CN105372307A - Preparation method and application of electrode for detecting transgenic CaMV35S promoter - Google Patents
Preparation method and application of electrode for detecting transgenic CaMV35S promoter Download PDFInfo
- Publication number
- CN105372307A CN105372307A CN201510848286.3A CN201510848286A CN105372307A CN 105372307 A CN105372307 A CN 105372307A CN 201510848286 A CN201510848286 A CN 201510848286A CN 105372307 A CN105372307 A CN 105372307A
- Authority
- CN
- China
- Prior art keywords
- electrode
- rgo
- cdte
- probe
- ito
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Abstract
The invention provides a preparation method and application of an electrode for detecting a transgenic CaMV35S promoter. The method includes the steps of: preparation of a reduced graphene oxide / gold nanocomposite RGO / Au; preparation of a silicon @ cadmium telluride nanocomposite Si@CdTe; preparation of a probe 1 (Probe 1) on an ITO electrode; modification of a target DNA (t-DNA) CaMV 35S promoter onto the probe 1 (Probe 1); and modification of a probe 2 (Probe2) onto the target DNA (t-DNA) CaMV 35S promoter. Through dual signal amplification at both ends of rGO / Au NPs and Si@CdTe, the sensitive detection of the transgenic CaMV35S promoter is realized; and in the concentration range of 0.05-100 pM, the concentration of CaMV35S and photocurrent present good linear relationship, and the detection limit can reach 0.017 pM.
Description
Technical field
The present invention relates to the preparation field of galvanochemistry electrode, specifically refer to a kind of Preparation method and use detecting the electrode of transgenosis CaMV35S promoter.
Background technology
Genetically modified crops (GeneticallyModifiedCrops, be called for short GMC) refer to and utilize biotechnology, inserted in Plant Genome from the biosomes such as animal, plant or microorganism through the genes of interest of qualification, separation, change its genetic constitution, produce the plant of new economical character.Since the first commercialization of transgene tomato in 1994 in the U.S., biotechnology is widely used in modern agriculture.The existing kind more than 100 of genetically modified organism of current whole world approval commercial growth, the country of plantation genetically modified crops had 29, and the cultivated area of genetically modified crops is also increased to 16,000 ten thousand hm2 of 2011 by 1,700,000 hm2 of 1996.A lot of country is according to using the raw materials for production of the partial transgenic crop of approved as food or feed, and the meanwhile security of transgenic product receives extensive concern.
Current transgenic detection method is mainly based on the detection of foreign protein target and the detection based on nucleic acid.Take foreign protein as target object detection method be based on the specific recognition of antibody to antigen, mainly contain enzyme linked immunosorbent assay (ELISA), immunity test strip method and protein-chip, but these method background signals are high, protein active is difficult to permanent maintenance, exploitation specific antibody its protein generation sex change of high, the finished transgenic product of cost and cannot detect.What the detection method based on nucleic acid was the most frequently used is PCR (PCR) is the most frequently used transgenic detection method, but sample requirement is large, and complex operation, consuming time, the accuracy of result is subject to false positive and false-negative impact.
Graphene has higher physical strength, larger specific surface area and cheaper preparation cost, these features make Graphene become new excellent carrier, and the compound substance that nm of gold (AuNPs) and Graphene are formed, not only excellent properties is originally had, as large specific surface area, outstanding electric conductivity, catalytic, and excellent chemical stability etc., and two also also exist synergy between component, therefore the performance significantly improving compound substance also makes Graphene/golden nanometer particle compound in catalysis, biology sensor, spectroscopy, the fields such as stored energy show the performance of many excellences and potential using value.
Cadmium telluride quantum dot (CdTeQDs) is a kind of semiconductor nano material, by regulating particle diameter, the energy gap from whole visible light wave range to ultraviolet light wave band can be obtained, there is large carrier mobility, high optical absorption characteristics and thermal stability etc., can produce luminous efficiently under ultraviolet light or electron excitation.In photoelectric property, not only there is good luminescent properties, but also the electron acceptor material being, thus in electroluminescent device and photoelectric cell device, all obtain investigation and application widely.
Silica nanosphere have small size, water-soluble good, specific surface area large, good biocompatibility, nontoxic and can and the advantage such as various biomolecules coupling, be the ideal carrier of quantum dot.
Photic electrochemical sensor is a kind of using luminous energy as excitation energy, and electric signal is as the sensor of detection signal.
The present invention is with the coated silicon ball (SiO of cadmium telluride
2@CdTe) be photosignal mark.First ITO electrode surface is modified successively the silicon ball (SiO that upper Graphene/gold (rGO/AuNPs), DNA probe 1 (Probe1), target dna (T-DNA), DNA probe 2 (Probe2)-cadmium telluride are coated
2@CdTe), the Optical Electro-Chemistry sensor of structure substantially increases sensitivity.This detection system take ITO as working electrode, saturated calomel electrode is contrast electrode, and platinum electrode is to electrode, take photocurrent as detection signal, and by detecting the target dna of variable concentrations, Criterion curve, to reach the object detected crop and weight per unit length.
