CN105372220A - Application of two-dimensional graphdiyne material for non-diagnosis purpose of biomarker fluorescence detection - Google Patents
Application of two-dimensional graphdiyne material for non-diagnosis purpose of biomarker fluorescence detection Download PDFInfo
- Publication number
- CN105372220A CN105372220A CN201510834364.4A CN201510834364A CN105372220A CN 105372220 A CN105372220 A CN 105372220A CN 201510834364 A CN201510834364 A CN 201510834364A CN 105372220 A CN105372220 A CN 105372220A
- Authority
- CN
- China
- Prior art keywords
- graphite alkene
- detection
- application
- biomarker
- dimensional
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6402—Atomic fluorescence; Laser induced fluorescence
Landscapes
- Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Optics & Photonics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
Abstract
The invention relates to an application of a two-dimensional graphdiyne material (with single layer or a plurality of layers) for a non-diagnosis purpose of biomarker fluorescence detection. Specifically, a biomarker includes a disease biomarker small-molecular compound, DNA, a nucleic acid aptamer, a protein, a peptide chain or other biological molecules. Through adopting of the two-dimensional graphdiyne material, the detection sensitivity can be substantially increased and the detection time is shortened at the same time, the use amount of specimens is reduced, the cost of testing is reduced, real-time detection of a variety of biological molecules can be realized simultaneously, and the two-dimensional graphdiyne material has broad application prospects for epidemic prevention of epidemic diseases such as influenza.
Description
Technical field
The present invention relates to 2D fields of nano material application, particularly relate to the application of a kind of two-dimentional graphite alkene material for the non-diagnostic object of biomarker fluoroscopic examination.
Background technology
Responsive, fast, the biomolecule analysis detection platform of the high and low cost of selectivity is very important for the clinical diagnosis of disease and treatment.Polymerase chain reaction is a kind of method of typical amplification and order-checking, but the features such as its high cost, excessive risk and length consuming time make it be difficult to extensively promote as practical application system.In recent years, new technology, the new method of biological detection continue to bring out, and comprise the semiconductor-quantum-point that size is controlled, the detection system such as fluorescence and many metallic barcodes, and wherein the Measurement for Biotechnique of fluorochrome label is the most noticeable.Fluorescence diagnosis mainly relies on FRET (fluorescence resonance energy transfer) (FRET) principle by the fluorescent quenching of fluorescence probe and manifests the detection realizing molecules of interest, because it is highly sensitive, selectivity is good, become one of the preferred means (document: S.Tyagi for biomolecule detection, F.R.Kramer, Nat.Biotechnol.1996,14,303).
Along with the deepening continuously of Measurement for Biotechnique research of fluorochrome label, it is multi-field that the field that this technology is applied constantly is extended to environmental monitoring, drug invention, clinical diagnosis, treatment and genetic analysis etc., but due to the restriction of test material, also there is following subject matter in this technology: detection sensitivity is low, detection time is long, detects while cannot realizing multiple target.
As early stage two-dimension nano materials, research finds to possess remote energy trasfer between Graphene and the ring structure of nucleic acid base, be good nanometer quencher material, base and hexagonal Graphene form comparatively high forces and then make probe base be with fluorescent dye cancellation by pi-pi accumulation.But double-stranded DNA, because the phosphate backbones of electronegative DNA is to the shielding effect of base, makes DNA molecular not stablize and is adsorbed on material surface, thus produce the recovery of fluorescence.Therefore, by detecting of biomarker can be realized to the observation of fluorescent quenching and recovery.This individual layer two-dimensional nano sheet layer material realizes according to its single stranded DNA to dye marker (ssDNA) absorption and fluorescent quenching ability the proof (document: C.F.Zhu that process that DNA and Small molecular detect have also been obtained scientist, Z.Y.Zeng, H.Li, F.Li, C.H.Fan, H.Zhang, J.Am.Chem.Soc.2013,135,5998.).Subsequently, WS
2pay close attention to widely because its potential application potential obtains in field of biological detection with some individual layers two dimension transient metal sulfide nano materials.
