CN105316339A - Corn endosperm specific expression promoter NRP1 promoter and cloning method and application thereof - Google Patents

Abstract

The invention relates to a corn endosperm specific expression promoter NRP1 promoter and a cloning method and application thereof. The NAM related protein 1 (NRPI) promoter capable of being specifically expressed in corn endosperm is separated out for the first time. The promoter has a nucleotide sequence shown as SEQ ID NO.1 or a nucleotide sequence which is replaced with, is in lack of and/or is added with one or more nucleotides, has the same function and is derived from the nucleotide sequence. Starting from cloning the corn endosperm specific expression promoter NRP1 promoter, the function of the NRP1 promoter is analyzed, and it is verified from the experiment level that the promoter is suitable for starting a target gene to be specifically expressed in corn endosperm, and is low expressed or not expressed in other tissue. A proper control element is provided for construction of a plant genetic engineering expression carrier, and new materials are provided for study on other projects in a laboratory.

Description

Corn embryosperm specific expression promoter NRP1 promotor, its cloning process and application thereof

Technical field

The present invention relates to a kind of corn embryosperm specific expression promoter NRP1 promotor, its cloning process and application thereof.

Technical background

Corn ( zeamaysL.) be one of important grain of the mankind, and develop into the product integrating the purposes such as grain, feed, the energy, industrial raw material gradually, the demand also cumulative year after year to corn in worldwide along with the lifting of economy and technology.And improving corn yield, improvement corn germplasm becomes the major objective of present stage corn molecule breeding research.Transgenic technology becomes instantly popular and one of method comparatively fast and effectively because of the feature of its efficient Crop Improvement proterties.

Promotor is the initial necessary sequence of genetic transcription, the Upstream cis acting containing gene expression regulation.Promoter in eukaryote is distinguished the promotor that rna plymerase i, II and III can be divided into identify by RNA polymerase kind.Wherein II class promotor is combined by rna plymerase ii identification, controls the genetic expression of Multi-encoding functional protein.The II class promotor of plant is primarily of core promoter and upstream functional element composition.Genetic expression whether and expression time, expressive site all need the cis-acting elements of promotor and corresponding transcription factor coordinated regulation.II class promotor can be divided into strong promoter and weak promoter according to the intensity controlling transcriptional level.According to the difference of the mode of action and function, usually also promotor is divided into constitutive promoter, tissue-specific promoter and inducible promoter three major types.

Tissue-specific promoter is also referred to as organ specific promoters, and this kind of promotor is often relevant to the growth of certain organs.Found the element that simultaneously there is several control tissue specific expression in this kind of promotor at present, its expression specificity determines by the kind of these elements, number and relative position etc. are common.People are striving to find the structure of the distinctive tissue specific promoter of some plants self for transgene carrier.Using-system specific promoter, can, according to the wish of people at plant interior expression foreign gene, make foreign gene play a role more cost-effectively.Further investigation tissue-specific promoter not only contributes to illustrating the basic theories such as phytomorph, growth, pathways metabolism, and is with a wide range of applications.

Corn seed is main vegetative storage organ, has important economic worth.Endosperm tissue is nutrition storage position main in seed.Therefore, endosperm specificity promoter is as a kind of important cis-acting elements, there is practice significance and using value, from now on utilizing transgenic technology to improve in seed protein content and to prepare in plant bioreactor etc., will have and apply more widely.The present invention filters out 1 corn embryosperm specificity promoter by bioinformatics method.Can be maize genetic transformation experiment provide tool valuable molecular tool by analyzing this promotor.

Summary of the invention

An object of the present invention is to provide a kind of corn embryosperm specific expression promoter NRP1 promotor.

Two of object of the present invention is the cloning process providing this promoter sequence.

Three of object of the present invention is the application providing this promotor.