Summary of the invention
The present invention is intended to invent and a kind ofly integrates the Optical Electro-Chemistry sensor of exempting from mark, high sensitivity, high selectivity, the advantage such as simple to operation, there is provided a kind of preparation technology simple, highly sensitive, measurement range is wide, the quantitative detection that cost is low contains the method for CaMV35S promoter genetically modified crops and product, solves the difficult problem that existing testing cost is high, detection scheme is complicated, detection time is long, sensitivity is lower.
The present invention is achieved by the following technical solutions:
The preparation process of step 1, redox graphene/gold nano compound substance RGO/Au;
Step 2, silicon dioxide nanosphere@cadmium telluride nano composite material SiO
2the preparation process of@CdTe;
Step 3, in ITO electrode, prepare the step of probe 1 (Probe1): RGO/Au is scattered in distilled water the modified region of dripping after obtaining RGO/Au dispersion liquid and being applied to ITO electrode surface, carries out drying; Get the tris-HCl buffering drop being dissolved with probe 1 and be applied to described dried RGO/Au surface, carry out drying; After rinsing electrode surface, carry out drying, obtain ITO-rGO/Au-Probe1;
Step 4, modify the step of target dna CaMV35S promoter to probe 1: get the tris-HCl being dissolved with target dna CaMV35S promoter and cushion the surface that drop is applied to described ITO-rGO/Au-Probe1, incubated at room, post-flush electrode to be dried, obtains ITO-rGO/Au-Probe1-t-DNA;
Step 5, modify the step of probe 2 to target dna CaMV35S promoter: by SiO
2the distilled water dispersion liquid of@CdTe and the aqueous solution of N-hydroxy-succinamide join in the aqueous solution of ethyl-(3-dimethyl aminopropyl) carbodiimide hydrochloride reacts, after reaction terminates, centrifugal and washing obtain solid A, being joined by gained solid A is dissolved with in the tris-HCl damping fluid of probe 2, obtain mixed liquor A, after oscillating reactions a period of time, obtain solid product Probe2/SiO
2@CdTe; By Probe2/SiO
2@CdTe is scattered in after in distilled water, obtains mixed liquid B, and mixed liquid B dripped and be applied to described ITO-rGO/Au-Probe1-t-DNA surface, hatch, post-flush electrode surface to be dried, obtains ITO-rGO/Au-Probe1-t-DNA-Probe2/SiO
2@CdTe.
In step 3, the concentration of RGO/Au dispersion liquid is 1 ~ 4mg/mL, and dripping the amount being applied to the RGO/Au dispersion liquid on ITO surface is 20 μ L; The tris-HCl damping fluid consumption being dissolved with Probe1 is 10 μ L, and the concentration of probe 1 is 4 μMs.
In step 4, the tris-HCl damping fluid consumption being dissolved with target dna CaMV35S promoter is 20 μ L, and the concentration of target dna is 0.05pM ~ 100pM.
In step 5, SiO used
2the volume ratio 25:1:1 of the aqueous solution of the distilled water dispersion liquid of@CdTe, the aqueous solution of N-hydroxy-succinamide, ethyl-(3-dimethyl aminopropyl) carbodiimide hydrochloride; SiO used
2the concentration of the distilled water dispersion liquid of@CdTe is 1mg/mL, and the concentration of the aqueous solution of N-hydroxy-succinamide is 0.2M, and the concentration of the aqueous solution of ethyl-(3-dimethyl aminopropyl) carbodiimide hydrochloride is 0.4M; In mixed liquor A, the used concentration being dissolved with the tris-HCl damping fluid middle probe 2 of probe 2 is 10 μMs, and in mixed liquor A, containing 1mgSiO in every 100 μ Ltris-HCl damping fluids
2@CdTe; In mixed liquid B, Probe2/SiO
2the concentration of@CdTe is 4 μMs.
All electrode washing methods are the PBS wash buffer electrode 3 times with PH7.0, and all tris-HCl pH of buffer are 7.4, and concentration is 4.5mM.
To carry out modifying probe 2 (Probe2) to target dna (t-DNA) front, first get the 0.01mM6-sulfydryl hexanol 20 μ L of fresh configuration, drip on ITO-rGO/Au-Probe1-t-DNA surface, in order to avtive spot unnecessary on closed rGO/Au, use after 2 hours, with the PBS wash buffer electrode 3 times of PH7.0, to remove excessive 6-sulfydryl hexanol.
SiO
2the preparation method of@CdTe is: choose silicon ball and join in PDDA (PDDA), stirring reaction, stirring reaction is complete carry out centrifugal, washing after, getting precipitation joins in the distilled water dispersion liquid of CdTe, stirring reaction, after reaction terminates, centrifugal, washing, dry, obtain product, for subsequent use.
Probe 1 (Probe1) sequence used is 5 ' HS-GGCCATCGTTGAA3 '; CaMV35S (t-DNA) sequence is 5 ' GGCAGAGGCATCTTCAACGATGGCC3 '; Probe 2 (Probe2) sequence is 5 ' GATGCCTCTGCC-NH23 '.
Using prepared electrode as sensor, detect CaMV35S promoter for Optical Electro-Chemistry, its detecting step is as follows:
(1) the prepared ITO electrode containing variable concentrations target dna is placed in PH7.0PBS damping fluid, uses three-electrode system, carry out Electrochemical Detection.