CN104762080A discloses a kind of Graphene fluorescent chemicals and preparation method thereof and the application of this compound in sodium glutamate fluoroscopic examination field, its Graphene fluorescent chemicals synthetic method prepared is simple, mild condition, product are easy to get, when sodium glutamate fluoroscopic examination by the impact of other biomolecule as amino acid and carbohydrate, there is high selectivity, test in alcohol water, easy to operate, fluorescence intensity is high, can obviously detect when concentration of sodium glutamate is low to moderate 0.5mg/L.CN103115903A discloses a kind of fluorescence detection method of micro-TCs, it is by the high selection index system of graphene molecules beacon, combined with fluorescent spectrophotometer, obtains the fluorescence signal of graphene molecules beacon, can realize the quantitative detection of trace amount tetracycline antibiotics.
Recent study finds, although Graphene and graphite alkene are all the carbon atoms of individual layer, but due to graphite alkene be by 1, phenyl ring conjugation is connected to form the full carbon molecule of two dimensional surface network structure by 3-bis-acetylene bond, it has abundant carbon chemical bond, large conjugated system, wide interplanar distance (4.1913 & Aring), make it have excellent chemical stability and semiconducting behavior.The special electronic structure of graphite alkene makes it be obtained for good application in fields such as superconduction, electronics, the energy and photoelectricity.Such as CN103943373A discloses the application of graphite alkene material in the electrode material of metallic ion battery and ultracapacitor, it can be used as the negative material of metallic ion battery or ultracapacitor to use, thus make metallic ion battery and ultracapacitor obtain excellent chemical property.CN101774570A discloses a kind of method preparing graphite alkyne film, and by this graphene film for the preparation of fields such as battery, electrode material, field effect transistor, catalysis material or energy and materials.But, do not find the pertinent literature be used for by graphite alkene in fluoroscopic examination at present.
Therefore, how two-dimensional material is used for the disease biomarkers in fluoroscopic examination body fluid, and significantly improves detection sensitivity and shorten detection time, the research making the epidemic prevention of its popularity disease have outstanding advantage has become current problem demanding prompt solution.
Summary of the invention
For solving deficiency of the prior art, the invention provides a kind of disease biomarkers that can be used in fluoroscopic examination body fluid, and significantly improve detection sensitivity and shorten detection time, the epidemic prevention of popularity disease has the two-dimensional material of outstanding advantage, when using it for the non-diagnostic object of biomarker fluoroscopic examination, its accuracy of detection is higher than existing instrument, significantly can improve data reliability and quantification property, and decrease sample consumption, reduce testing expense, because it can carry multiple fluorescence indicator, the detection of various biomolecules simultaneously can also be realized.
For reaching this object, present invention employs following technical scheme:
The invention provides the application of a kind of two-dimentional graphite alkene material for the non-diagnostic object of biomarker fluoroscopic examination.
In the present invention, described biomarker is the combination of any one or at least two kinds in disease biomarkers micromolecular compound, DNA, nucleic acid aptamer, protein or peptide chain fluoroscopic examination.
Present invention also offers two-dimentional graphite alkene material and prepare the application in body fluid in disease biomarkers luciferase assay reagent.
In the present invention, described body fluid is the combination of any one or at least two kinds in seminal fluid, blood, lymph liquid, saliva or urine.
In the present invention, described disease biomarkers can be any one in H1N1 type influenza, H5N1 type influenza or M13 bacteriophage, but the present invention is not limited to this.
In the present invention, fluorescence labels used in described fluoroscopic examination is any one in FAM, TexasRed or ROX.
In the present invention, described two-dimentional graphite alkene material is layer material, is preferably single or multiple lift two dimension graphite alkene material.
In the present invention, described two-dimentional graphite alkene material is as disease biomarkers carrier.
Two-dimentional graphite alkene material involved in the present invention is according to document G.X.Li, Y.L.Li, H.B.Liu, L.J.Li, D.B.Zhu, Chem.Comm., 2010,46 (19), 3256.) method synthesis.
In addition, the preparation of the thin layer graphite alkynes material in the present invention be by synthesis after material through peeling off (concrete grammar see document Z.Y.Zeng, Z.Y.Yin, X.Huang, H.Li, Q.Y.He, G.Lu, F.Boey, H.Zhang, Angew.Chem.Int.Ed.2011,50,11093.) the thin layer graphite alkynes material formed.
