sea cucumber kethepsin, wherein the nucleotide sequence of sea cucumber kethepsin is as shown in SEQID:NO.1.
Nucleotide sequence SEQID:NO.1 is as follows:
CCAGACACTGTTGATTGGAGACCAAAGGGTTACGTCACTGGGGTCAAAGATCAGAAACAATGCGGATCCTGCTGGGCATTCAGCACCACTGGGTCACTTGAAGGTCAGATGTTCAACAAGACTGGTATGCTGGTCAGCTTGAGCGAACAGAATCTCGTCGACTGCTCTCGTAAGGAGGGTAACATGGGTTGCCAAGGGGGGCTTATGGACGACGCCTTTCAATATGTCATTGATAACGGAGGTCTTGACACCGAGGATTGTTACCCGTACAAAGCCGTGCAAGGAACTTGCATGTACAAGTCGAGCTGCAACTCTGCTGATGTTGTCAAGTTCAACGATATTCCAACTGGTAACGAGATGGCACTTCAACAAGCTGTGGCTACCGTAGGACCTGTTTCTGTCGCCATAGACGCTGCTCTCAGTTCGTTCCATATGTACCATAGCGGTGTTTACGATGACTCAATGTGCCGCAGCGACAGACAGCACTTGGATCACGGTGTGCTGGCGGTAGGTTACGGAACCATGGACGGGAAAGATTACTGGCTCGTTAAGAACAGCTGGGGCATGAGCTGGGGTGACCAGGGGTACATCATGATGTCTCGTAACAAGAACAACCAGTGTGGTATTGCAACTGCCGCCAGTTACCCAACTGTC
The invention has the beneficial effects as follows: the sea cucumber proteolytic enzyme of being expressed by the method has the features such as production cost is low, quality is easily controlled, and will increase the optional kind of Collagenase proteolytic enzyme, improve enzymolysis productivity effect, there is important economy and social value.
On the basis of technique scheme, the present invention can also do following improvement:
Further, specifically comprise the steps: in step (1)
According to acquired stichopus japonicus cathepsin gene est sequence fragment, design specificity full-length clone primer, RACE technology amplification gene fragment is adopted to obtain the full length cDNA sequence of functional gene, by the exactness of the initial analysis cDNA sequence such as NCBI website and protein translation software.
Further, specifically comprise the steps: in step (2)
Search the open reading frame determining stichopus japonicus cathepsin gene full length sequence, determine encoding sequence and infer the aminoacid sequence of proteins encoded, adopt the structural information such as PDBSUM database forecast analysis Protein secondary structure, disulfide linkage, ligand binding site, PROCAT database forecast analysis avtive spot three-dimensional structure, the structural analysis of NRL-3D database similar protein, SMART protein structure functional domain analyses etc., preliminary elaboration gene coded protein constitutional features, specifies structural domain position.
Further, specifically comprise the steps: in step (3)
According to acquired full-length gene order open reading frame information sequence information, design the Auele Specific Primer with HindIII and EcoR I restriction enzyme site, with stichopus japonicus body wall cDNA for masterplate, amplification obtains target sequence; Get extension increasing sequence to be cloned in pMD18-T carrier, after obtaining the carrier with target clone, adopt HindIII and EcoR I double digestion, obtain target and clone and be connected in carrier for expression of eukaryon, be transformed in expressive host bacterium afterwards, secreting, expressing target protein.
Further, DNA fragmentation clone is carried out with TA cloning process in described step (1):
1) in Eppendorf tube, prepare following DNA solution, full dose is 5 μ l;
Using amount of reagent:
18-TSimpleVector*1：1μl；
InsertDNA*3：0.1pmol～0.3pmol；
dH2O：upto5μl；
2) to step 1) in add the SolutionI of 5 μ l, in 16 DEG C, react 30min;
3) by step 2) in the solution that obtains be added in 100 μ lDH5 α competent cells, place 30 minutes in ice;
4) by step 3) in the solution that obtains 42 DEG C of 45 seconds of heating;
5) by step 4) in the solution that obtains in ice, place 1 minute;
6) to step 5) in the solution that obtains add 800 μ lLB substratum, 37 DEG C of shaking culture 60 minutes;
7) in step 6) in get in the solution that obtains on LB-Agar Plating that 100 μ l bacterium liquid are applied to containing Amp and cultivate, form single bacterium colony;
8) in step 7) in select mono-clonal in single bacterium colony of obtaining, cultivate with the LB-liquid nutrient medium containing Amp and send order-checking company to carry out DNA sequence dna and detect analysis.
Further, described carrier for expression of eukaryon is pPIC9K carrier; Described Host Strains is Pichiapastoris expression strain.
Embodiment
Be described principle of the present invention and feature below in conjunction with specific embodiment, example, only for explaining the present invention, is not intended to limit scope of the present invention.
Embodiment 1
An eukaryon expression for sea cucumber kethepsin, comprises and is cloned in carrier for expression of eukaryon by the nucleotide sequence of sea cucumber kethepsin, transformed host cell, and carry out the preparation process induced and express, concrete steps are as follows:
(1) stichopus japonicus cathepsin gene full-length clone
According to acquired stichopus japonicus cathepsin gene est sequence fragment, design specificity full-length clone primer, RACE technology amplification gene fragment is adopted to obtain the full length cDNA sequence of functional gene, by the exactness of the initial analysis cDNA sequence such as NCBI website and protein translation software.
(2) predicted protein structural analysis determine the gene fragment of eukaryotic expression
Search the open reading frame determining stichopus japonicus cathepsin gene full length sequence, determine encoding sequence and infer the aminoacid sequence of proteins encoded, adopt the structural information such as PDBSUM database forecast analysis Protein secondary structure, disulfide linkage, ligand binding site, PROCAT database forecast analysis avtive spot three-dimensional structure, the structural analysis of NRL-3D database similar protein, SMART protein structure functional domain analyses etc., preliminary elaboration gene coded protein constitutional features, specifies structural domain position.
Determined target gene fragment sequence is: SEQID:NO.1.
Nucleotide sequence SEQID:NO.1 is as follows:
CCAGACACTGTTGATTGGAGACCAAAGGGTTACGTCACTGGGGTCAAAGATCAGAAACAATGCGGATCCTGCTGGGCATTCAGCACCACTGGGTCACTTGAAGGTCAGATGTTCAACAAGACTGGTATGCTGGTCAGCTTGAGCGAACAGAATCTCGTCGACTGCTCTCGTAAGGAGGGTAACATGGGTTGCCAAGGGGGGCTTATGGACGACGCCTTTCAATATGTCATTGATAACGGAGGTCTTGACACCGAGGATTGTTACCCGTACAAAGCCGTGCAAGGAACTTGCATGTACAAGTCGAGCTGCAACTCTGCTGATGTTGTCAAGTTCAACGATATTCCAACTGGTAACGAGATGGCACTTCAACAAGCTGTGGCTACCGTAGGACCTGTTTCTGTCGCCATAGACGCTGCTCTCAGTTCGTTCCATATGTACCATAGCGGTGTTTACGATGACTCAATGTGCCGCAGCGACAGACAGCACTTGGATCACGGTGTGCTGGCGGTAGGTTACGGAACCATGGACGGGAAAGATTACTGGCTCGTTAAGAACAGCTGGGGCATGAGCTGGGGTGACCAGGGGTACATCATGATGTCTCGTAACAAGAACAACCAGTGTGGTATTGCAACTGCCGCCAGTTACCCAACTGTC
(3) pPIC9K carrier pichia spp eukaryotic expression
According to acquired full-length gene order open reading frame information sequence information, design the Auele Specific Primer with HindIII and EcoR I restriction enzyme site, with stichopus japonicus body wall cDNA for masterplate, amplification obtains target sequence; Getting extension increasing sequence is cloned in pMD18-T carrier, after obtaining the carrier with target clone, adopt HindIII and EcoR I double digestion, obtain target and clone and be connected to pPIC9K carrier, be transformed in expressive host bacterium-pichia spp afterwards, secreting, expressing target protein.
Wherein, DNA fragmentation clone is carried out with TA cloning process in described step (1):
1) in Eppendorf tube, prepare following DNA solution, full dose is 5 μ l;
Using amount of reagent:
18-TSimpleVector*1：1μl；
InsertDNA*3：0.1pmol～0.3pmol；
dH2O：upto5μl；
2) to step 1) in add the SolutionI of 5 μ l, in 16 DEG C, react 30min;
3) by step 2) in the solution that obtains be added in 100 μ lDH5 α competent cells, place 30 minutes in ice;
4) by step 3) in the solution that obtains 42 DEG C of 45 seconds of heating;
5) by step 4) in the solution that obtains in ice, place 1 minute;
6) to step 5) in the solution that obtains add 800 μ lLB substratum, 37 DEG C of shaking culture 60 minutes;
7) in step 6) in get in the solution that obtains on LB-Agar Plating that 100 μ l bacterium liquid are applied to containing Amp and cultivate, form single bacterium colony;
8) in step 7) in select mono-clonal in single bacterium colony of obtaining, cultivate with the LB-liquid nutrient medium containing Amp and send order-checking company to carry out DNA sequence dna and detect analysis.
The foregoing is only preferred embodiment of the present invention, not in order to limit the present invention, within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.
Claims (7)
1. an eukaryon expression for sea cucumber kethepsin, is characterized in that, comprises the following steps:
(1) screen cathepsin gene est sequence, based on the fragment sequence filtered out, adopt RACE full-length clone method to obtain full length gene sequence information;
(2) by full length sequence information prediction analysis of encoding protein structure feature and functionally active, search and determine key structure territory;
(3) according to predictive analysis results, the gene order fragment accessing expression system is determined; Build the eukaryotic expression system of Host Strains, vivoexpression target protein; Detect and illustrate the protease activity functional character of expressing and obtaining.
2. the eukaryon expression of a kind of sea cucumber kethepsin according to claim 1, it is characterized in that, step specifically comprises the steps: in (1)
According to acquired stichopus japonicus cathepsin gene est sequence fragment, design specificity full-length clone primer, RACE technology amplification gene fragment is adopted to obtain the full length cDNA sequence of functional gene, by the exactness of the initial analysis cDNA sequence such as NCBI website and protein translation software.
3. the eukaryon expression of a kind of sea cucumber kethepsin according to claim 1, it is characterized in that, step specifically comprises the steps: in (2)
Search the open reading frame determining stichopus japonicus cathepsin gene full length sequence, determine encoding sequence and infer the aminoacid sequence of proteins encoded, adopt the structural information such as PDBSUM database forecast analysis Protein secondary structure, disulfide linkage, ligand binding site, PROCAT database forecast analysis avtive spot three-dimensional structure, the structural analysis of NRL-3D database similar protein, SMART protein structure functional domain analyses etc., preliminary elaboration gene coded protein constitutional features, specifies structural domain position.
4. the eukaryon expression of a kind of sea cucumber kethepsin according to claim 1, it is characterized in that, step specifically comprises the steps: in (3)
According to acquired full-length gene order open reading frame information sequence information, design the Auele Specific Primer with HindIII and EcoR I restriction enzyme site, with stichopus japonicus body wall cDNA for masterplate, amplification obtains target sequence; Get extension increasing sequence to be cloned in pMD18-T carrier, after obtaining the carrier with target clone, adopt HindIII and EcoR I double digestion, obtain target and clone and be connected in carrier for expression of eukaryon, be transformed in expressive host bacterium afterwards, secreting, expressing target protein.
5. the eukaryon expression of a kind of sea cucumber kethepsin according to claim 1, is characterized in that, carries out DNA fragmentation clone with TA cloning process in described step (1), described TA cloning process comprises the steps:
1) in Eppendorf tube, prepare following DNA solution, full dose is 5 μ l;
Using amount of reagent:
18-TSimpleVector*1：1μl；
InsertDNA*3：0.1pmol～0.3pmol；
dH2O：upto5μl；
2) to step 1) in add the SolutionI of 5 μ l, in 16 DEG C, react 30min;
3) by step 2) in the solution that obtains be added in 100 μ lDH5 α competent cells, place 30 minutes in ice;
4) by step 3) in the solution that obtains 42 DEG C of 45 seconds of heating;
5) by step 4) in the solution that obtains in ice, place 1 minute;
6) to step 5) in the solution that obtains add 800 μ lLB substratum, 37 DEG C of shaking culture 60 minutes;
7) in step 6) in get in the solution that obtains on LB-Agar Plating that 100 μ l bacterium liquid are applied to containing Amp and cultivate, form single bacterium colony;
8) in step 7) in select mono-clonal in single bacterium colony of obtaining, cultivate with the LB-liquid nutrient medium containing Amp and send order-checking company to carry out DNA sequence dna and detect analysis.
6. the eukaryon expression of a kind of sea cucumber kethepsin according to claim 4, it is characterized in that, described carrier for expression of eukaryon is pPIC9K carrier; Described Host Strains is Pichiapastoris expression strain.
7. a sea cucumber kethepsin, is characterized in that, a kind of eukaryon expression preparation of sea cucumber kethepsin according to any one of claim 1 to 5, wherein the nucleotide sequence of sea cucumber kethepsin is as shown in SEQID:NO.1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510919334.3A CN105385706A (en) | 2015-12-11 | 2015-12-11 | Eukaryotic expression method of sea cucumber cathepsin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510919334.3A CN105385706A (en) | 2015-12-11 | 2015-12-11 | Eukaryotic expression method of sea cucumber cathepsin |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105385706A true CN105385706A (en) | 2016-03-09 |
Family
ID=55418485
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510919334.3A Pending CN105385706A (en) | 2015-12-11 | 2015-12-11 | Eukaryotic expression method of sea cucumber cathepsin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105385706A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107577922A (en) * | 2017-09-20 | 2018-01-12 | 吉林大学 | A kind of corn lncRNA sifting sort methods based on arm processor |
| CN116072227A (en) * | 2023-03-07 | 2023-05-05 | 中国海洋大学 | Marine nutrient biosynthesis pathway excavation method, apparatus, device and medium |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104845957A (en) * | 2015-05-11 | 2015-08-19 | 浙江海洋学院 | Prokaryotic expression method for sea cucumber cathepsin |
-
2015
- 2015-12-11 CN CN201510919334.3A patent/CN105385706A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104845957A (en) * | 2015-05-11 | 2015-08-19 | 浙江海洋学院 | Prokaryotic expression method for sea cucumber cathepsin |
Non-Patent Citations (2)
| Title |
|---|
| XIANHONG YU ET AL.: "High-level expression and characterization of carboxypeptidase Y from Saccharomyces cerevisiae in Pichia pastoris GS115", 《BIOTECHNOL LETT》 * |
| 王清路等: "巴斯德毕赤酵母表达系统的特点及应用", 《生物技术通讯》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107577922A (en) * | 2017-09-20 | 2018-01-12 | 吉林大学 | A kind of corn lncRNA sifting sort methods based on arm processor |
| CN107577922B (en) * | 2017-09-20 | 2020-07-03 | 吉林大学 | ARM processor-based corn lncRNA screening and classifying method |
| CN116072227A (en) * | 2023-03-07 | 2023-05-05 | 中国海洋大学 | Marine nutrient biosynthesis pathway excavation method, apparatus, device and medium |
| CN116072227B (en) * | 2023-03-07 | 2023-06-20 | 中国海洋大学 | Marine nutrient biosynthesis pathway excavation method, apparatus, device and medium |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sun et al. | A novel aspartic protease from Rhizomucor miehei expressed in Pichia pastoris and its application on meat tenderization and preparation of turtle peptides | |
| Melani et al. | Mapping proteoforms and protein complexes from king cobra venom using both denaturing and native top-down proteomics | |
| Henche et al. | Structure and function of the adhesive type IV pilus of S ulfolobus acidocaldarius | |
| Rivera-Hoyos et al. | Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris | |
| Meng et al. | Identification of a novel repressor encoded by the putative gene ctf1 for cellulase biosynthesis in Trichoderma reesei through artificial zinc finger engineering | |
| Buchetics et al. | Reverse engineering of protein secretion by uncoupling of cell cycle phases from growth | |
| WO2000047750B1 (en) | Metalloproteases of the neprilysin family | |
| Pessoa et al. | Metagenomic alkaline protease from mangrove sediment | |
| He et al. | New strategy for expression of recombinant hydroxylated human collagen α1 (III) chains in P ichia pastoris GS 115 | |
| Wang et al. | High-level expression of endo-β-N-acetylglucosaminidase H from Streptomyces plicatus in Pichia pastoris and its application for the deglycosylation of glycoproteins | |
| Che et al. | An effective combination of codon optimization, gene dosage, and process optimization for high-level production of fibrinolytic enzyme in Komagataella phaffii (Pichia pastoris) | |
| Kumar et al. | In-vitro refolding and characterization of recombinant laccase (CotA) from Bacillus pumilus MK001 and its potential for phenolics degradation | |
| Cayrol et al. | Three wall-associated kinases required for rice basal immunity form protein complexes in the plasma membrane | |
| Zhong et al. | Expression and secretion of the human erythropoietin using an optimized cbh1 promoter and the native CBH I signal sequence in the industrial fungus Trichoderma reesei | |
| CN105385706A (en) | Eukaryotic expression method of sea cucumber cathepsin | |
| Šnajder et al. | Codon optimisation is key for pernisine expression in Escherichia coli | |
| Bracke et al. | Exploring three different expression systems for recombinant expression of globins: Escherichia coli, Pichia pastoris and Spodoptera frugiperda | |
| Guo et al. | Overproduction, purification, and property analysis of an extracellular recombinant fructosyltransferase | |
| Nevalainen et al. | Overview of gene expression using filamentous fungi | |
| Jiang et al. | Genetic engineering for enhanced production of a novel alkaline protease BSP-1 in Bacillus amyloliquefaciens | |
| Li et al. | Cloning, expression and characterization of the serine protease gene from Chaetomium thermophilum | |
| Revuelta et al. | Extensive expansion of A1 family aspartic proteinases in fungi revealed by evolutionary analyses of 107 complete eukaryotic proteomes | |
| CN106701813A (en) | Expression vector as well as construction method and application thereof | |
| Sánchez-Mir et al. | Biological significance of nuclear localization of mitogen-activated protein kinase Pmk1 in fission yeast | |
| Heitzer et al. | An extracellular matrix-localized metalloproteinase with an exceptional QEXXH metal binding site prefers copper for catalytic activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160309 |