Described three-electrode system: saturated calomel electrode is contrast electrode, platinum electrode is to electrode, and ITO is working electrode;
(2) scanning voltage scope is from-0.5V ~ 0V, and the electromotive force rank that jump are 4mV, frequency 25Hz, amplitude 25mV;
(3) Photoelectric Detection adopts i-t means of testing, and bias voltage is set to 0V; Switch lamp is carried out, the changing value of electric current before and after record switch lamp every 20s, according to the photocurrent values of the different sizes that the t-DNA of variable concentrations produces, drawing typical curve;
(4) testing sample solution is replaced t-DNA solution, the method for drawing according to described working curve detects.
The typical curve that CaMV35S detects refers to that this sensor reacts at the CaMV35S with variable concentrations, and sweeps to obtain its photo-signal collection of illustrative plates, the typical curve obtained according to photocurrent under variable concentrations.
Beneficial effect of the present invention is:
(1) the present invention is by CaMV35S as target dna and two probe specificity complementary pairing principle, and specific recognition CaMV35S transgenosis, can detect genetically modified crops and products thereof, greatly reduces the probability of false negative and false positive appearance.
(2) the present invention is by silicon dioxide nanosphere Surface coating CdTe, makes single Probe2 can connect N number of CdTe, thus carries out signal amplification.
(3) the present invention is by rGO/AuNPs and SiO
2@CdTe two ends dual signal amplifies, and achieve the Sensitive Detection to transgenosis CaMV35S promoter, in the concentration ranges of 0.1 ~ 100pM, CaMV35S concentration and photocurrent present good linear relationship, and detection limit can reach 0.017pM.
Accompanying drawing explanation
The photocurrent response figure that Fig. 1 obtains for detecting variable concentrations CaMV35S in embodiment 4, wherein a is 0.05pM, b be 0.01pM, c be 0.5pM, d be 1pM, e be 10pM, f be 50pM, g is 100pM;
Fig. 2 is the Experimental comparison figure in embodiment 3 and embodiment 7, and wherein a is the photocurrent response of the blank electrode in embodiment 3, and b is t-DNA photocurrent response, and c is 2 base mispairing DNA, d is that 5 base mispairing DNA are each, and e is not complementary DNA completely.
Embodiment
Below in conjunction with specific embodiment, the invention will be further described:
Silicon ball used in the present invention and CdTe all can adopt existing method to prepare, and the present invention's silicon ball used refers to silicon dioxide nanosphere.
The preparation method of the graphene oxide that the present invention is used is:
The preparation of GO adopts the Hummers method improved: under ice-water bath and stirring condition, 1g natural flake graphite is joined the dense H of 50mL
2s
2o
4(98%), in, zero degree is cooled to; Slowly add 0.5gKNO
3and 6gKMnO
4.4h is reacted under control temperature of reaction is no more than the condition of 10 DEG C.Then this system is transferred to 35 DEG C of water bath with thermostatic control stirring reaction 2h, adds 300mL deionized water, under≤80 DEG C of conditions, continue reaction 2h.With excessive 5%H
2o
2reduce remaining KMnO
4, and wash several times with 5%HCl, finally fully wash to solution no longer containing SO with enough deionized waters
4 2-ion (BaCl
2detect without white precipitate).Final product is transferred in 65 DEG C of baking ovens dry, stores for future use.
The preparation method of rGO/Au is:
Take 25mgGO ultrasonic disperse in 50mL ethanol solution, add 1gEDC and 0.5gNHS, stirred at ambient temperature reaction 8h; Then 1.0g2-ATP is joined in above-mentioned reaction system, continue under room temperature to stir 12h; Reaction terminate after, with absolute ethyl alcohol and redistilled water wash respectively, centrifugal 3 ~ 5 times, finally vacuum drying 24h at 60 DEG C, obtains GO-SH; Take GO-SH ultrasonic disperse in 30mL redistilled water of the above-mentioned preparation of 10mg, and be transferred in three hole flasks, under stirring, add hot reflux 0.5h; Then by freshly prepared for 10mL sodium citrate solution (0.2gmL
-1) slowly join in three hole flasks, continue under stirring condition to add hot reflux 2.5h; Again by 50 μ LHAuCl
4solution (2wt%) is slowly added drop-wise in above-mentioned reaction system, stops heating, be cooled to room temperature under stirring after continuing to add hot reflux 0.5h.Finally use second distillation water washing, centrifugal 3 ~ 5 times, can rGO/AuNPs be obtained after vacuum drying.
Embodiment 1:
SiO
2the preparation of@CdTe
Get the silicon ball of about 1mg100nm, join in 40mL0.4% PDDA (PDDA), stir 1 hour, 7000 leave the heart 5 minutes, after the centrifugal washing of distilled water 3 times, get precipitation and join 8mL and contain in the distilled water of 2.4mgCdTe, stirring reaction 1 hour, product is centrifugal, washing, dry, for subsequent use.
Embodiment 2:
Probe2/SiO
2the preparation of@CdTe:
Get the SiO of 1mL1mg/mL
2@CdTe distilled water dispersion liquid and 40 μ L0.2MN-N-Hydroxysuccinimide (NHS) join in 40 μ L0.4M ethyls-(3-dimethyl aminopropyl) carbodiimide hydrochloride (EDC), react after 2 hours, centrifugally remove unnecessary EDC and NHS, add the Probe2tris-HCl damping fluid of 100 μ L10 μMs, vibrate 12 hours, obtain Probe2/SiO
2@CdTe.
Embodiment 3:
(1) pre-service of ITO electrode: ITO electro-conductive glass is cut into 1cm*2cm size, use liquid detergent, ethanol, ultrapure water ultrasonic cleaning 30min successively, dry up with nitrogen afterwards, with insulating tape at one section of area fixedly going out 1cm*0.5cm of ITO electrode in order to decorative material and detection;
(2) get distilled water homogeneous dispersion that 20 μ L are dispersed with 2mg/mLrGO/Au to drip and be coated on ITO electro-conductive glass, place dry;
(3) Probe1 getting 10 μ L4 μMs of band sulfydryls drips the electrode surface being coated in step (2), by Au-S key, Probe1 is fixed on electrode surface, react 12 hours, with the PBS wash buffer electrode 3 times of PH7.0, rinse the Probe1 that removing is excessive, drying, obtains ITO-rGO/Au-Probe1;
(4) get the 0.01mM6-sulfydryl hexanol 20 μ L of fresh configuration, drip at electrode surface, in order to avtive spot unnecessary on closed rGO/Au, with the PBS wash buffer electrode 3 times of PH7.0 after 2 hours, to remove excessive MCH;
(5) Probe2/SiO of 20 μ L4 μMs is got
2@CdTe distilled water dispersant liquid drop is coated onto electrode surface, forms the control test of blank DNA, after hatching 50 minutes, with the PBS wash buffer electrode 3 times of PH7.0, to remove excessive Probe2/SiO
2@CdTe, obtains ITO-rGO/Au-Probe1-Probe2/SiO
2@CdTe Optical Electro-Chemistry sensor.
Embodiment 4:
(1) pre-service of ITO electrode: ITO electro-conductive glass is cut into 1cm*2cm size, use liquid detergent, ethanol, ultrapure water ultrasonic cleaning 30min successively, dry up with nitrogen afterwards, with insulating tape at one section of area fixedly going out 1cm*0.5cm of ITO electrode in order to decorative material and detection;
(2) get distilled water homogeneous dispersion that 20 μ L are dispersed with 1mg/mLrGO/Au to drip and be coated on ITO electro-conductive glass, place dry;
(3) Probe1 getting 10 μ L4 μMs of band sulfydryls drips the electrode surface being coated in step (2), by Au-S key, Probe1 is fixed on electrode surface, react 12 hours, with the PBS wash buffer electrode 3 times of PH7.0, rinse the Probe1 that removing is excessive, drying, obtains ITO-rGO/Au-Probe1;
(4) get the 0.01mM6-sulfydryl hexanol 20 μ L of fresh configuration, drip at electrode surface, in order to avtive spot unnecessary on closed rGO/Au, with the PBS wash buffer electrode 3 times of PH7.0 after 2 hours, to remove excessive MCH;
(5) get 0.05 respectively, 0.1,0.5,1,10,50, each 20 μ L of t-DNA of 100pM drip on 6 different ITO electrode surfaces, make target dna and Probe1 complementary pairing, incubated at room 50 minutes, with the PBS wash buffer electrode 3 times of PH7.0, to remove excessive target dna, obtain ITO-rGO/Au-Probe1-t-DNA;
(6) Probe2/SiO of 20 μ L4 μMs is got
2@CdTe distilled water dispersant liquid drop is coated onto electrode surface, makes Probe2 and target dna complementary pairing to connect Optical Electro-Chemistry marker material SiO
2@CdTe, after hatching 50 minutes, with the PBS wash buffer electrode 3 times of PH7.0, to remove excessive Probe2/SiO
2@CdTe, obtains the ITO-rGO/Au-Probe1-t-DNA-Probe2/SiO of the t-DNA of corresponding concentration
2@CdTe Optical Electro-Chemistry sensor.
ITO-rGO/Au-Probe1-t-DNA-Probe2/SiO prepared by the present embodiment
2@CdTe Optical Electro-Chemistry sensor is for detecting CaMV35S promoter, its result such as Fig. 1, Fig. 1 are presented within the scope of 0.05 ~ 100pM, present well linear to the detection of CaMV35S, detectability reaches 0.017pM, and therefore this sensor may be used for the quantitative detection of CaMV35S.