The fluoroscopic examination of the DNA in the present invention to excite the fluorescence bands being separately fixed at dyestuff entrained by DNA probe molecule with emission wavelength.
The present invention utilizes graphite alkene material to carry out fluoroscopic examination, this purposes make use of the newfound performance of graphite alkene material, and utilize this newfound performance, when using it for fluoroscopic examination, can significantly improve detection sensitivity and shorten detection time, sensitivity is made to reach 20pM, shorten detection time, can detect in real time, add system to be measured and namely manifest testing result, the real-time detection of various biomolecules simultaneously can also be realized, do not disturb each other.
Compared with prior art, the present invention at least has following beneficial effect:
(1) the present invention is by adopting two-dimentional graphite alkene material, use it in disease biomarkers micromolecular compound, DNA, nucleic acid aptamer, protein and the peptide chain in fluoroscopic examination body fluid, detection sensitivity can be improved to 20pM, shorten detection time simultaneously, and achieve real-time detection, add materials application in the possibility of clinical detection, the epidemic prevention of popularity disease (as influenza) is with a wide range of applications;
(2) the present invention utilizes two-dimentional graphite alkene material to carry out fluoroscopic examination, accuracy of detection can be made to be much higher than current material, significantly improve data reliability and quantification property, and reduce sample consumption, reduce testing expense, also can carry multiple fluorescence indicator, realize the detection of various biomolecules simultaneously.
Accompanying drawing explanation
Fig. 1 is biological detection process flow diagram of the present invention.
Fig. 2 is the thin layer graphite alkynes transmission electron microscope after the stripping that uses in the embodiment of the present invention and atomic force microscopy.
Fig. 3 is target DNA concentration and detecting signal strength relationship figure in embodiment 1.
Fig. 4 a-4d is Multiple detection anti-interference capability testing in embodiment 2.
Fig. 5 is the difference Detection results figure of T1, T2 and T3 target gene in embodiment 2.
In Fig. 1-5, GD is Sheet Graphite alkynes, and T1-T3 is target disease biomarker, and P1-P3 is the probe molecule with fluorescence labels.
Embodiment
For ease of understanding the present invention, it is as follows that the present invention enumerates embodiment.Those skilled in the art should understand, described embodiment is only help to understand the present invention, should not be considered as concrete restriction of the present invention.
As shown in Figure 1, the flow process of biological detection of the present invention is: first, according to the DNA molecular of disease biomarkers design to be measured with its pairing, synthesizes end according to this with the probe molecule of fluorescence labels, can fluorescence be detected; Then, mixed with the graphite alkene material prepared by probe molecule, fluorescence disappears; Finally, in system, add system to be measured, along with the target DNA containing target disease mark and probe molecule match, the fluorescence reproduction of its correspondence, the fluorescence namely by reproduction determines that system to be measured comprises disease molecules, realizes the detection of disease.
Fig. 2 shows the thin layer graphite alkynes transmission electron microscope after the stripping used in following examples and atomic force microscopy, it to show in following examples that used is smooth Sheet Graphite alkynes structure, and its thickness is about 1.5nm (being about single carbon atom diameter).
Embodiment 1:
H1N1 type influenza test (gene order: CGACTACACTCTCGATGAAGAA)
In 930 μ L phosphate buffer (0.1M, pH7.4), 1.2nM DNA probe molecule (gene order: TTCTTCATCGAGAGTGTAGTCG-FAM) and variable concentrations (0-5nM) target DNA are hybridized, and room temperature places 1min.Add graphite alkene (20 μ gml
-1) leave standstill 1 minute.Target DNA concentration and detecting signal strength relationship are as shown in Figure 3, fluorescent spectroscopy changes at the FAM fluorescent characteristics peak intensity of 494nm wave band, as shown in Figure 3, the concentration along with target DNA increases detection signal and significantly improves, and this graphite alkene material minimal detectable concentration is 20pM.
Embodiment 2:
Several genes detects simultaneously, and gene order used is as follows:
H1N1 type influenza T1 (gene order: CGACTACACTCTCGATGAAGAA)
DNA probe molecule P1 (gene order: TTCTTCATCGAGAGTGTAGTCG-FAM)
H5N1 type influenza T2 (gene order: CATACTGAGAACTCAAGAGTCT)
DNA probe molecule P2 (gene order: AGACTCTTGAGTTCTCAGTATG-TexasRed)
M13 bacteriophage T3 (gene order: ACTGGGCCGTCGTTTTAC)
DNA probe molecule P3 (gene order: GTAAAACGACGGCCAGT-ROX)
In 930 μ L phosphate buffer (0.1M, pH7.4), 1.2nM DNA probe molecule (P1, P2 and P3) and graphite alkene (20 μ gml
-1) mix standing 1 minute.
1) target DNA (T1, T2 and T3) is added respectively.Fluorescent spectroscopy is at the characteristic peak of 494nm, 518nm and 595nm wave band.
2) add T2 and T3 target DNA, the characteristic peak of fluorescent spectroscopy 494nm to 595nm wave band simultaneously.
Can be found out by Fig. 4 a-4d and Fig. 5, adopt the antijamming capability of graphite alkene material comparatively strong, multiple DNA can be detected simultaneously; Meanwhile, all samples is real-time detection, and namely target gene to be measured adds rear fluorescence and manifests immediately.
Table 1 shows the comparing result adopting graphite alkene of the present invention and other existing materials to carry out fluoroscopic examination.
Table 1
| Test material | Sensitivity | Detection time | Label | Multiple detection | Corresponding document |
| Graphite alkene | 20pM | Hurry up (in real time) | Simply | Be | The present invention |
| Single Walled Carbon Nanotube | 4nM | Slowly (several hours) | Simply | Do not report | 1 |
| Graphene | 100pM | Comparatively fast (1 minute) | Simply | Be | 2 |
| Nm of gold | nM | Comparatively fast (a few minutes) | Complicated | Be | 3 |
| Graphene (material premix) | ≈10nM | Slowly (30 minutes) | Simply | Do not report | 4 |
| Tantalum disulfide | 50pM | Comparatively fast (5 minutes) | Simply | Be | 5 |
| Molybdenum disulfide | 500pM | Comparatively fast (5 minutes) | Simply | Be | 5 |
The document related in table 1 is as follows:
1.R.H.Yang,J.Y.Jin,Y.Chen,N.Shao,H.Z.Kang,Z.Xiao,Z.W.Tang,Y.R.Wu,Z.Zhu,W.H.Tan,J.Am.Chem.Soc.2008,130,8351.
2.S.J.He,B.Song,D.Li,C.F.Zhu,W.P.Qi,Y.Q.Wen,L.H.Wang,S.P.Song,H.P.Fang,C.H.Fan,Adv.Funct.Mater.2010,20,453.
3.B.Dubertret,M.Calame,A.J.Libchaber,Nat.Biotechnol.2001,19,365
4.C.H.Lu,H.H.Yang,C.L.Zhu,X.Chen,G.N.Chen,Angew.Chem.Int.Ed.2009,48,4785.
5.ChangfengZhu,ZhiyuanZeng,HaiLi,FanLi,ChunhaiFan,andHuaZhang,J.Am.Chem.Soc.2013,135,5998-6001.
Contrasted by graphite alkene material that the present invention is adopted and other material existing, find: the present invention adopts graphite alkene material to be far superior to existing other materials in accuracy of detection with on detection time, and it has prior using value.
Applicant states, the present invention illustrates detailed process equipment and process flow process of the present invention by above-described embodiment, but the present invention is not limited to above-mentioned detailed process equipment and process flow process, namely do not mean that the present invention must rely on above-mentioned detailed process equipment and process flow process and could implement.Person of ordinary skill in the field should understand, any improvement in the present invention, to equivalence replacement and the interpolation of auxiliary element, the concrete way choice etc. of each raw material of product of the present invention, all drops within protection scope of the present invention and open scope.
Claims (8)
1. two-dimentional graphite alkene material is used for the application of the non-diagnostic object of biomarker fluoroscopic examination.
2. application according to claim 1, is characterized in that, described biomarker is the combination of any one or at least two kinds in disease biomarkers micromolecular compound, DNA, nucleic acid aptamer, protein or peptide chain fluoroscopic examination.
3. the application in body fluid in disease biomarkers luciferase assay reagent prepared by two-dimentional graphite alkene material.
4. application according to claim 3, is characterized in that, described body fluid is the combination of any one or at least two kinds in seminal fluid, blood, lymph liquid, saliva or urine.
5. the application according to claim 3 or 4, is characterized in that, described disease biomarkers is any one in H1N1 type influenza, H5N1 type influenza or M13 bacteriophage.
6. the application according to any one of claim 1-5, is characterized in that, fluorescence labels used in described fluoroscopic examination is any one in FAM, TexasRed or ROX.
7. the application according to any one of claim 1-6, is characterized in that, described two-dimentional graphite alkene material is layer material, is preferably single or multiple lift two dimension graphite alkene material.
8. the application according to any one of claim 1-7, is characterized in that, described two-dimentional graphite alkene material is as disease biomarkers carrier.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510834364.4A CN105372220B (en) | 2015-11-25 | 2015-11-25 | Application of the two-dimentional graphite alkene material for the non-diagnostic purpose of biomarker fluoroscopic examination |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510834364.4A CN105372220B (en) | 2015-11-25 | 2015-11-25 | Application of the two-dimentional graphite alkene material for the non-diagnostic purpose of biomarker fluoroscopic examination |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105372220A true CN105372220A (en) | 2016-03-02 |
| CN105372220B CN105372220B (en) | 2018-10-09 |
Family
ID=55374611
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510834364.4A Active CN105372220B (en) | 2015-11-25 | 2015-11-25 | Application of the two-dimentional graphite alkene material for the non-diagnostic purpose of biomarker fluoroscopic examination |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105372220B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110456051A (en) * | 2019-08-26 | 2019-11-15 | 扬州大学 | Unmarked impedance type immunosensor of Porcine epidemic diarrhea virus and preparation method thereof |
| CN110907421A (en) * | 2019-12-13 | 2020-03-24 | 深圳市人民医院 | Detection method and kit for copper ions based on graphdiyne and click chemistry and application |
| CN114034864A (en) * | 2021-10-15 | 2022-02-11 | 江苏大学 | Method for detecting alpha fetoprotein by aptamer fluorescence sensor constructed based on gold nanocomposite and polypeptide |
| CN114280015A (en) * | 2021-11-30 | 2022-04-05 | 苏州科技大学 | Application of graphdiyne/heme composite material and method for detecting reduced small molecules by using graphdiyne/heme composite material |
| CN114034864B (en) * | 2021-10-15 | 2024-06-07 | 江苏大学 | Method for detecting alpha fetoprotein by using aptamer fluorescent sensor constructed based on gold nanocomposite and polypeptide |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102205959A (en) * | 2011-03-28 | 2011-10-05 | 中国科学院化学研究所 | Graphite alkene nanotube and preparation method thereof |
| US20150048469A1 (en) * | 2013-08-19 | 2015-02-19 | Young-Woo Jung | Image sensor |
-
2015
- 2015-11-25 CN CN201510834364.4A patent/CN105372220B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102205959A (en) * | 2011-03-28 | 2011-10-05 | 中国科学院化学研究所 | Graphite alkene nanotube and preparation method thereof |
| US20150048469A1 (en) * | 2013-08-19 | 2015-02-19 | Young-Woo Jung | Image sensor |
Non-Patent Citations (2)
| Title |
|---|
| HAIXIN CHANG ET AL.: ""Graphene Fluorescence Resonance Energy Transfer Aptasensor for the Thrombin Detection"", 《ANALYTICAL CHEMISTRY》 * |
| XI CHEN ET AL.: ""Graphdiyne as a promising material for detecting amino acids"", 《SCIENTIFIC REPORT》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110456051A (en) * | 2019-08-26 | 2019-11-15 | 扬州大学 | Unmarked impedance type immunosensor of Porcine epidemic diarrhea virus and preparation method thereof |
| CN110456051B (en) * | 2019-08-26 | 2022-06-03 | 扬州大学 | Unmarked impedance immunosensor for porcine epidemic diarrhea virus and preparation method thereof |
| CN110907421A (en) * | 2019-12-13 | 2020-03-24 | 深圳市人民医院 | Detection method and kit for copper ions based on graphdiyne and click chemistry and application |
| CN110907421B (en) * | 2019-12-13 | 2022-06-17 | 深圳市人民医院 | Detection method and kit for copper ions based on graphdiyne and click chemistry and application |
| CN114034864A (en) * | 2021-10-15 | 2022-02-11 | 江苏大学 | Method for detecting alpha fetoprotein by aptamer fluorescence sensor constructed based on gold nanocomposite and polypeptide |
| CN114034864B (en) * | 2021-10-15 | 2024-06-07 | 江苏大学 | Method for detecting alpha fetoprotein by using aptamer fluorescent sensor constructed based on gold nanocomposite and polypeptide |
| CN114280015A (en) * | 2021-11-30 | 2022-04-05 | 苏州科技大学 | Application of graphdiyne/heme composite material and method for detecting reduced small molecules by using graphdiyne/heme composite material |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105372220B (en) | 2018-10-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jin et al. | Fabrication strategies, sensing modes and analytical applications of ratiometric electrochemical biosensors | |
| Jiang et al. | Signal-switchable electrochemiluminescence system coupled with target recycling amplification strategy for sensitive mercury ion and mucin 1 assay | |
| Laraib et al. | Nanotechnology-based approaches for effective detection of tumor markers: A comprehensive state-of-the-art review | |
| Qian et al. | Reversible fluorescent nanoswitch based on carbon quantum dots nanoassembly for real-time acid phosphatase activity monitoring | |
| Meng et al. | Peptide cleavage-based electrochemical biosensor coupling graphene oxide and silver nanoparticles | |
| Ge et al. | Affinity-mediated homogeneous electrochemical aptasensor on a graphene platform for ultrasensitive biomolecule detection via exonuclease-assisted target-analog recycling amplification | |
| Wei et al. | A novel label-free electrochemical immunosensor based on graphene and thionine nanocomposite | |
| Hilliard et al. | Immobilization of oligonucleotides onto silica nanoparticles for DNA hybridization studies | |
| Zhang et al. | Redox and catalysis ‘all-in-one’infinite coordination polymer for electrochemical immunosensor of tumor markers | |
| Jie et al. | Quantum dots-based multifunctional dendritic superstructure for amplified electrochemiluminescence detection of ATP | |
| Yang et al. | Ultrasensitive “signal-on” electrochemiluminescence immunosensor for prostate-specific antigen detection based on novel nanoprobe and poly (indole-6-carboxylic acid)/flower-like Au nanocomposite | |
| Yang et al. | Novel synthesis of gold nanoclusters templated with l-tyrosine for selective analyzing tyrosinase | |
| Ray et al. | Nanotechniques in proteomics: current status, promises and challenges | |
| Narayana et al. | Electrocatalytic boost up of epinephrine and its simultaneous resolution in the presence of serotonin and folic acid at poly (serine)/multi-walled carbon nanotubes composite modified electrode: a voltammetric study | |
| Yang et al. | Development of a lateral flow strip biosensor based on copper oxide nanoparticles for rapid and sensitive detection of HPV16 DNA | |
| Guo et al. | Potential-resolved “in-electrode” type electrochemiluminescence immunoassay based on functionalized g-C3N4 nanosheet and Ru-NH2 for simultaneous determination of dual targets | |
| Zhang et al. | A molybdenum disulfide quantum dots-based ratiometric fluorescence strategy for sensitive detection of epinephrine and ascorbic acid | |
| Mohammadi et al. | Fluorometric determination of microRNA-155 in cancer cells based on carbon dots and MnO 2 nanosheets as a donor-acceptor pair | |
| Zhang et al. | A ratiometric electrochemiluminescent biosensor for Con A detecting based on competition of dissolved oxygen | |
| CN104677892A (en) | Method for preparing electrochemiluminescence biological sensing interface based on loaded graphite phase carbon nitride and application thereof | |
| Liu et al. | Nanomaterial-based tools for protein kinase bioanalysis | |
| Salimi et al. | Amine-functionalized graphene as an effective electrochemical platform toward easily miRNA hybridization detection | |
| Liang et al. | Competitive method-based electrochemiluminescent assay with protein–nucleotide conversion for ratio detection to efficiently monitor the drug resistance of cancer cells | |
| CN105647788A (en) | SERS sensor for nucleic acid detection and preparation and multielement detection method thereof | |
| Hu et al. | Fluorometric and electrochemical dual-mode nanoprobe for tetracycline by using a nanocomposite prepared from carbon nitride quantum dots and silver nanoparticles |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |