CN105331749A - Reverse transcription loop-mediated isothermal amplification kit for swine epidemic encephalitis B virus and application of kit - Google Patents
Reverse transcription loop-mediated isothermal amplification kit for swine epidemic encephalitis B virus and application of kit Download PDFInfo
- Publication number
- CN105331749A CN105331749A CN201510938515.0A CN201510938515A CN105331749A CN 105331749 A CN105331749 A CN 105331749A CN 201510938515 A CN201510938515 A CN 201510938515A CN 105331749 A CN105331749 A CN 105331749A
- Authority
- CN
- China
- Prior art keywords
- epidemic encephalitis
- swine
- lamp
- virus
- reverse transcription
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a visualized reverse transcription loop-mediated isothermal amplification kit for a swine epidemic encephalitis B virus and application of the kit. The kit comprises RT-LAMP primers, two reaction buffer solutions, an EM, a fluorescent visual detection reagent, ultrapure water and a swine epidemic encephalitis B virus RNA template; the RT-LAMP primers comprise the outer primers F3 and B3, the inner primers FIP and BIP and the loop primers LF and LB, and the application includes detection of a swine epidemic encephalitis B lesion tissue sample and toxic mosquitoes through the kit. Specificity detection and sensitivity detection prove that the reverse transcription loop-mediated isothermal amplification kit can monitor a reaction in real time and quantitatively detect out the copy number of the swine epidemic encephalitis B virus to quickly and accurately obtain a detection result, and convenience is brought to easy, convenient, quick and reliable detection of the swine epidemic encephalitis B virus.
Description
Technical field
The present invention relates to technical field of microbial detection, relate to a kind of quick, visual and can the loop-mediated isothermal amplification kit of Real_time quantitative detection epidemic encephalitis b of swine virus and application thereof specifically.
Background technology
Epidemic encephalitis type B (
japaneseencephalitis, JE) be a kind of Natur al foca transmissible disease of the entomophila property Zoonosis based on central nervous system damage caused by epidemic encephalitis B virus (JEV).JEV mainly propagates with the approach of mosquito-aquatic bird or pig-aquatic bird all the year round in torrid areas, temperate zone.At present, there are 3,000,000,000 population lives in the whole world in encephalitis Endemic Area, and its Major Epidemic is in the main Asia in the Far East and Southeast Asian countries and regions, popular comparatively serious with China, India and south east asia.The thirties in 20th century, Japan is first reports the popular of JE.In summer nineteen twenty-four, large-scale encephalitis B is broken out in Japan and Korea, and people more than 6000 infects, and case fatality rate reaches about 80%, and in 1958, Vietnam's encephalitis B in the groove, had people more than 6000 to infect.China is the Endemic Area of encephalitis B, and the encephalitis B nearly 80% of whole world report occurs in China in recent years, and annual report has 20,000 many cases, case fatality rate more than 10%, and about has 15.3% to leave sequela in various degree in survivor.
Pig is the overwinterring host of epidemic encephalitis B virus and animal of mainly increasing, take the main contagium that viruliferous pig is people's encephalitis B, in pig-mosquito-propagation of people's chain lock, the encephalitis B each time of the mankind is very popular all closely bound up with the encephalitis B popularity in swinery, therefore encephalitis B is one of sanitarian major issue in Asia, the World Health Organization (OIE) is classified as category-B transmissible disease, and the Ministry of Agriculture of China is attributed to two class Animal diseases.Therefore, very necessary to the research of the popular Diagnostic Methods of Japanese Encephalitis in pig source.
To encephalitis b virus quick and precisely diagnosis be the key of preventing and treating epidemic encephalitis b of swine virus clinically.The method of current laboratory diagnosis JEV is broadly divided into 2 classes: 1. serological method, as ELISA method, complement fixation test (CFT) (CT), hemagglutination-inhibition test (HI) and neutralization test (NT), immunocytochemical method etc.; 2. molecular biology method.Serological method exists to be needed all to detect acute phase and convalescent serum, compares and wastes time and energy, and the shortcoming such as specificity and susceptibility is not high, be unfavorable for making the early infection of JEV quick and precisely diagnosing.Molecular biology method comprises PCR-ELISA microplate hybridization method, RT-PCR, real-time fluorescence quantitative PCR, gene chip etc., although comparatively Virus Isolation method is quick and precisely for these class methods, but need expensive plant and instrument, cost is higher, need to carry out agarose gel electrophoresis on result judges, easily cause laboratory pollution to cause occurring false positive results, be also not suitable for basic unit and Site Detection.
Summary of the invention
The object of the invention is to detect the problems such as epidemic encephalitis b of swine virus difficulty, length consuming time and expensive equipment to solve basic unit, there is provided a kind of for basic unit is easy, the quick test kit detecting epidemic encephalitis b of swine virus exactly, the technical scheme used for realizing the object of the invention is: a kind of epidemic encephalitis b of swine virus reverse transcription loop-mediated isothermal amplification kit, and this test kit comprises RT-LAMP primer, 2 × reaction buffer, EM, fluorescence visual detection reagent, ultrapure water and epidemic encephalitis b of swine viral RNA template; Described RT-LAMP primer comprises outer primer F3(SEQIDNO:1) and B3(SEQIDNO:2), inner primer FIP(SEQIDNO:3) and BIP(SEQIDNO:4) and ring primer LF(SEQIDNO:5) and LB(SEQIDNO:6):
Wherein primer sequence is:
F3TGGGTGGACTTGGTGCTA
B3TGGGCTTCTCCAGTCGTG
FIPTCGATGTTGATCATGCGGACGTAGACAGCTGCTTGACAATCA
BIPAGCTAGCCAACTTGCTGAGGTCAGCCACCGTCGAGATGTC
LFTGTTGGTTTGTCGTTTGCCA
LBGTTACTGCTATCATGCTTCAGTCA；
2 described × reaction buffer is Tris-HCL, KCL, MgSO
4, (NH
4)
2sO
4, Tween20, Betaine and dNTPs.
Above-described epidemic encephalitis b of swine viral RNA template is the RNA using virus genom DNA/RNA to extract the epidemic encephalitis b of swine virus that test kit extracts.From the RNA of epidemic encephalitis b of swine pathological tissues sample or the epidemic encephalitis b of swine virus with extracting in malicious mosquito.
Above-described fluorescence visual detection reagent adopts fluorexon fluorescent reagent, and fluorescent reagent adds before the reaction.
Above-described 2 × reaction buffer comprises Tris-HCL35-55mM, KCL15-35mM, MgSO
415-20mM, (NH
4)
2sO
415-25mM, Tween200.4-0.8 ℅, Betaine1.5-3.0M and dNTPs2.5-4mM, above-mentioned solvent, under pH is 8.6 conditions, evenly obtains by its compound method.
An application for epidemic encephalitis b of swine virus reverse transcription loop-mediated isothermal amplification kit, whether detect on veterinary clinic containing epidemic encephalitis b of swine virus in doubtful epidemic encephalitis b of swine pathological tissues or mosquito, concrete detecting step comprises:
(1) Design and synthesis of RT-LAMP primer
(2) extraction of epidemic encephalitis b of swine viral RNA template
(3) foundation of RT-LAMP reaction system
(4) RT-LAMP detection method.
Above-described RT-LAMP reaction system is set up in 25 μ l,
2 × reaction buffer 12.5 μ L
EM1μL
FIP40pmol
BIP40pmol
BIP20pmol
LB20pmol
F35pmol
B35pmol
Epidemic encephalitis b of swine viral RNA 5 μ L
Ultrapure water supplies 25 μ L.
Above-described RT-LAMP detection method is the method adopting specific detection, sensitivity Detection and fluorescent visual to detect.
Above-described RT-LAMP detection method adopts real-time turbidimeter to carry out airtight complete monitoring.
Above-described RT-LAMP detection method adopts the real-time turbidimeter of LoopampLA-320C to carry out airtight complete monitoring, and temperature of reaction is 63 DEG C, reacts appearance amplification between 10-35 minute.
Substantive distinguishing features of the present invention and progress are:
1) high specificity
The negative control virus of RT-LAMP detection reagent box specific detection of the present invention and all no positive result of water contrast are out, consistent with PCR detected result.And easy and simple to handle, obtain detected result fast, without the need to instrument costly.
2) highly sensitive
The sensitivity of regular-PCR detection method is 1.274 × 10
-3ng/ μ L, and use RT-LAMP detection method of the present invention, detectability is about 1.274 × 10
-5ng/ μ L is 100 times of regular-PCR.
3) result is obtained rapidly
The whole process of common RT-PCR just can be obtained a result at 24 hours, the RT-LAMP reaction method that current majority is set up after the completion of reaction, the video picture of agarose gel electrophoresis ultraviolet analysis must be adopted to carry out result of determination, extract acquisition test-results from virus genome RNA, need 4-5 hours.Amplification is there is in RT-LAMP detection method reaction provided by the invention at about 11 minutes, can complete amplification in 60 minutes, and result interpretation mode is easy, under visible light positive and negative pipe is compared, obviously can see that positive reaction is obvious muddiness by naked eyes, negative reaction pipe is transparent; Of short duration centrifugal after, have obvious white magnesium pyrophosphate throw out bottom positive reaction pipe, and a sediment-free bottom negative reaction pipe; Or add fluorescence dye, positive reaction pipe under ultraviolet light in green, with the naked eye just observable experimental result.Do not need to carry out the video picture of agarose gel electrophoresis ultraviolet analysis again and carry out result of determination, extract from geneome RNA and obtain net result and can complete in 2-3 hour.
4) do not pollute
The fluorescence dye that current RT-LAMP method is used for directly observing is for adding after reaction, and fluorescence dye of the present invention is the fluorexon commercial dyes (non-syber-green) added before the reaction, and testing process does not need to uncap.In addition, RT-LAMP detection method of the present invention, on result judges, is directly carried out result of determination by the turbidity value of turbidimeter detection reaction pipe, can not be carried out fluorescent dye determination detected result or carry out agarose gel electrophoresis detected result, do not need to uncap, can effectively avoid polluting.
5) can real-time quantitative
The present invention utilizes Tubidimeterreal-timeLA-320 turbidimeter to carry out the result of real-time analysis RT-LAMP reaction, the typical curve that time of the turbidity value that the concentration of different standard models is corresponding is depicted as, substitute into typical curve equation, the epidemic encephalitis b of swine viral copy number of each time can be obtained, reach the object of detection by quantitative product.
Accompanying drawing explanation
Fig. 1 is RT-LAMP method specific detection result of the present invention, wherein 1: epidemic encephalitis b of swine virus; 2: pig breeding dysfunction and breath syndrome virus; 3: foot and mouth disease virus; 4: Pestivirus suis; 5: porcine circovirus 2 type; 6: pig parvoviral; 7: PRV (Pseudorabies virus); 8: transmissible gastro-enteritis virus; 9: blank (water).There is the upcurve of turbidity in result display epidemic encephalitis b of swine virus reaction tubes, 7 strains contrast viral reaction tubes and water control reaction Guan Junwu increases.
Fig. 2 and Fig. 3 is the result that the epidemic encephalitis b of swine viral susceptibility using RT-LAMP method of the present invention and conventional RT-PCR method to carry out respectively detects.Wherein 1:1.27 × 10
2ng/ μ L; 2:1.27 × 10
1ng/ μ L; 3:1.27 × 10
0ng/ μ L; 4:1.27 × 10
-1ng/ μ L; 5:1.27 × 10
-2ng/ μ L; 6:1.27 × 10
-3ng/ μ L; 7:1.27 × 10
-4ng/ μ L; 8:1.27 × 10
-5ng/ μ L; 9: water (blank).The initial concentration of epidemic encephalitis b of swine virus genome RNA is 1.27 × 10
2ng/ μ L, after 10 times of multiple proportions serial dilutions, carries out RT-LAMP and pcr amplification, and result shows RT-LAMP method detectability of the present invention and is about 1.27 × 10
-5ng/ μ L, and regular-PCR method detectability is about 1.27 × 10
-3ng/ μ L.
Fig. 4 adds the response situation that visual results: Zuo Guanwei after fluorescence dye is template with epidemic encephalitis b of swine virus genome RNA, and be positive findings, right pipe is the response situation of negative control, is negative findings.
Fig. 5 is epidemic encephalitis b of swine Viral Quantification typical curve of the present invention: utilize the typical curve that turbidity value corresponding to the concentration of different standard models was depicted as the time, substitute into typical curve equation, the epidemic encephalitis b of swine viral copy number of each time can be obtained.
Embodiment
1, the preparation of material
Epidemic encephalitis b of swine virus, pig breeding dysfunction and breath syndrome virus, foot and mouth disease virus, Pestivirus suis, porcine circovirus 2 type, pig parvoviral, PRV (Pseudorabies virus) and transmissible gastro-enteritis virus, be commercial available vaccines.RT-LAMPRNA amplification kit purchased from Beijing Lanpu Biological Technology Co., Ltd., article No. LMP204; Virus genom DNA/RNA extracts test kit, is century bio tech ltd purchased from health, article No. CW0548.
2, the Design and synthesis of RT-LAMP primer
According to the encephalitis b virus E gene order in GenBank, utilize a set of RT-LAMP primer of RT-LAMP method primer Autocad PrimerExplorerV4 software design, wherein F3, B3 are outer primer, and FIP, BIP are inner primer, LF and LB is ring primer,
F3TGGGTGGACTTGGTGCTA
B3TGGGCTTCTCCAGTCGTG
FIPTCGATGTTGATCATGCGGACGTAGACAGCTGCTTGACAATCA
BIPAGCTAGCCAACTTGCTGAGGTCAGCCACCGTCGAGATGTC
LFTGTTGGTTTGTCGTTTGCCA
LBGTTACTGCTATCATGCTTCAGTCA
3, virus genome RNA extracts
(health is century bio tech ltd to use virus genom DNA/RNA to extract test kit, article No. CW0548) extract the DNA/RNA of pathological tissues of epidemic encephalitis b of swine virus or doubtful epidemic encephalitis b of swine virus infection and the genomic dna/RNA of contrast virus.
4, RT-LAMP reaction system is set up
According to test kit specification sheets, by 25 μ l system configurations:
2 × reaction buffer 12.5 μ L
EM1μL
FIP40pmol
BIP40pmol
LF20pmol
LB20pmol
F35pmol
B35pmol
Epidemic encephalitis b of swine viral RNA 5 μ L
Ultrapure water supplies 25 μ L.
RT-LAMP reaction is with real-time turbidimeter (LA-320C, Rong Yan company of Japan) form of carrying out airtight complete monitoring monitor present method detect situation, turbidimeter monitors amplification situation in real time, can drawing standard curve, time value corresponding to 0.1 turbidity value is reached by obtaining unknown sample, the starting copy number of this sample can be calculated from typical curve, temperature of reaction with 63 DEG C as temperature of reaction.
5, RT-LAMP detection method
1) specific detection
Use virus genom DNA/RNA to extract genomic dna/RNA that test kit extracts epidemic encephalitis b of swine virus and contrast strain-pig breeding dysfunction and breath syndrome virus, foot and mouth disease virus, Pestivirus suis, porcine circovirus 2 type, pig parvoviral, PRV (Pseudorabies virus) and transmissible gastro-enteritis virus, as the template of RT-LAMP reaction, simultaneously using water as blank, the specificity of checking R T-LAMP method.
2) sensitivity Detection
The epidemic encephalitis b of swine virus genome RNA extracted, measure its concentration, 8 extent of dilution are become with the continuous 10 times of doubling dilutions of RNA-FreeWater, using each RNA extent of dilution as template, carry out RT-LAMP amplification and pcr amplification, contrast RT-LAMP method of the present invention and regular-PCR method to the susceptibility detecting epidemic encephalitis b of swine virus.
3) fluorescent visual detects
According to the condition that turbidimeter monitoring is optimized, add fluorescence dye, fluorescence dye adds before the reaction, the dyestuff added is fluorexon commercial dyes, react at 63 DEG C after 30 minutes, observe under ultraviolet lamp, do not adopt the video picture of agarose gel electrophoresis ultraviolet analysis, avoid uncapping and run the Aerosol Pollution laboratory that electrophoresis observation causes.
The specific outcome of embodiment 1RT-LAMP detection method
RT-LAMP amplification is carried out to 1 strain epidemic encephalitis b of swine virus, 7 strain contrast viruses and water contrast, result as shown in Figure 1, the upcurve of turbidity is there is in epidemic encephalitis b of swine virus reaction tubes at about 11 minutes, for positive findings, 7 strains contrast viral reaction tubes and the water control reaction Guan Junwu situation that increases occurs, are negative findings.
The susceptibility results of embodiment 2RT-LAMP detection method
The initial concentration of epidemic encephalitis b of swine virus genome RNA is 1.27 × 10
2ng/ μ L, after 10 times of multiple proportions serial dilutions, carry out RT-LAMP and regular-PCR amplification, as shown in Figures 2 and 3, result shows RT-LAMP method detectability of the present invention and is about 1.27 × 10 result
-5ng/ μ L, and the detection of regular-PCR method is limited to 1.27 × 10
-3ng/ μ L.
The fluorescent visual detected result of embodiment 3RT-LAMP detection method
According to the condition that turbidimeter monitoring is optimized, add fluorescence dye, 63 DEG C of reactions are after 60 minutes, observe under ultraviolet lamp, Fig. 4 is observations, the response situation that Zuo Guanwei is template with epidemic encephalitis b of swine viral RNA, for positive findings, right pipe is negative control, is negative findings.Test-results shows, the RT-LAMP method of foundation can facilitate basic unit to use, the RT-LAMP primer that only test kit need be used to coordinate present method to design, after adding sample, with cheap water-bath keep 63 DEG C 60 minutes, can rapid examination result, and without the need to uncapping, avoid pollution.
The drafting of embodiment 4 epidemic encephalitis b of swine Viral Quantification typical curve
With epidemic encephalitis b of swine viral RNA for template, with outer primer F3 and B3 of this RT-LAMP method design for pcr amplification primer, the goal gene fragment obtained by pcr amplification is connected to carrier pMD18-T, transformation of E. coli recipient cell DH5a, ampicillin resistant screening obtains mono-clonal bacterium, extract the plastid rna of restructuring, after order-checking confirms, as standard model, measure the initial concentration of recombinant plasmid pMD18-T-E, carry out continuous 10 times of doubling dilutions 8 extent of dilution with RNA-FreeWater, get each extent of dilution 5 μ L and carry out RT-LAMP amplification as template
Contrast is set: concentration is 1.274 × 10
2ng/ μ L, 1.274 × 10
1ng/ μ L, 1.274 × 10
0ng/ μ L, 1.274 × 10
-1ng/ μ L, 1.274 × 10
-2ng/ μ L, 1.274 × 10
-3ng/ μ L, 1.274 × 10
-4ng/ μ L and 1.274 × 10
-5each one of the standard recombinant plasmid pMD18-T-E sample of ng/ μ L, because the negative logarithm of concentration and turbidity value be 0.1 time value linear, so the value that turbidimeter can be captured and time (as table 1) make typical curve, obtain typical curve equation, y=0.3599x – 5.6061, as shown in Figure 5.From typical curve equation coefficient R
2be 0.9952, in good linear relationship.Take time as X value, can obtain the negative time number formulary of Y value and concentration, then concentration is 10
-y, then be multiplied by radix 1.274, be 1.274 × 10
-yng/ μ L.According to copy number reduction formula copies/ μ L=(6.02 × 10
23× (ng/ul × 10
-9))/(RNAlength × 660), RNAlength is that carrier sequence size adds goal gene sequence size, is 2693+167=2860bp, is converted into copy number (copies/ μ L): 6.02 × 10
23× (1.274 × 10
-y× 10
-9)/(2860 × 660), be reduced to: 4.06 × 10
8× 10
-y.As certain test sample reach turbidity value be 0.1 time be 20 minutes time, bring set up typical curve equation into, obtain Y and equal 1.5919, then concentration is 10
-1.5919, then be multiplied by radix 1.274, be the concentration 1.274 × 10 of this test sample
-1.5919ng/ μ L, copy number is 4.06 × 10
8× 10
-1.5919, be 4.06 × 10
6.408copies/ μ L, thus reach quantitative effect.
Table 1 sample concentration negative logarithm and JEV-LAMP turbidity value linearly relation table
| Concentration bears logarithm | -2 | -1 | 0 | 1 | 2 | 3 | 4 |
| Time (dividing) | 10.5 | 13 | 15 | 18 | 21 | 24 | 27 |
<110> Veterinary Institute of Guangxi Zhuang Autonomous Region
<120> epidemic encephalitis b of swine virus reverse transcription loop-mediated isothermal amplification kit and application thereof
<160>6
<210>1
<211>18
<212>DNA
<213> artificial sequence
<400>1
TGGGTGGACTTGGTGCTA
<210>2
<211>18
<212>DNA
<213> artificial sequence
<400>2
TGGGCTTCTCCAGTCGTG
<210>3
<211>42
<212>DNA
<213> artificial sequence
<400>3
TCGATGTTGATCATGCGGACGTAGACAGCTGCTTGACAATCA
<210>4
<211>40
<212>DNA
<213> artificial sequence
<400>4
AGCTAGCCAACTTGCTGAGGTCAGCCACCGTCGAGATGTC
<210>5
<211>20
<212>DNA
<213> artificial sequence
<400>5
TGTTGGTTTGTCGTTTGCCA
<210>6
<211>24
<212>DNA
<213> artificial sequence
<400>6
GTTACTGCTATCATGCTTCAGTCA
Claims (8)
1. an epidemic encephalitis b of swine virus reverse transcription loop-mediated isothermal amplification kit, it is characterized in that, this test kit comprises RT-LAMP primer, 2 × reaction buffer, EM, fluorescence visual detection reagent, ultrapure water and epidemic encephalitis b of swine viral RNA template; Described RT-LAMP primer comprises outer primer F3(SEQIDNO:1) and B3(SEQIDNO:2), inner primer FIP(SEQIDNO:3) and BIP(SEQIDNO:4) and ring primer LF(SEQIDNO:5) and LB(SEQIDNO:6)
Wherein primer sequence is:
F3TGGGTGGACTTGGTGCTA
B3TGGGCTTCTCCAGTCGTG
FIPTCGATGTTGATCATGCGGACGTAGACAGCTGCTTGACAATCA
BIPAGCTAGCCAACTTGCTGAGGTCAGCCACCGTCGAGATGTC
LFTGTTGGTTTGTCGTTTGCCA
LBGTTACTGCTATCATGCTTCAGTCA；
2 described × reaction buffer is Tris-HCL, KCL, MgSO
4, (NH
4)
2sO
4, Tween20, Betaine and dNTPs.
2. epidemic encephalitis b of swine virus reverse transcription loop-mediated isothermal amplification kit according to claim 1, it is characterized in that, described epidemic encephalitis b of swine viral RNA template uses virus genom DNA/RNA to extract test kit, from the RNA of epidemic encephalitis b of swine pathological tissues sample or the epidemic encephalitis b of swine virus with extracting in malicious mosquito.
3. epidemic encephalitis b of swine virus reverse transcription loop-mediated isothermal amplification kit according to claim 1, it is characterized in that, described fluorescence visual detection reagent adopts fluorexon fluorescent reagent, and fluorescent reagent adds before the reaction.
4. epidemic encephalitis b of swine virus reverse transcription loop-mediated isothermal amplification kit according to claim 1, it is characterized in that, 2 described × reaction buffer comprises Tris-HCL35-55mM, KCL15-35mM, MgSO
415-20mM, (NH
4)
2sO
415-25mM, Tween200.4-0.8%, Betaine1.5-3.0M and dNTPs2.5-4mM.
5. the application of an epidemic encephalitis b of swine virus reverse transcription loop-mediated isothermal amplification kit, it is characterized in that, on veterinary clinic, detect doubtful epidemic encephalitis b of swine pathological tissues or be with malicious mosquito etc. whether to contain epidemic encephalitis b of swine virus, concrete detecting step comprises:
(1) Design and synthesis of RT-LAMP primer
(2) extraction of epidemic encephalitis b of swine viral RNA template
(3) foundation of RT-LAMP reaction system
(4) RT-LAMP detection method.
6. the application of epidemic encephalitis b of swine virus reverse transcription loop-mediated isothermal amplification kit according to claim 5, it is characterized in that, described RT-LAMP reaction system is set up in 25 μ l,
2 × reaction buffer 12.5 μ L
EM1μL
FIP40pmol
BIP40pmol
BIP20pmol
LB20pmol
F35pmol
B35pmol
Epidemic encephalitis b of swine viral RNA 5 μ L
Ultrapure water supplies 25 μ L.
7. the application of epidemic encephalitis b of swine virus reverse transcription loop-mediated isothermal amplification kit according to claim 5, it is characterized in that, described RT-LAMP detection method is the method adopting specific detection, sensitivity Detection and fluorescent visual to detect.
8. the application of epidemic encephalitis b of swine virus reverse transcription loop-mediated isothermal amplification kit according to claim 5, it is characterized in that, described RT-LAMP detection method adopts real-time turbidimeter to carry out airtight complete monitoring.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510938515.0A CN105331749A (en) | 2015-12-16 | 2015-12-16 | Reverse transcription loop-mediated isothermal amplification kit for swine epidemic encephalitis B virus and application of kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510938515.0A CN105331749A (en) | 2015-12-16 | 2015-12-16 | Reverse transcription loop-mediated isothermal amplification kit for swine epidemic encephalitis B virus and application of kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105331749A true CN105331749A (en) | 2016-02-17 |
Family
ID=55282509
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510938515.0A Pending CN105331749A (en) | 2015-12-16 | 2015-12-16 | Reverse transcription loop-mediated isothermal amplification kit for swine epidemic encephalitis B virus and application of kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105331749A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164558A (en) * | 2017-04-20 | 2017-09-15 | 华南农业大学 | A kind of recombinase normal temperature amplification of nucleic acid of Japanese Type-B encephalitis（RT‑RPA）ELISA test strip kit and application |
| CN112195272A (en) * | 2020-09-08 | 2021-01-08 | 华南农业大学 | Kit for detecting porcine Japanese encephalitis virus by combining centrifugal microfluidic chip with loop-mediated isothermal amplification technology |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103103294A (en) * | 2013-02-19 | 2013-05-15 | 广东出入境检验检疫局检验检疫技术中心 | Primers for detection of porcine Japanese encephalitis virus and visual kit |
| CN103116022A (en) * | 2013-01-23 | 2013-05-22 | 广西壮族自治区兽医研究所 | Test strip for quickly detecting swine Japanese encephalitis antibody and preparation method of test strip |
| CN103695561A (en) * | 2013-11-29 | 2014-04-02 | 华南农业大学 | RT-LAMP (Reverse Transcription Loop-mediated Isothermal Amplification) nucleic acid test strip kit for detecting Japanese B encephalitis virus and application of kit |
| CN104762414A (en) * | 2015-01-06 | 2015-07-08 | 武汉真福医药股份有限公司 | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit for fluorescent visual fast detection of Japanese encephalitis B virus |
-
2015
- 2015-12-16 CN CN201510938515.0A patent/CN105331749A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103116022A (en) * | 2013-01-23 | 2013-05-22 | 广西壮族自治区兽医研究所 | Test strip for quickly detecting swine Japanese encephalitis antibody and preparation method of test strip |
| CN103103294A (en) * | 2013-02-19 | 2013-05-15 | 广东出入境检验检疫局检验检疫技术中心 | Primers for detection of porcine Japanese encephalitis virus and visual kit |
| CN103695561A (en) * | 2013-11-29 | 2014-04-02 | 华南农业大学 | RT-LAMP (Reverse Transcription Loop-mediated Isothermal Amplification) nucleic acid test strip kit for detecting Japanese B encephalitis virus and application of kit |
| CN104762414A (en) * | 2015-01-06 | 2015-07-08 | 武汉真福医药股份有限公司 | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit for fluorescent visual fast detection of Japanese encephalitis B virus |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164558A (en) * | 2017-04-20 | 2017-09-15 | 华南农业大学 | A kind of recombinase normal temperature amplification of nucleic acid of Japanese Type-B encephalitis（RT‑RPA）ELISA test strip kit and application |
| CN112195272A (en) * | 2020-09-08 | 2021-01-08 | 华南农业大学 | Kit for detecting porcine Japanese encephalitis virus by combining centrifugal microfluidic chip with loop-mediated isothermal amplification technology |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102146466B (en) | Reagent for detecting brucella and complex probe fluorescence quantitative PCR (polymerase chain reaction) brucella detection method | |
| CN105349707A (en) | RT-LAMP (reverse transcriptase loop-mediated isothermal amplification) kit for porcine epidemic diarrhea viruses and applications thereof | |
| CN106811550B (en) | Grass carp reovirus type II vaccine strain and wild strain identification primer, kit containing grass carp reovirus type II vaccine strain and wild strain identification primer and diagnostic detection method | |
| CN106520977B (en) | The primer and method of ring mediated isothermal amplification method detection causing root rot disease of Medicago sativa bacterium | |
| CN101886138A (en) | Three-color fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) combined detection method of enterovirus 71, Coxsackie virus A16 and other subtypes of enterovirus as well as kit thereof | |
| CN105349702A (en) | PPV (porcine parvovirus) LAMP (loop-mediated isothermal amplification) kit and application thereof | |
| Chen et al. | Development and evaluation of loop-mediated isothermal amplification (LAMP) for rapid detection of Clonorchis sinensis from its first intermediate hosts, freshwater snails | |
| CN104651534A (en) | Porcine circovivus loop-mediated isothermal amplification kit and application thereof | |
| CN103710433A (en) | Babesiidae protozoon detection primer and real-time fluorescent quantitative PCR (polymerase chain reaction) kit | |
| CN106399486A (en) | Primer group and kit for detecting diarrhea-causing parasites through multi-PCR technology | |
| CN104651535A (en) | Reverse transcription loop-mediated isothermal amplification test kit of hog cholera virus and application thereof | |
| CN101845516A (en) | Real-time quantitative PCR detection method for red-sea bream iridovirus | |
| Zeng et al. | A one‐step molecular biology method for simple and rapid detection of grass carp Ctenopharyngodon idella reovirus (GCRV) HZ08 strain | |
| CN105400902A (en) | Reverse transcription loop-mediated isothermal amplification kit for detecting pestedes petits ruminants viruses | |
| CN107460255A (en) | A kind of RT LAMP primers group, kit and application for detecting pig fourth type coronavirus | |
| Khan et al. | Rapid detection of infectious bursal disease by loop-mediated isothermal amplification for field analysis | |
| CN101831506A (en) | Kit for authenticating deletion of vaccine strain and wild strain of PRVgE | |
| CN105349672A (en) | Mycoplasma hyopneumoniae loop-mediated isothermal amplification kit and application thereof | |
| CN105331749A (en) | Reverse transcription loop-mediated isothermal amplification kit for swine epidemic encephalitis B virus and application of kit | |
| CN104031997B (en) | A kind of LAMP primer group for rapid detection ustilago scitaminea bacteria, test kit and detection method thereof | |
| CN103695561A (en) | RT-LAMP (Reverse Transcription Loop-mediated Isothermal Amplification) nucleic acid test strip kit for detecting Japanese B encephalitis virus and application of kit | |
| Zhang et al. | Diagnostics and detection of African swine fever virus | |
| CN105385789A (en) | Reverse transcriphase loop-mediated isothermal amplification kit for swine transmissible gastroenteritis viruses and application of kit | |
| CN101392299A (en) | Equine influenza detection kit and detection method | |
| CN110295254A (en) | Identify the Multiplex real-time PCR primer and probe of detection Rift Valley fever virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160217 |