In order to realize the object of the invention, the present invention adopts following technical scheme:

A kind of corn embryosperm specific expression promoter NRP1 promotor, is characterized in that this promotor is one of one sequence:

I) nucleotide sequence shown in SEQIDNO.1;

Ii) the nucleotides sequence shown in SEQIDNO.1 be listed in retain core promoter sequence basis on be substituted, lack and/or add one or several Nucleotide and there is the nucleotide sequence derivative by the nucleotide sequence shown in SEQIDNO.1 of same function.

A kind of carrier, is characterized in that this carrier contains above-mentioned corn embryosperm specific expression promoter NRP1 promotor.

A kind of transgenic cell line, is characterized in that this clone contains above-mentioned corn embryosperm specific expression promoter NRP1 promotor.

A kind of engineering bacteria, is characterized in that this project bacterium contains above-mentioned corn embryosperm specific expression promoter NRP1 promotor.

A kind ofly clone above-mentioned corn embryosperm specific expression promoter NRP1 promotor; it is characterized in that the concrete steps of the method are: the base sequence ATG upstream sequence of corn embryosperm specific expression gene NRP1 being intercepted 2000bp; design primer; with B73 genome for template, namely obtain corn embryosperm specific expression promoter NRP1 promotor by pcr amplification; The primer sequence of described amplified fragments:

Forward primer is held to hold to 3 ' from 5 ': agtcgtcacgctcacattgt;

Reverse primer is held to hold to 3 ' from 5 ': ggctcctgctccttcactga.

A kind of above-mentioned corn embryosperm specific expression promoter NRP1 promotor is in the specific expressed application of regulation and control downstream gene in corn embryosperm.。

The present invention also provides the application of corn embryosperm specific expression promoter NRP1 promotor in regulation and control downstream gene expression, and preferred downstream gene is the reporter gene such as gus gene, GFP gene.

After initiator codon (ATG) the upstream 2kb sequence amplification of corn NRP1 gene, be connected on GUS expression vector pTF102, by the vector corn built, obtain transgenic line, and with GUS display substrate x-gluc, transfer-gen plant is dyeed, observe the coloring case of endosperm.

The present invention propose first one new can in corn embryosperm the NRP1 promotor of specifically expressing, this promotor is applicable to start specific expressed in corn embryosperm of target gene (as gus gene or GFP gene).The specificity of this promotor is very strong, therefore for the structure of plant genetic engineering expression vector provides suitable controlling element, also for the research of other problems of laboratory is carried out providing new material.

Accompanying drawing explanation

The GUS transient expression vector constructing plan figure of Fig. 1 corn embryosperm specific expression promoter NRP1 and deletion fragment thereof.

The GUS transient expression vector segmentation enzyme of Figure 22 kbNRP1 promoter fragment and 1kb and 500bp deletion fragment thereof cuts qualification figure.

Fig. 3 pUC-pNRP1-GUS vector construction schematic diagram.

14 days seed biolistic bombardment GUS coloration results after Fig. 4 B73 corn pollination.

+: 35S(positive control)-: B73 negative contrast A:NRP1-2000bp fragment B:NRP1-1000bp fragment

Scale length in C:NRP1-500bp fragment figure represents 1mm

Fig. 5 pTF102-pNRP1-GUS corn transformation vector construction schematic diagram.

Fig. 6 PBPA maize immature embryos conversion process figure.

A: get embryo and infect B: Dual culture C: renewal cultivation D: takes turns screening E: three-wheel screening F: kanamycin-resistant callus tissue

G: secretly regenerate H: photo reversal I: positive seedling buries

Fig. 7 PCR detects transgenic positive result electrophorogram.

A:(bar)B:(GUS)

M:DNA molecular weight Marker; 1:NRP1-D-1 is negative; 2:NRP1-D-2 is positive; 3:NRP1-D-3 is negative; 4:NRP1-D-4 is positive; 5:NRP1-D-5 is negative; 6:NRP1-D-6 is negative; 7:NRP1-D-7 is negative; 8:NRP1-D-8 is negative; 9:NRP1-D-9 is negative; 10:NRP1-D-10 is negative; 11:NRP1-D-11 is positive; 12:NRP1-D-12 is positive; 13:NRP1-D-13 is negative; 14:NRP1-D-14 is negative; 15:NRP1-D-15 is positive; 16:NRP1-D-16 is negative; Negative contrast: PBPA; Water contrasts.

The GUS coloration result figure of the leaf of Fig. 8 transfer-gen plant, root, seed coat, embryo, endosperm tissue

35S-GUS's

A: root b: leaf c: seed coat d: embryo e: endosperm

NRP1-GUS's

A: leaf B: root C: seed coat D: embryo E: endosperm

Scale length in figure represents 1mm.

Embodiment

Below in conjunction with specifically implementing example, set forth the present invention further.Should be understood that these examples are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted specific experiment condition in the following example, usual conveniently condition, as molecular cloning (MolecularCloning:ALaboratoryManual, 3rded.) or molecular biology of plants-laboratory manual (PlantMolecularBiology-ALaboratoryManual, MelodyS.Clark compiles, Springer-verlagBerlinHeidelberg, 1997) condition described in, or according to the condition that manufacturer advises.

Embodiment one: obtain promoter fragment

In ncbi database, find the ATG upstream sequence of corn embryosperm specific expression gene NRP1, intercept the base sequence of 2000bp, concrete sequence refers to SEQIDNO.1, design primer, with B73 genome for template, obtains fragment, see Fig. 1 by pcr amplification technology.The primer sequence of amplified fragments:

Forward primer is held to hold to 3 ' from 5 ': agtcgtcacgctcacattgt;

Reverse primer is held to hold to 3 ' from 5 ': ggctcctgctccttcactga;

Result: clone connection carrier by TA after obtaining 2000bp object fragment, enzyme cuts qualification (see figure 2), order-checking comparison, consistent with the sequence provided in database.

Embodiment two: the acquisition of promotor truncated segment

According to the predicting the outcome of website (http://www.softberry.com) of prediction promoter element, intercept the base sequence of 1000bp, 500bp size respectively, PCR obtains fragment.The primer sequence of amplified fragments:

1000bp：

Forward primer is held to hold to 3 ' from 5 ': atagatgatagatacatcgg;

Reverse primer is held to hold to 3 ' from 5 ': ggctcctgctccttcactga;

500bp：

Forward primer is held to hold to 3 ' from 5 ': gatcgacggcctgagcagac;

Reverse primer is held to hold to 3 ' from 5 ': ggctcctgctccttcactga;

Result: clone connection carrier by TA after reclaiming the object fragment of different size respectively, enzyme cuts qualification (see figure 2), order-checking comparison, consistent with the sequence provided.

Embodiment three: truncated segment is connected with gus gene, beats particle gun, checking core promoter element

With xbai+ hindgusA-NOS fragment is cut from enzyme pBI121 carrier (see figure 3) and is connected in pUC19 carrier (see figure 3) by 1 enzyme point, builds pUC19-Gus-nos carrier.After correct for the fragment recovery connection sequence verification of the different lengths be cloned into, use xbai+ bamHi enzyme is cut, and is connected into pUC19-Gus-nos, builds pUC19-pNRP1-GUS carrier.The carrier that structure is good is proceeded in intestinal bacteria TOP10, after extracting plasmid, beat particle gun.

After choosing B73 corn pollination, the seed of 14 days is acceptor material, peels off seed coat with 70% alcohol disinfecting, is put into the instantaneous conversion of osmotic medium being cultivated and carrying out particle gun after 6 hours.The bombardment parameters of particle gun: pressure 650, distance 3cm, two rifles.25 DEG C of light culture 48 hours after bombardment, GUS dyes (see figure 4).

Result: NRP1-2000bp promoter fragment, 1000bp fragment, 500bp fragment all have GUS to express, illustrates that promotor still has function when being punctured into 500bp fragment.

Embodiment four: according to the functional verification result of truncated segment, chooses 2000bp fragment construction of expression vector, Agrobacterium-mediated Transformation maize immature embryos

Choose the carrier of pTF102 carrier as Agrobacterium-mediated Transformation maize immature embryos.First use psti enzyme is cut pTF102 carrier and is removed 35S-GUS fragment, and carrier is from connecting.Section 2000bp promoter fragment in pUC19-pNRP1-GUS carrier being connected GUS is used xbai+ ecoRafter I enzyme is cut, be connected into the pTF102 carrier after connecting, build pTF102-pNRP1-GUS carrier (see figure 5), electroporated EHA105 bacterial strain.

Choose the PBPA corn strain pollination rataria of 8-12 days, size is about about 1.5mm as acceptor material, carry out rataria conversion, idiographic flow (see figure 6): Agrobacterium infect 10min-Dual culture 20 DEG C of 3 days-renewal cultivations 28 DEG C of 7 days-screening and culturing (two third ammonia phosphorus 1.5mg/l) 28 DEG C of 14 days-screening and culturing (two third ammonia phosphorus 3mg/l) 28 DEG C of 14 days 3-5 take turns-obtain resistant calli-dark regeneration cultivation 28 DEG C of 14-21 days-photo reversals cultivate 28 DEG C 14-21 days-obtain-PCR in positive seedling-immigrations basin to detect positive plant (Fig. 7)-pollination acquisition offspring.

Result: choose about 2000 ratarias as acceptor material, obtains 10 kanamycin-resistant callus tissues after transformation and selection, obtains transfer-gen plant, and gather in the crops offspring after regeneration.The leaf extracting genome of selected part event simultaneously, detects transgenic positive result by the double PCR of marker gene bar and goal gene GUS.

Embodiment five: GUS dyes

Choose 35S-GUS as positive control, respectively GUS dyeing is carried out to the root of transfer-gen plant, leaf, seed coat, embryo, endosperm, the specificity (see figure 8) of checking promotor.

Result: 35S-GUS all has gus gene to express at the root of milpa, leaf, embryo, endosperm, and pNRP1-GUS milpa root, leaf, seed coat, embryo is organized all does not have gus gene to express, only have gus gene high expression in endosperm tissue, prove that the specificity of NRP1 promotor is fine.

<110> Shanghai University

<120> corn embryosperm specific expression promoter NRP1 promotor, its cloning process and application thereof

<160>5

<210>1

<211>2000

<212>DNA

<213> corn

<400>1

ggctcctgctccttcactgagatcagatcgatgaagcactaacaacaaccatttatatca60

aggaacaattcgtagacgacagtataaaaatcgaaactttcatacatgcacaaacgcttc120

gttctcggcctgccggcggccgccggtcagtctagctaggtctctcactcgctcgctcgc180

tcaccagaacgacggatgatgcagagctagcgagttgtgttctggtagtgcagtgagcca240

caggcacgctgcagcgcgcgcgttaaataggcaggaagcgtgctcgcgcaaggcgctttc300

cgctgaagcctcctgctcctgcctctatacccggcggccctctttttcggtgctgtctgt360

ttctactggccattggacgcttgttctttccaactgtgccacgcttgtcgtcgcgcaggc420

cgggctcactttcgcgccggggcctcggctggtgctggcgacaggtgccgaatggaggcc480

gggttctggaatgtctctacctccggtttgcctctgcccggccagccctggcatgcgatt540

cctgtggacgtatgcgtgagtccgcccgcgcgccgctcatgtctgctcaggccgtcgatc600

gccggctgcatgaacaagagggctgcgcggctggtggccgcccacgtcgacatgcgcatg660

cgcgcgcggctgacggccggccgctagctacaaggggccgccttcgcgatagaaagctgc720

tgtagatgtaggcatccatctgggacaagcagtccagtgatagatgtgggtcgtcgtgat780

ctggttgctgatcattattgcggcgccggagcgtcgtgttcttcactactctcggtcagt840

tttaggtgcatgggagaaacgcgtgcgtgcatgcgcgcgggccgttgtgccgatgcggtg900

tgctgtccggctgtccctggctgcgtatgcatgtagacacccgatgtatctatcatctat960

ctgctggacgatatatagcctgtttgtgcctgttgtcacacacacacacacaaaccgtgc1020

atagataacacagattacatggtgaccaatgcaagtgacaagtgtgcgtcggtccaagcg1080

cgcctagccagccctggaaaccatggtcagttcgcgtgttactgtgccacccaaaccaag1140

ggacaggacaggcggcgacgacgaccgcttgatttatgcatgcatggaatgaagggggta1200

ttttccttttcagttccttgctttcaaaggaattaagtcaggaaacctacgcgcgcgttc1260

tgatccagcgtaccgatccatcacacattctgcgcgtgcatggagtgcatggctagagtc1320

catgcctatgtgtgccgtccaggcttggtgaaatggcgtggcatgtgtgctggcgctttc1380

cgtagaaaagtggcggcgacgtgggcttgtccatgcatgggtacggcgtgtgccatactg1440

ccatcccatctcatcaagggccaggtgtggtatacgtgaatgtacatgcttatcgattga1500

atggagctaatcctctgcggtcatgttttgggcgtgccctagctaaccgaaatgaatcga1560

cccaagcatatctatcatttcaccggttgaccctacaagccagcgcaaccgcaatggtat1620

cagcagcccccggtcctatgattttgaggaccccaggtgaactagggcctctagactata1680

taaaaaaattctatcatatgcggcggaacaggttagcatttcataggtaaatgatgatgt1740

gcattgaaattagtttttaaaatatctaagacgctagataatatacattggtgcatatta1800

gctctttgcaggttaagaaataagaacgatggtcacaggataacctgaatccttattgcg1860

cgagcgtgcgtgcctagaggctagcgcccagtgccctggaatcctggagggttggatcag1920

tgaaatgacaaatgacgatcgcgtggagggtgtggtcgcacagacgcgcgacaatgtgag1980

cgtgacgactgggcaatggg2000

<210>2

<211>20

<212>DNA

The artificial primer of <213>

<400>1

agtcgtcacgctcacattgt20

<210>3

<211>20

<212>DNA

The artificial primer of <213>

<400>1

ggctcctgctccttcactga20

<210>4

<211>20

<212>DNA

The artificial primer of <213>

<400>1

Atagatgatagatacatcgg20

<210>5

<211>20

<212>DNA

<213> corn

<400>1

gatcgacggcctgagcagac20

Claims (6)

1. a corn embryosperm specific expression promoter NRP1 promotor, is characterized in that this promotor is one of one sequence:

I) nucleotide sequence shown in SEQIDNO.1;

Ii) the nucleotides sequence shown in SEQIDNO.1 be listed in retain core promoter sequence basis on be substituted, lack and/or add one or several Nucleotide and there is the nucleotide sequence derivative by the nucleotide sequence shown in SEQIDNO.1 of same function.

2. a carrier, is characterized in that this carrier contains corn embryosperm specific expression promoter NRP1 promotor according to claim 1.

3. a transgenic cell line, is characterized in that this clone contains corn embryosperm specific expression promoter NRP1 promotor according to claim 1.

4. an engineering bacteria, is characterized in that this project bacterium contains corn embryosperm specific expression promoter NRP1 promotor according to claim 1.

5. clone's corn embryosperm specific expression promoter NRP1 promotor according to claim 1; it is characterized in that the concrete steps of the method are: the base sequence ATG upstream sequence of corn embryosperm specific expression gene NRP1 being intercepted 2000bp; design primer; with B73 genome for template, namely obtain corn embryosperm specific expression promoter NRP1 promotor by pcr amplification; The primer sequence of described amplified fragments:

Forward primer is held to hold to 3 ' from 5 ': agtcgtcacgctcacattgt;

Reverse primer is held to hold to 3 ' from 5 ': ggctcctgctccttcactga.

6. a corn embryosperm specific expression promoter NRP1 promotor according to claim 1 is in the specific expressed application of regulation and control downstream gene in corn embryosperm.