Embodiment 5:
(1) pre-service of ITO electrode: ITO electro-conductive glass is cut into 1cm*2cm size, use liquid detergent, ethanol, ultrapure water ultrasonic cleaning 30min successively, dry up with nitrogen afterwards, with insulating tape at one section of area fixedly going out 1cm*0.5cm of ITO electrode in order to decorative material and detection;
(2) get distilled water homogeneous dispersion that 20 μ L are dispersed with 2mg/mLrGO/Au to drip and be coated on ITO electro-conductive glass, place dry;
(3) Probe1 getting 10 μ L4 μMs of band sulfydryls drips the electrode surface being coated in step (2), by Au-S key, Probe1 is fixed on electrode surface, react 12 hours, with the PBS wash buffer electrode 3 times of PH7.0, rinse the Probe1 that removing is excessive, drying, obtains ITO-rGO/Au-Probe1;
(4) get the 0.01mM6-sulfydryl hexanol 20 μ L of fresh configuration, drip at electrode surface, in order to avtive spot unnecessary on closed rGO/Au, with the PBS wash buffer electrode 3 times of PH7.0 after 2 hours, to remove excessive MCH;
(5) get 0.05 respectively, 0.1,0.5,1,10,50, each 20 μ L of t-DNA of 100pM drip on 6 different ITO electrode surfaces, make target dna and Probe1 complementary pairing, incubated at room 50 minutes, with the PBS wash buffer electrode 3 times of PH7.0, to remove excessive target dna, obtain ITO-rGO/Au-Probe1-t-DNA;
(6) 1mLSiO is got
2@CdTe, add 40 μ L400mM ethyls-(3-dimethyl aminopropyl) carbodiimide hydrochloride (EDC) and 40 μ L200mMN-N-Hydroxysuccinimide (NHS), react after 2 hours, centrifugally remove unnecessary EDC and NHS, add the tris-HCl damping fluid that 100 μ L contain 10 μMs of Probe2, vibrate 12 hours, obtain Probe2/SiO
2@CdTe.Get the Probe2/SiO of 20 μ L4 μMs
2@CdTe distilled water dispersant liquid drop is coated onto electrode surface, makes Probe2 and target dna complementary pairing to connect Optical Electro-Chemistry marker material SiO
2@CdTe, after hatching 50 minutes, with the PBS wash buffer electrode 3 times of PH7.0, to remove excessive Probe2/SiO
2@CdTe, obtains the ITO-rGO/Au-Probe1-t-DNA-Probe2/SiO of the t-DNA of corresponding concentration
2@CdTe Optical Electro-Chemistry sensor.
Embodiment 6:
(1) pre-service of ITO electrode: ITO electro-conductive glass is cut into 1cm*2cm size, use liquid detergent, ethanol, ultrapure water ultrasonic cleaning 30min successively, dry up with nitrogen afterwards, with insulating tape at one section of area fixedly going out 1cm*0.5cm of ITO electrode in order to decorative material and detection;
(2) get distilled water homogeneous dispersion that 20 μ L are dispersed with 4mg/mLrGO/Au to drip and be coated on ITO electro-conductive glass, place dry;
(3) Probe1 getting 10 μ L4 μMs of band sulfydryls drips the electrode surface being coated in step (2), by Au-S key, Probe1 is fixed on electrode surface, react 12 hours, with the PBS wash buffer electrode 3 times of PH7.0, rinse the Probe1 that removing is excessive, drying, obtains ITO-rGO/Au-Probe1;
(4) get the 0.01mM6-sulfydryl hexanol 20 μ L of fresh configuration, drip at electrode surface, in order to avtive spot unnecessary on closed rGO/Au, with the PBS wash buffer electrode 3 times of PH7.0 after 2 hours, to remove excessive MCH;
(5) get 0.05 respectively, 0.1,0.5,1,10,50, each 20 μ L of t-DNA of 100pM drip on 6 different ITO electrode surfaces, make target dna and Probe1 complementary pairing, incubated at room 50 minutes, with the PBS wash buffer electrode 3 times of PH7.0, to remove excessive target dna, obtain ITO-rGO/Au-Probe1-t-DNA;
(6) 1mLSiO is got
2@CdTe, add 40 μ L400mM ethyls-(3-dimethyl aminopropyl) carbodiimide hydrochloride (EDC) and 40 μ L200mMN-N-Hydroxysuccinimide (NHS), react after 2 hours, centrifugally remove unnecessary EDC and NHS, add the tris-HCl damping fluid that 100 μ L contain 10 μMs of Probe2, vibrate 12 hours, obtain Probe2/SiO
2@CdTe.Get the Probe2/SiO of 20 μ L4 μMs
2@CdTe distilled water dispersant liquid drop is coated onto electrode surface, makes Probe2 and target dna complementary pairing to connect Optical Electro-Chemistry marker material SiO
2@CdTe, after hatching 50 minutes, with the PBS wash buffer electrode 3 times of PH7.0, to remove excessive Probe2/SiO
2@CdTe, obtains the ITO-rGO/Au-Probe1-t-DNA-Probe2/SiO of the t-DNA of corresponding concentration
2@CdTe Optical Electro-Chemistry sensor.
Because the amount of the rGO/Au modified in embodiment 4 ~ 6 is different, so the final probe of load and the amount of target dna are all had any different, but the difference of its testing result is only limitted to photocurrent size, therefore the electrode of these 3 embodiments all may be used for Optical Electro-Chemistry detection CaMV35S.
Embodiment 7:
(1) pre-service of ITO electrode: ITO electro-conductive glass is cut into 1cm*2cm size, use liquid detergent, ethanol, ultrapure water ultrasonic cleaning 30min successively, dry up with nitrogen afterwards, with insulating tape at one section of area fixedly going out 1cm*0.5cm of ITO electrode in order to decorative material and detection;
(2) get distilled water homogeneous dispersion that 20 μ L are dispersed with 1mg/mLrGO/Au to drip and be coated on ITO electro-conductive glass, place dry;
(3) Probe1 getting 10 μ L4 μMs of band sulfydryls drips the electrode surface being coated in step (2), by Au-S key, Probe1 is fixed on electrode surface, react 12 hours, with the PBS wash buffer electrode 3 times of PH7.0, rinse the Probe1 that removing is excessive, drying, obtains ITO-rGO/Au-Probe1;
(4) get the 0.01mM6-sulfydryl hexanol 20 μ L of fresh configuration, drip at electrode surface, in order to avtive spot unnecessary on closed rGO/Au, with the PBS wash buffer electrode 3 times of PH7.0 after 2 hours, to remove excessive MCH;
(5) get respectively the t-DNA of 20 μ L200pM, 2 base mispairing DNA, 5 base mispairing DNA respectively and completely not complementary DNA 20 μ L drip on 6 different ITO electrode surfaces, make DNA and Probe1 complementary pairing, incubated at room 50 minutes, with the PBS wash buffer electrode 3 times of PH7.0, to remove excessive DNA, obtain ITO-rGO/Au-Probe1-t-DNA;
(6) Probe2/SiO of 20 μ L4 μMs is got
2@CdTe distilled water dispersant liquid drop is coated onto electrode surface, makes Probe2 and target dna complementary pairing to connect Optical Electro-Chemistry marker material SiO
2@CdTe, after hatching 50 minutes, with the PBS wash buffer electrode 3 times of PH7.0, to remove excessive Probe2/SiO
2@CdTe, obtains the Optical Electro-Chemistry sensor of corresponding DNA.
The correlation data of the sensor of Fig. 2 prepared by the present embodiment and embodiment 3, the sensor of the present embodiment increasing along with base mispairing quantity can be found, its photoelectricity corresponding signal reduces gradually, after the DNA that electrode modification is completely not complementary, its photoelectric response value is substantially identical with blank, illustrates that this sensor has good selection specificity to CaMV35S.
In above-described embodiment, probe 1 sequence used is 5 ' HS-GGCCATCGTTGAA3 '; CaMV35S (t-DNA) sequence is 5 ' GGCAGAGGCATCTTCAACGATGGCC3 '; Probe 2 sequence is 5 ' GATGCCTCTGCC-NH23 '; The sequence of 2 base mispairing DNA is: 5 ' GGCAGAGGCAACTTCAAGGATGGCC3 '; The sequence of 5 base mispairing DNA is: 5 ' GCCAGAGGCAACTTCAAGGATGCCG3 '; The sequence of complementary pairing DNA is not completely: 5 ' CCTGCTCCGTAGCCTGCGTCATCTG3 '.
SEQUENCELISTING
<110> Jiangsu University
<120> mono-kind detects the Preparation method and use of the electrode of transgenosis CaMV35S promoter
<130> mono-kind detects the Preparation method and use of the electrode of transgenosis CaMV35S promoter
<160>3
<170>PatentInversion3.5
<210>1
<211>13
<212>DNA
<213> artificial sequence
<400>1
ggccatcgttgaa13
<210>2
<211>25
<212>DNA
<213> artificial sequence
<400>2
ggcagaggcatcttcaacgatggcc25
<210>3
<211>12
<212>DNA
<213> artificial sequence
<400>3
gatgcctctgcc12
Claims (9)
1. detect a preparation method for transgenosis CaMV35S promoter electrode, it is characterized in that, comprising:
The preparation process of step 1, redox graphene/gold nano compound substance RGO/Au;
Step 2, silicon dioxide nanosphere@cadmium telluride nano composite material SiO
2the preparation process of@CdTe;
Step 3, in ITO electrode, prepare the step of probe 1: RGO/Au is scattered in distilled water the modified region of dripping after obtaining RGO/Au dispersion liquid and being applied to ITO electrode surface, carries out drying; Get the tris-HCl buffering drop being dissolved with probe 1 and be applied to described dried RGO/Au surface, carry out drying; After rinsing electrode surface, carry out drying, obtain ITO-rGO/Au-Probe1;
Step 4, modify the step of target dna CaMV35S promoter to probe 1: get the tris-HCl being dissolved with target dna CaMV35S promoter and cushion the surface that drop is applied to described ITO-rGO/Au-Probe1, incubated at room, post-flush electrode to be dried, obtains ITO-rGO/Au-Probe1-t-DNA;
Step 5, modify the step of probe 2 to target dna CaMV35S promoter: by SiO
2the distilled water dispersion liquid of@CdTe and the aqueous solution of N-hydroxy-succinamide join in the aqueous solution of ethyl-(3-dimethyl aminopropyl) carbodiimide hydrochloride reacts, after reaction terminates, centrifugal and washing obtain solid A, being joined by gained solid A is dissolved with in the tris-HCl damping fluid of probe 2, obtain mixed liquor A, after oscillating reactions a period of time, obtain solid product Probe2/SiO
2@CdTe; By Probe2/SiO
2@CdTe is scattered in after in distilled water, obtains mixed liquid B, and mixed liquid B dripped and be applied to described ITO-rGO/Au-Probe1-t-DNA surface, hatch, post-flush electrode surface to be dried, obtains ITO-rGO/Au-Probe1-t-DNA-Probe2/SiO
2@CdTe.
2. by method according to claim 1, it is characterized in that, in step 3, the concentration of RGO/Au dispersion liquid is 1 ~ 4mg/mL, and dripping the amount being applied to the RGO/Au dispersion liquid on ITO surface is 20 μ L; The tris-HCl damping fluid consumption being dissolved with probe 1 is 10 μ L, and the concentration of probe 1 is 4 μMs.
3. by method according to claim 1, it is characterized in that, in step 4, the tris-HCl damping fluid consumption being dissolved with target dna is the concentration of 20 μ L, target dna CaMV35S promoter is 0.05pM ~ 100pM.
4., by method according to claim 1, it is characterized in that, in step 5, SiO used
2the volume ratio 25:1:1 of the aqueous solution of the distilled water dispersion liquid of@CdTe, the aqueous solution of N-hydroxy-succinamide, ethyl-(3-dimethyl aminopropyl) carbodiimide hydrochloride; SiO used
2the concentration of the distilled water dispersion liquid of@CdTe is 1mg/mL, and the concentration of the aqueous solution of N-hydroxy-succinamide is 0.2M, and the concentration of the aqueous solution of ethyl-(3-dimethyl aminopropyl) carbodiimide hydrochloride is 0.4M; In mixed liquor A, the used concentration being dissolved with the tris-HCl damping fluid middle probe 2 of probe 2 is 10 μMs, and in mixed liquor A, containing 1mgSiO in every 100 μ Ltris-HCl damping fluids
2@CdTe; In mixed liquid B, Probe2/SiO
2the concentration of@CdTe is 4 μMs.
5., by the method described in Claims 1 to 4 any one, it is characterized in that, SiO
2the preparation method of@CdTe is: choose silicon ball and join in PDDA, stirring reaction, stirring reaction is complete carry out centrifugal, washing after, getting precipitation joins in the distilled water dispersion liquid of CdTe, stirring reaction, after reaction terminates, centrifugal, washing, dry, obtain product, for subsequent use.
6. by the method described in Claims 1 to 4 any one, it is characterized in that, probe 1 sequence used is 5 ' HS-GGCCATCGTTGAA3 '; Target dna CaMV35S promoter sequence is 5 ' GGCAGAGGCATCTTCAACGATGGCC3 '; Probe 2 sequence is 5 ' GATGCCTCTGCC-NH23 '.
7. by the method described in Claims 1 to 4 any one, it is characterized in that, before carrying out modifying probe 2 to target dna, first get the 0.01mM6-sulfydryl hexanol 20 μ L of fresh configuration, drip on ITO-rGO/Au-Probe1-t-DNA surface, use after 2 hours, with the PBS wash buffer electrode 3 times of PH7.0.
8. by the method described in Claims 1 to 4 any one, it is characterized in that, all electrode washing methods are the PBS wash buffer electrode 3 times with PH7.0, and all tris-HCl pH of buffer are 7.4, and concentration is 4.5mM.
9. the purposes of the electrode prepared by the method described in claim 1 ~ 8 any one, is characterized in that, described electrode is used for Optical Electro-Chemistry and detects CaMV35S promoter.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510848286.3A CN105372307B (en) | 2015-11-27 | 2015-11-27 | A kind of Preparation method and use for the electrode for detecting transgenosis CaMV35S promoters |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510848286.3A CN105372307B (en) | 2015-11-27 | 2015-11-27 | A kind of Preparation method and use for the electrode for detecting transgenosis CaMV35S promoters |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105372307A true CN105372307A (en) | 2016-03-02 |
| CN105372307B CN105372307B (en) | 2018-02-27 |
Family
ID=55374689
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510848286.3A Expired - Fee Related CN105372307B (en) | 2015-11-27 | 2015-11-27 | A kind of Preparation method and use for the electrode for detecting transgenosis CaMV35S promoters |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105372307B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106053415A (en) * | 2016-07-12 | 2016-10-26 | 江苏大学 | Method for constructing fluorescence resonance energy transfer sensor and method for detecting CaMV35S promoter by means of sensor |
| CN106092978A (en) * | 2016-05-27 | 2016-11-09 | 江苏大学 | The preparation of a kind of FRET (fluorescence resonance energy transfer) sensor and the method for quick to CaMV35S |
| CN112649484A (en) * | 2020-12-10 | 2021-04-13 | 西南大学 | Preparation method and product of photo-induced electrochemical miRNA (micro ribonucleic acid) detection kit based on CHA (Chalco-charcot interaction) |
-
2015
- 2015-11-27 CN CN201510848286.3A patent/CN105372307B/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| JING QIAN ET.AL: "A high-throughput homogeneous immunoassay based on Forster resonance energy transfer between quantum dots and gold nanoparticles", 《ANALYTICA CHIMICA ACTA》 * |
| P. ABDUL RASHEED, N. SANDHYARANI: "Graphene-DNA electrochemical sensor for the sensitive detection of ofBRCA1 gene", 《SENSORS AND ACTUATORS B: CHEMICAL》 * |
| XIANXIANG ZENG ET.AL: "Using Graphene-Based Plasmonic Nanocomposites to Quench Energy from Quantum Dots for Signal-On Photoelectrochemical Aptasensing", 《ANALYTICAL CHEMISTRY》 * |
| XIAORU ZHANG ET.AL: "A New Signal-On Photoelectrochemical Biosensor Based on a Graphene/Quantum-Dot Nanocomposite Amplified by the Dual-Quenched Effect of Bipyridinium Relay and AuNPs", 《CHEMISTRY A EUROPEAN JOURNAL》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106092978A (en) * | 2016-05-27 | 2016-11-09 | 江苏大学 | The preparation of a kind of FRET (fluorescence resonance energy transfer) sensor and the method for quick to CaMV35S |
| CN106092978B (en) * | 2016-05-27 | 2018-10-09 | 江苏大学 | A kind of preparation of fluorescence resonance energy transfer sensor and the rapid detection method to CaMV35S |
| CN106053415A (en) * | 2016-07-12 | 2016-10-26 | 江苏大学 | Method for constructing fluorescence resonance energy transfer sensor and method for detecting CaMV35S promoter by means of sensor |
| CN106053415B (en) * | 2016-07-12 | 2018-11-09 | 江苏大学 | A kind of structure of fluorescence resonance energy transfer sensor and its detection method to CaMV35S promoters |
| CN112649484A (en) * | 2020-12-10 | 2021-04-13 | 西南大学 | Preparation method and product of photo-induced electrochemical miRNA (micro ribonucleic acid) detection kit based on CHA (Chalco-charcot interaction) |
| CN112649484B (en) * | 2020-12-10 | 2021-09-07 | 西南大学 | Preparation method and product of photo-induced electrochemical miRNA (micro ribonucleic acid) detection kit based on CHA (Chalco-charcot interaction) |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105372307B (en) | 2018-02-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10605761B2 (en) | Electrochemical biosensor based on aptamer/nano silver probe and EXO I enzyme | |
| Khonsari et al. | Recent trends in electrochemiluminescence aptasensors and their applications | |
| Hahn et al. | Chemical and biological sensors based on metal oxide nanostructures | |
| CN101458215B (en) | Electrochemical luminescent adaptorprotein sensor of poly-pyridine ruthenium complex compound and method for making same | |
| CN110438200B (en) | Biosensor for heavy metal lead ion detection based on double-signal amplification | |
| Li et al. | A versatile cathodic “signal-on” photoelectrochemical platform based on a dual-signal amplification strategy | |
| CN108469524A (en) | A kind of optical electro-chemistry immunosensor and its preparation method and application of detection CA125 | |
| CN105784796A (en) | Sensitive lysozyme measuring method of aptasensor based on gold/molybdenum disulfide/graphene nanocomposite | |
| CN107121462A (en) | A kind of preparation method for vulcanizing the dual decrease cadmium sulfide of Cu/SiO 2/carbon doping titanium dioxide insulin optical electro-chemistry sensor | |
| CN109507256A (en) | A kind of unmarked electrochemical luminescence aptamer sensor and preparation method thereof and application method detecting carcinomebryonic antigen | |
| CN105372307A (en) | Preparation method and application of electrode for detecting transgenic CaMV35S promoter | |
| CN104152449B (en) | MiRNA capture probes and its modified electrode and capture probe complementary strand and its carbon nano-tube modified golden magnetic nanoparticle compound | |
| CN110308187A (en) | A kind of preparation method and application of porous nano pucherite/bismuth sulfide optical electro-chemistry aptamer sensor based on zinc and cobalt doped | |
| Pang et al. | CdSe quantum dot-functionalized TiO2 nanohybrids as a visible light induced photoelectrochemical platform for the detection of proprotein convertase subtilisin/kexin type 6 | |
| CN110231336A (en) | A kind of preparation method and application of graphene/polyaniline nano-wire array immunosensor | |
| CN110297023A (en) | A kind of preparation method and application for the self-reinforcing optical electro-chemistry immunosensor that detection Procalcitonin electrochemical catalysis is assisted | |
| Wang et al. | Highly efficient quenching of electrochemiluminescence from CdS nanocrystal film based on biocatalytic deposition | |
| CN108918853A (en) | A kind of Pd@Ag@CeO2The preparation method and application of the immunosensor of label | |
| Liu et al. | An NIR light-responsive “on-off-on” photoelectrochemical aptasensor for carcinoembryonic antigen assay based on Y-shaped DNA | |
| CN104865240B (en) | Disposable nanometer electrogenerated chemiluminescence two-component immunosensor and preparation method thereof | |
| CN109142486A (en) | A kind of preparation method of the Photoelectrochemistrbiosensor biosensor for microRNA detection | |
| CN112526135A (en) | Preparation method and application of photoelectrochemical biosensor for detecting prostate specific antigen | |
| CN106770215A (en) | Preparation method of iron cobalt magnetic Nano sensor of a kind of multifunction and products thereof and application | |
| CN110184392A (en) | Detect the electrochemica biological sensor and preparation method thereof of EBV related gene | |
| CN115753936A (en) | Electrochemical luminescence biosensor for detecting organophosphorus pesticide, preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180227 Termination date: 20181127 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |