CN105311045A - Application of ginsenoside Rg1 to preparation of medicines for prevention and/or treatment of myocardial ischemia - Google Patents
Application of ginsenoside Rg1 to preparation of medicines for prevention and/or treatment of myocardial ischemia Download PDFInfo
- Publication number
- CN105311045A CN105311045A CN201410378683.4A CN201410378683A CN105311045A CN 105311045 A CN105311045 A CN 105311045A CN 201410378683 A CN201410378683 A CN 201410378683A CN 105311045 A CN105311045 A CN 105311045A
- Authority
- CN
- China
- Prior art keywords
- ginsenoside
- minutes
- hole
- group
- myocardial ischemia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention relates to application of ginsenoside Rg1 to preparation of medicines for prevention and/or treatment of myocardial ischemia. The ginsenoside Rg1 is capable of improving myocardial energy metabolism and cardiac functions, reducing myocardial infarction area and increasing cardiac surface blood flow volume to realize treatment and prevention of myocardial ischemia.
Description
Technical field:
The present invention relates to a kind of application of medicine, particularly a kind of ginsenoside Rg1 is to the research of the improvement result of myocardial ischemia.
Background technology:
Coronary heart disease has occupied the front three of the fatality rate of China and external Main Developed Countries, and its sickness rate presents the trend risen year by year
[1].Acute myocardial infarction (AMI) is still the dead and disabled main cause in the whole world.After acute myocardial infarction occurs, percutaneous coronary intervention (pci) (percutaneouscoronaryintervention, PCI) has become treatment means the most frequently used clinically, although PCI can recover the perfusion of heart, but, the mortality rate of Stable Angina Pectoris can not be reduced
[2], Reperfu-sion itself can cause the process of cardiomyocyte cell death, is called reperfusion injury of cardiac muscle (ischemia/reperfusion, I/R), and the ischemical reperfusion injury that PCI causes is the main pathological basis that after getting involved, cardiac event appears in patient.Still effective therapy is not had at present.Many new therapeutic strategies at present just under study for action.Reperfusion injury of cardiac muscle is prevented to be expected to improve the Clinical Outcome of patient.
The mechanism of ischemical reperfusion injury is mainly the generation of free radical, microvascular damage, the overload of intracellular Ca2+, the generation of inflammatory factor, apoptosis of cardiac muscle, the activation etc. of platelet, neutrophilic granulocyte and complement
[3,4].Wherein play important role in the cardiac microcirculation disturbance that causes at I/R of abnormal energy metabolism, apoptosis, inflammatory reaction and myocardial tissue damage.The myocardial ischemia phase, because lacking oxygen and nutrient substance provides, add the low expression of ATP synzyme δ subunit ATP5D
[5], result in myocardial ATP and generate not enough.On the other hand, myocardium pump blood oxygen consumption, causes again ATP degraded and increases.ADP, AMP, hypoxanthine are piled up.ATP minimizing causes the F-actin of cytoskeleton thin myofilament polymerization to be obstructed further, and its ATP synzyme level is reduced further, and myocardial contraction declines
[6].It is one of the principal element of ischemic stage myocardial contraction egg white injury that ATP reduces.F-actin is the architecture basics of myocardium filament, and its degraded is the basis of cardiac muscle fiber damage.MLC2 is the dynein light chain on thick myofilament, and the phosphorylation of MLC2 can cause myocardial contraction diastolic function to lower.The myocardium myofilament skelemin of the peroxide breakdown of the abnormal energy metabolism that I/R causes and excessive generation
[7].Intervention or thrombolytic open blood fortune rear (Reperfu-sion), the water provided and oxygen, generate negative oxygen anion under the effect of hypoxanthine oxidase, and then generation hydrogen peroxide.In cell membrane phospholipid structure, unsaturated fatty acid produces lipid peroxidation, generates lipid peroxide, then decomposes generation malonaldehyde (MDA) through peroxidase, finally makes cell membrane phospholipid structure change.These reactive oxygen free radical (ROS) on the one hand can directly and immobilized artificial membrane, albumen and DNA direct reaction, cause cellularity destruction and function impaired
[8]; On the other hand, Nuclear factor kappa B (nuclearfactor κ B, NF-κ B) can be activated again, be started the expression of inflammatory factor and adhesion factor by NF-κ B, promote reacting to each other and swimming out of of leukocyte and vascular endothelial cell
[9], increase the weight of blood vessel and myocardial damage.Excessive ROS also can cause the long term open of mitochondrial depolarization and mitochondria permeability transition pore (mitochondrialpermeabilitytransitionpore, mPTP), causes the release of cytochrome c and the apoptosis of mitochondrion inducing cell
[10].
Rho kinases (Rho-kinase, ROCK) plays important role in apoptosis of cardiac muscle caused by heart ischemia reperfusion.ROCK is serine/threonine protein kitase family member, its molecular weight is approximately 160KD, ROCK can the phosphorylation/dephosphorylation reaction of a series of albumen of mediate downstream, and the stream substrates of the representational ROCK of most is Myosin light chain phosphatase (MLCP) and myosin phosphatase (MYPT-1).The Rho kinases of activation makes MYPT-1 phosphorylation, and make MLCP inactivation further, the MLCP of inactivation by myosin light chain (MLC) dephosphorylation, can not make the MLC of phosphorylation increase, cause myocardium shrinkage function obstacle.There are some researches show ROCK by regulating the function of PTEN, the activation of protein kinase A kt important in final T suppression cell
[11].At the Reperfu-sion initial stage, inhibit the activation of ROCK, can reduce myocardial infarction area, its mechanism relates to PI3K/Akt/eNOS approach
[12].Akt, is also referred to as protein kinase B (PKB), is the main effector in phosphatidyl-inositol 3-kinase (PI3K) downstream.PI3K/AKT signal path participates in an apoptotic important signal path.The PI3K of activation occurs with phosphorylation form, further activation Akt, AKT stream substrates is very many, comprise NF-κ B, VEGF (VEGF), Forkhead transcription factor (FOXO) etc., mostly be the factor promoting propagation, apoptosis inhibit, thus play Anti-G value.The Anti-G value that PI3K and downstream molecules thereof mediate has become the focus in drug research field.
Ginsenoside Rg1 (ginsenosideRg1, Rg1) is one of isolated monomer saponin in Radix Ginseng, has biologic activity widely.Large quantifier elimination shows that ginsenoside has impact to cardiovascular system, nervous system, immune system, can inhibited apoptosis, blood vessel dilating, improve the effects such as cardiac function, defying age, beauty treatment.Its mechanism of action relates to multiple signal transduction pathway, as ginsenoside Rg1 (ginsenosideRg1, Rg1) can suppress the oxidative damage of hypoxia/reoxygenation cardiac myocyte by raising superoxide dismutase
[13].Rg1 can also increase the angiogenesis of infarcted region by the level of increase rats with acute myocardial infarction VEGF, thus plays the effect of myocardial preservation
[14].Current research shows, Rg1 can suppress the autophagy of the myocardial cell of hypoxia/reoxygenation induction by the content and antioxidative effect increasing ATP in myocardial cell, thus plays the protective effect of cardiac muscle
[15].In addition, similar to Rb1 effect, Rg1 can reduce the cardiac myocyte hypertrophy that PGF-2 α induces
[16].The signal transduction path of proinflammatory factor in the cells such as NF κ B and MAPK that Rg1 can also suppress lipopolysaccharide (LPS) to be induced, and there is no the side effect of glucocorticoid
[17].But there is no the evidence of in vivo test at present, from energy metabolism, inflammation-inhibiting and apoptotic angle, inquire into ginsenoside Rg1 to the improvement result of myocardial ischemia-reperfusion injury.
The present invention furthers investigate ginsenoside Rg1 to the impact of cardiac function, is studied the effect of ginsenoside Rg1 on the myocardial model of ischemical reperfusion injury, and unexpected discovery ginsenoside Rg1 is to the release of pro-inflammatory mediator; Impact is had on indexs such as energy metabolism of myocardial, myocardial infarction area, cardiac muscular tissue F-actin dyeing, cardiac muscular tissue HE dyeing, myocardial ultrastructure, cardiomyocyte apoptosis and modulin, cardiac function, heart surface blood flows.
The present inventor on this basis, proposes conception of the present invention.
Summary of the invention:
The effect that the new purposes, particularly ginsenoside Rg1 that the invention provides a kind of ginsenoside Rg1 show on the myocardial model of ischemical reperfusion injury.The present invention proposes following application for this reason
Ginsenoside Rg1 is preparing the application prevented and/or treated in the medicine of myocardial ischemia.
Wherein, treating and/or preventing myocardial ischemia described in is that ginsenoside Rg1 improves energy metabolism of myocardial and cardiac function, minimizing myocardial infarction area, improves heart surface blood flow.
Wherein, described in treat and/or prevent myocardial ischemia be the cardiac muscle fiber damage that ginsenoside Rg1 can alleviate that I/R causes, suppress the apoptosis of cardiac muscle that I/R causes.
Wherein, treating and/or preventing myocardial ischemia described in is that ginsenoside Rg1 can the rising of ADP/ATP, AMP/ATP ratio that causes of the suppression I/R of significance.
Wherein, described in treat and/or prevent myocardial ischemia be the expression that ginsenoside Rg1 can improve ATP-5DmRNA and albumen in cardiac muscle, reduce the phosphorylation level of MLC.
Wherein, the rising that myocardial ischemia is the MDA content that ginsenoside Rg1 can suppress I/R to cause is treated and/or prevented described in.
Wherein, to treat and/or prevent myocardial ischemia described in be ginsenoside Rg1 to the release of pro-inflammatory mediator and apoptosis inhibited.
Wherein, described in treat and/or prevent myocardial ischemia be that ginsenoside Rg1 can improve the reduction of NF-κ BP65 level in I/R group myocardial cell slurry, in nucleus, the expression of NF-κ BP65 raises.
Wherein, the enhancing that myocardial ischemia is MPO, ICAM-1, CD18 expression that ginsenoside Rg1 can suppress I/R to cause is treated and/or prevented described in; TUNEL positive cell number in cardiac muscular tissue can be suppressed, promote the expression of anti-apoptotic proteins Bcl-2, suppress the expression of pro apoptotic protein Bax and cleaved-Caspase-3.
Wherein, the phosphorylation level of activation that myocardial ischemia is the ROCK that ginsenoside Rg1's preventive administration can suppress I/R to cause and its substrate MYPT-1 is treated and/or prevented described in.
Ginsenoside Rg1 of the present invention comprises the ginsenoside Rg1 of commercially available purity at 10%-98%, also by prior art extraction and isolation.
Preferred purity of the present invention more than 50%, preferably more than 80%, select more than 90% most.
The ginsenoside Rg1 used in the present invention's experiment obtains for market is bought, and purity is more than 90%.
Application of the present invention.Wherein said medicine refers to the pharmaceutical composition comprising ginsenoside Rg1, is the pharmaceutical preparations composition be prepared into as active constituents of medicine with ginsenoside Rg1 described above.It is preferably sole active agent with ginsenoside Rg1.
Pharmaceutical preparations composition of the present invention, can contain medicine acceptable carrier as required, wherein ginsenoside Rg1 is as active constituents of medicine, its in the formulation shared percentage by weight can be 0.1-99.9%, all the other are medicine acceptable carrier.Pharmaceutical preparations composition of the present invention, exists in a unit, and described unit dosage form refers to the unit of preparation, as every sheet of tablet, and every capsules of capsule, every bottle of oral liquid, granule every bag, often propping up of injection.
Pharmaceutical preparations composition of the present invention can be any pharmaceutically useful dosage form, and these dosage forms comprise: tablet, sugar coated tablet, film coated tablet, enteric coated tablet, capsule, hard capsule, soft capsule, oral liquid, suck agent, granule, electuary, pill, powder, unguentum, sublimed preparation, suspensoid, powder, solution, injection, suppository, ointment, plaster, cream, spray, drop, patch.
Chinese medicine preparation of the present invention, the preparation of its oral administration can containing conventional excipient, and such as binding agent, filler, diluent, tablet agent, lubricant, disintegrating agent, coloring agent, flavoring agent and wetting agent, can carry out coating to tablet if desired.
The filler be suitable for comprises cellulose, mannitol, lactose and other similar filler.Suitable disintegrating agent comprises starch, polyvinylpyrrolidone and starch derivatives, such as sodium starch glycollate.Suitable lubricant comprises, such as magnesium stearate.The suitable acceptable wetting agent of medicine comprises sodium lauryl sulphate.
By mixing, fill, the method that tabletting etc. are conventional prepares solid oral composition.Repeatedly mix and active substance can be made to be distributed in those compositionss of a large amount of filler of whole use.
The form of oral liquid can be such as aqueous or oily suspensions, solution, Emulsion, syrup or elixir, or can be the composite dry products of a kind of available water before use or other suitable carrier.This liquid preparation can containing conventional additive, such as suspending agent, such as sorbitol, syrup, methylcellulose, gelatin, hydroxyethyl-cellulose, carboxymethyl cellulose, aluminium stearate gel or hydrogenated edible fats, emulsifying agent, such as lecithin, anhydro sorbitol monooleate or arabic gum; Non-aqueous carrier (they can comprise edible oil), the oily ester of the such as ester of almond oil, fractionated coconut oil, such as glycerol, propylene glycol or ethanol; Antiseptic, such as para hydroxybenzene methyl ester or propyl p-hydroxybenzoate or sorbic acid, and if need, can containing conventional flavouring agent or coloring agent.
For injection, the fluid unit dosage form of preparation contains active substance of the present invention and sterile carrier.According to carrier and concentration, this compound can be suspended or dissolve.The preparation of solution is normally by being dissolved in a kind of carrier by active substance, filter-sterilized before being loaded a kind of suitable bottle or ampoule, then seals.Adjuvant such as a kind of local anesthetic, antiseptic and buffer agent also can be dissolved in this carrier.In order to improve its stability, by freezing for this compositions after loading bottle, and under vacuo water can be removed.
Chinese medicine preparation of the present invention, applicable medicine acceptable carrier is optionally added when being prepared into medicament, described medicine acceptable carrier is selected from: mannitol, sorbitol, sodium pyrosulfite, sodium sulfite, sodium thiosulfate, cysteine hydrochloride, TGA, methionine, vitamin C, EDETATE SODIUM, Ethylenediaminetetraacetic Acid Calcium Salt, the alkali-metal carbonate of monovalence, acetate, phosphate or its aqueous solution, hydrochloric acid, acetic acid, sulphuric acid, phosphoric acid, aminoacid, sodium chloride, potassium chloride, sodium lactate, xylitol, maltose, glucose, fructose, dextran, glycine, starch, sucrose, lactose, mannitol, silicon derivative, cellulose and its derivates, alginate, gelatin, polyvinylpyrrolidone, glycerol, POLYSORBATE 80, agar, calcium carbonate, calcium bicarbonate, surfactant, Polyethylene Glycol, cyclodextrin, beta-schardinger dextrin-, phospholipid material, Kaolin, Pulvis Talci, calcium stearate, magnesium stearate etc.
Preparation of the present invention according to the situation determination usage and dosage of patient, can take three every day in use, each 1-20 agent, as: 1-20 bag or grain or sheet, and every agent 1mg-1000mg.
Therapeutic use of the present invention is proved by following experiment:
2 materials and methods
2.1 laboratory animal
Male SD rat, body weight 240-260g, is divided into 4 groups at random by 144, often organizes 36, is respectively sham operated rats (Sham); Background group (Rg1+Sham); Model group (I/R); Pre-administration group (Rg1+I/R).Be purchased from Department Of Medicine, Peking University's animal center, the quality certification number: SCXK (capital) 2006-0008.Animal feeding is in SPF level animal housing, and temperature is 22 ± 2 DEG C, and humidity is under the condition of 40 ± 5%, free diet, drinking-water, and 12 h light/dark alternately.Animal fasting 12 hours before experiment, but can freely drink water.
2.2 medicine
Rg1 buys from Kunming Fengshanjian Medicine Research Co., Ltd. (Yunnan, China), and purity is (>98%), and 4 DEG C save backup, physiological saline solution during use.Rg1 dosage is 1mg/kg, 5mg/kg, 10mg/kg, is dissolved in 2.5ml normal saline on pretreatment, and concentration is 0.25mg/mL, 1.25mg/mL, 2.5mg/mL matching while using.
2.3 key instruments:
(1) just fluorescence microscope is put: U25LBD, Olympus, Tokyo, Japan;
(2) hypersensitization photographic head: USS-301, UNIQVision, CA, the U.S.;
(3) mercury lamp light source: OLYMPUS, 220-240V, 1.8A, 50-60Hz, Tokyo, Japan;
(4) colour imagery shot: TK-C920EC, JVC, Tokyo, Japan;
(5) color video monitor: 20PF5120, PHILIPS, Tokyo, Japan;
(6) image synthesizer: SP-460colorquadprocessor, SUNSPO, Tokyo, Japan;
(7) DVD burner: DVDR560H/93, PHILIPS, Tokyo, Japan;
(8) time video display units: VTG-33, FOR.A, Tokyo, Japan;
(9) cold light source: SJ8038HA2, SANJUN, Beijing, China;
(10) thermostat water bath: HW-SY11-K1, mayor of Beijing bearing instruments and meters company, China;
(11) 4 DEG C of centrifuges: Centrifuge5417R, Eppendorf, Hamburg, Germany;
(12) high speed centrifuge: Allegra64R, Beckman, PaloAlto, CA, the U.S.;
(13) analytical balance: CP64, SartoriusAG, Goettingen, Germany;
(14) laser confocal microscope: Radiance2100, Bio-Rad, Hercules, CA, the U.S.;
(15) multi-functional microplate reader (Gene5): Synergy2, Bio-Rad, Hercules, CA, the U.S.;
2.4 reagent and preparation
(1) urethane: produce purchased from Shanghai Chemical Reagent Co., Ltd., Sinopharm Group, lot number: T20090119, becomes 20% solution with normal saline, room temperature is preserved;
(2) 2,3,5-triphenyltetrazolium chlorides (2,3,5-triphenyltetrazoliumchloride, TTC): purchased from American AMRESCO company limited, is dissolved as the solution of concentration 2.0%, room temperature preservation with phosphate buffer;
(3) Yi Wensishi indigo plant (Evansblue): available from Sigma, normal saline becomes 4% solution;
(4) PBS: purchased from Beijing Bioisystech Co., Ltd of Zhong Shan Golden Bridge, before using, often bag adds distilled water and is settled to 2L, and after fully dissolving, subpackage is stand-by;
(5) dimethyl sulfoxide (DMSO): Sigma, St.Louis, Mo, the U.S.;
(6) Dichlorofluorescein (DCFH-DA): lot number: D6883, Sigma, St.Louis, MO, the U.S., storage liquid DMSO is mixed with 50mM, uses final concentration to be 5 μMs;
(7) Hoechst33342:Invitrogen, St.Louis, MO, the U.S., storage liquid 1mg/ml, final concentration is 10 μ g/ml;
(8) RIPA lysate: 40mMTris, 8Murea, 4%w/vCHAPS, 60mMDTT and 1mMPMSF (isopropyl alcohol dissolves, and faces the used time and now adds);
(9) 10 × TBS:Tris121.14g, NaCl90g, hydrochloric acid is adjusted to pH7.5, ddH
2o to 1000ml;
(10) 1.5mol/LTris-Cl (pH8.8): take 18.17gTris-Cl, first add ddH
2o is about 80ml, is adjusted to pH8.8 with 2MHCl, is finally settled to 100ml;
(11) 0.5mol/LTris-Cl (pH6.8): take 6gTris-Cl, first add ddH
2o is about 50ml, is adjusted to pH6.8 with 2MHCl, is finally settled to 100ml;
(12) 4% paraformaldehydes: claim 4g paraformaldehyde to be dissolved in 0.1MPBS, be heated to 60 DEG C, drip 1MNaOH, stirring and dissolving, to transparent, is settled to 100ml;
(13) 12% separation gel: ddH
2o3.35ml, 1.5mol/LTris-HCl (pH8.8) 2.5ml, 10%SDS100 μ l, 30%Acr/Bis4.0ml, 10%APS100 μ l, TEMED5 μ l;
(14) 5% concentrated glue: ddH
2o6.8ml, 1.0mol/LTris-HCl (pH6.8) 1.25ml, 10%SDS100 μ l, 30%Acr/Bis1.65ml, 10%APS100 μ l, TEMED10 μ l;
(15) electrotransfer buffer: Tris alkali 3.03g, glycine 14.4g, methanol 200ml, adds ddH
2o is settled to 1000ml;
(16) 5%-TBS defatted milk powder: defatted milk powder 2.5g, is dissolved in 1 × TBS to final volume 50ml;
(17) 0.05%TBS-T: polysorbas20 100 μ l is dissolved in 1 × TBS to final volume 200ml;
(18) other general chemistry reagent is analytical reagent, purchased from Chemistry In China drug company.
The foundation of 2.5 rat heart I/R models and medication
Rat 2% urethane (2.0g/kg) intramuscular anesthesia.Rat dorsal position fixed, per os circulation of qi promoting cannula, intubate another end and toy respirator (ALC-V8, Shanghai, China) are connected, row pressure breathing (ventilation is 20 for respiratory quotient 1:1, respiratory frequency 80/ minute).After open chest surgery, expose heart, cut off pericardium, with being installed with sutural 3/8 looper of 5-0 through left anterior descending coronary artery (pulmonary conus and left auricle have a common boundary and slightly descend 1-2mm), between stitching thread and cardiac muscular tissue, put a cotton thread, ligation stitching thread causes ischemia.Ligation, after 30 minutes, is untied stitching thread and is namely carried out Reperfu-sion, and the Reperfu-sion persistent period is 90 minutes.Rats in sham-operated group, except only threading not ligation, other operation is all identical with model group.Left femoral vein intubate is for injecting Rg1 or normal saline.Rg1 dosage is 1mg/kg, 5mg/kg, 10mg/kg, is dissolved in 2.5ml normal saline on pretreatment, matching while using.Administering mode is: ligation first 30 minutes left femoral vein start to pump into normal saline or drug solution 1,5,10mg/kg, with the speed continuous intravenous pumping of 1ml/h, until Reperfu-sion terminates for 90 minutes.
The number of animals that table 1. divides into groups and each index is used
2.6TTC and AZO-blue dyeing
Reperfu-sion is after 90 minutes, and the following coronary artery occlusion left anterior descending branch again in identical position, by femoral vein bolus 4%EvansBlue2ml; After treating that heart becomes basket, heart is taken out, PBS rinses, wash loose colour off, heart is put into-80 DEG C to take out after 5 minutes, by the direction of apex to ligature, 5 thin slices becoming 1mm thick heart crosscut, put into the TTC dye liquor of 2.0%, hatch 15 minutes for 37 DEG C, with Image-Proplus5.0 (MediaCybernetic, Maryland, USA) image analysis software measures Infarct area (InfarctArea, IA) in each thin slice, ischemic region area (AreaatRisk, and left ventricular area (LeftVentricularArea, LA) AAR).Heart and injury degree is represented, by the weight of ischemic areas/left ventricular area × 100 reaction experiment maneuver by Infarct area/ischemic areas × 100%.
The mensuration of 2.7 heart surface blood flows
Rat opens breast, is exposed completely by heart, with laser-Doppler perfusion weighted imaging instrument PeriScanPIM3 (PeriScanPIM3System; PERIMED, Sweden) rat left ventricle blood flow is detected, before being recorded in ischemia (Baseline), heart surface blood flow when ischemia 30 minutes and Reperfu-sion 10 minutes, 30 minutes, 60 minutes, 90 minutes, each point in time measurement 3 times.With LDPIwin3.1 (PeriScanPIM3System; PERIMED, Sweden) image is measured and data assessment, get 3 measurements.Be worth based on left ventricle groundwater increment before I/R, calculate the rate of change of left ventricle groundwater increment.
2.8 hemodynamics detect cardiac function
(1) rat dorsal position fixed, per os circulation of qi promoting cannula, intubate another end and toy respirator, respiratory quotient 1:1, respiratory frequency 80/ minute, ventilation is 20;
(2), after open chest surgery, expose heart, through right carotid artery intubate, be filled with the heparin sodium of 5mg/ml in pipe, the other end of conduit and biological functional system (BL-420F, Chengdu, China) connect.During intubate, pipe does not rotate, and when there being the sense that obviously falls through, the blood pressure waveform of biological function system log (SYSLOG) rises and falls and obviously increases suddenly simultaneously, proves that intubate enters left ventricle;
(3), after intubate success, closed by the tee T connecting heparin sodium, the blood pressure now recorded is left ventricular pressure;
(4) hemodynamics module is selected, treat that curve is stablized, modeling is started after the pressure value of record one section of baseline, continuous monitor heart rate (heartrate in rat heart I/R process, HR), left ventricular systolic pressure (leftventricularsystolicpressure, LVSP), left ventricular diastolic pressure (leftventriculardiastolicpressure, LVDP), ventricular end diastolic pressure (leftventricularenddiastolicpressure, LVEDP), the maximum climbing speed of left indoor pressure (leftventriculardevelopedpressure (max), dp/dt), the maximum fall off rate of left indoor pressure (leftventriculardevelopedpressure (min),-dp/dt),
(5) ligation unties ligation first after 30 minutes, then fills with, in the process of Reperfu-sion, keep pipeline unobstructed, if wave-shape amplitude is more and more less, represent that blood coagulation blocks pipeline, Xiang Guanzhong fills one section of heparin sodium, washes pipeline open;
(6) Reperfu-sion is after 90 minutes, arterial cannulation is dropped back by left ventricle, moves to right common carotid artery, to measure systolic arterial pressure (arterysystolicpressure, and mean arterial pressure (meanarterypressure, MAP) ASP).
2.9 tectology dyeing
2.9.1 paraffin section preparation
(1) Reperfu-sion is after 90 minutes, cuts heart, operates on ice, with rinsing heart surface and inner blood in normal saline.With eye scissors, heart atrium and auricle are cut;
(2) paraformaldehyde solution being placed in 4% of new preparation fixes 48 hours, notes often shaking in fixing process, and fixing volumetric ratio is 20-30 times;
(3) heart after fixing is pruned, and goes out to cut, ensure that heart upper limb flushes with blade from 5mm cross section above the apex of the heart;
(4) be stained with dry by the formaldehyde filter paper of heart surface, tri-distilled water cleans, and scavenging period is 12 hours, and cleaning process will often be shaken, and changes a tri-distilled water at 6 hours;
(5) through 70% ethanol, 80% dehydration of alcohol 24 hours, 95% dehydration of alcohol 12 hours, 100% dehydration of alcohol 6 hours, changed an ethanol at 3 hours, will constantly shake in dehydration;
(6) after dehydration terminates, dry with the ethanol of filter paper by heart surface, entered by tissue in dimethylbenzene, clearing time is 1 hour, will the transparency of tissues observed at any time in clearing process;
(7) the electric drying oven with forced convection temperature of waxdip is decided to be 60 DEG C, within 5-6 hour, opens in advance, wax is melted.Dry with the dimethylbenzene of filter paper by surface, action is wanted soon, and dimethylbenzene can not be made to volatilize dry, waxdip total time is 3 hours, within each hour, changes once new wax, and the volumetric ratio of waxdip is 20-30 times;
(8) embed, tissue is placed in the mould taking advantage of full paraffin, makes whole organizing all immerse in paraffin, to be placed in cold water until paraffin, wax stone is taken out from mould;
(9) repair wax stone, be trimmed to by wax stone trapezoidal, tissue will reserve enough borders around, is positioned in 4 DEG C and preserves;
(10) being finally prepared into paraffin mass is placed in microtome, is cut into the section of 5 μm, is put in drift sheet machine and launches, invest on the microscope slide of poly-D-lysine bag quilt by the wax disk(-sc) of flattening jail;
(11) roasting sheet is wanted in time, must put in an oven before naturally doing, otherwise occurs the situation of turning white.The temperature of roasting sheet is 37 DEG C, spends the night.
2.9.2 hematoxylin-eosin stains
(1) paraffin section dewaxes, and dewaxes 15 minutes in dimethylbenzene I, dewaxes 10 minutes in dimethylbenzene II;
(2) after dewaxing, to cut into slices in 100% ethanol I 5 minutes, to transfer in 100% ethanol II 3 minutes;
In (3) 95% ethanol I 3 minutes, in 95% ethanol II 2 minutes;
In (4) 80% ethanol 2 minutes;
1-2 minute in (5) 70% ethanol;
(6) distillation washing 2-3 time, washing is gently propose section up and down gently, washes 5 minutes at every turn;
(7) Harris brazilwood extract dyeing 5-10 minute;
(8) distillation washing, gently carries up and down and washes several times;
(9) break up with 1% hydrochloride alcohol, gently carry several times up and down;
(10) distillation washing, gently carries several times up and down;
(11) 1% ammonia return indigo plant, and Microscopic observation is cut into slices, and control to return the blue time;
(12) distillation washing, gently carries several times up and down;
(13) eosin stains, the time is 3-5 second, if desired can Microscopic observation;
(14) distillation washing, gently carries several times up and down;
(15) carry out breaking up dehydration of holding concurrently with 80% ethanol, differentiation phase Yihong color can shoal, and notes often observing color, checks if desired under mirror;
(16) 95% ethanol dewater, dewatering time 5 minutes, and the time, oversize meeting was faded, and notice that the moment observes color;
(17) 100% ethanol I dewater 5 minutes, and 100% ethanol II dewaters 3 minutes;
(18) in dimethylbenzene I 5 minutes, in dimethylbenzene II 10 minutes;
(19) use neutral gum mounting, carry out observing and taking pictures with Photobiology microscope (DigitalSightDS-5M-U1, Nikon, Tokyo, Japan).
2.10 fluorescent immunohistochemistry
(1) Reperfu-sion is after 90 minutes, opens thoracic cavity, and take out heart, the paraformaldehyde solution being placed in 4% fixes 48 hours, through dehydration, transparent, waxdip, embedding, prepares wax stone, is finally prepared into paraffin section.
(2) paraffin section dewaxes, and dewaxes 15 minutes in dimethylbenzene I, dewaxes 10 minutes in dimethylbenzene II;
(3) after dewaxing, to cut into slices in 100% ethanol I 5 minutes, to transfer in 100% ethanol II 3 minutes;
In (4) 95% ethanol I 3 minutes, in 95% ethanol II 2 minutes;
In (5) 80% ethanol 2 minutes;
1-2 minute in (6) 70% ethanol;
(7) distill washing 1 time, washing is gently propose section up and down gently, washes 5 minutes;
(8) carry out antigen retrieval with the sodium citrate of 0.01M, liquor sodii citratis is filled it up with, and specimen is towards one side, and lid is opened, and uses microwave oven to be warmed up to 90 DEG C, then suspends, put into specimen, and regulate firepower to 60, the time is 10 minutes;
(9) room temperature natural cooling, is generally 2 hours;
(10) PBST wash buffer 3 times, each washing time is 5 minutes.
(11) incubator is opened in advance, be warmed up to 37 DEG C, with phalloidin (1:40, R415, Invitrogen, California, USA) labelling cardiac muscle F-actin, 1:40PBS dilutes, and the amount of liquid that each heart tissue needs is 50 μ l, and in 37 DEG C of climatic chambers, lucifuge hatches 1 hour;
(12) PBS washes 3 times, and each time is 5 minutes, wants lucifuge in operating process;
(13) with Hoechst33342 (1:100, MolecularProbes) labeled cell core, Hoechst PBS dilutes, and the amount of liquid of each organization need is 50 μ l, and under room temperature, lucifuge hatches 10 minutes;
(14) PBS washes 3 times, and each time is 5 minutes, wants lucifuge in operating process;
(15) carry out mounting by anti-fluorescent quenching mountant, scheme upper nial polish around after mounting, anti-slip limiting plate;
(16) with laser scanning co-focusing microscope (TCSSP5, Leica, Mannheim, Germany), at 40 times of thing Microscopic observations and taking pictures.
The TUNEL dyeing of 2.11 myocardial cell
(1) Reperfu-sion is after 60 minutes, opens thoracic cavity, and take out heart, the paraformaldehyde solution being placed in 4% fixes 48 hours, through dehydration, transparent, waxdip, embedding, prepares wax stone, is finally prepared into paraffin section;
(2) paraffin section dewaxes, and dewaxes 15 minutes in dimethylbenzene I, dewaxes 10 minutes in dimethylbenzene II;
(3) after dewaxing, to cut into slices in 100% ethanol I 5 minutes, to transfer in 100% ethanol II 3 minutes;
In (4) 95% ethanol I 3 minutes, in 95% ethanol II 2 minutes;
In (5) 80% ethanol 2 minutes;
1-2 minute in (6) 70% ethanol;
(7) distill washing 1 time, washing is gently propose section up and down gently, washes 5 minutes;
(8) carry out antigen retrieval with the sodium citrate of 0.01M, liquor sodii citratis is filled it up with, and specimen is towards one side, and lid is opened, and uses microwave oven to be warmed up to 90 DEG C, then suspends, put into specimen, and regulate firepower to 60, the time is 10 minutes;
(9) room temperature natural cooling, is generally 2 hours;
(10) PBS wash buffer 3 times, each washing time is 5 minutes;
(11) apoptotic cell is detected with TUNEL (the Nick End labelling method of Deoxydization nucleotide terminal transferase mediation) staining, original position apoptosis detection kit (Roche is selected in experiment, Basel, Switzerland), TUNEL reactant liquor is prepared according to 1:9, the amount of liquid that individual heart tissue needs is 50 μ l, and in 37 DEG C of climatic chambers, lucifuge hatches 1 hour;
(12) PBS washes 3 times, and each time is 5 minutes, wants lucifuge in operating process;
(13) with Hoechst33342 (1:100, MolecularProbes) labeled cell core, Hoechst PBS dilutes, and the amount of liquid of each organization need is 50 μ l, and under room temperature, lucifuge hatches 10 minutes;
(14) PBS washes 3 times, and each time is 5 minutes, wants lucifuge in operating process;
(15) carry out mounting by anti-fluorescent quenching mountant, scheme upper nial polish around after mounting, anti-slip limiting plate;
(16) 5 visuals field are chosen in left ventricular ischemia region, with laser scanning co-focusing microscope system (Axiovert200M, CarlZeiss, Jena, Germany), under 63 times of object lens, carry out observing and taking pictures, wherein nuclei dyeing au bleu, and the nucleus of the TUNEL positive is green.
2.12 western blot analysis
2.12.1 the extraction of histone
(1) ischemic myocardial tissue deposited in-80 DEG C of refrigerators is taken out, be placed on ice, make to be organized in and thaw on ice, tissue scissors are shredded, is placed in tinfoil and wraps;
(2) after being wrapped by tissue tinfoil, carry out group labelling, drop in liquid nitrogen, the time can not be too short, about 20 minutes;
(3) be organized in liquid nitrogen during this period of time in, the lysate of obtain solution, 10 × RIPA lysate adds Cocktail protease inhibitor according to 1:100;
(4) tissue is taken out from liquid nitrogen, smash, being organized in of pulverizing was transferred in centrifuge tube before melting, weighs;
(5) according to the lysate adding 10ml in 1g tissue, be placed on ice, carry out abundant cracking;
(6) take the DMSF of 0.0174g, be dissolved in the isopropyl alcohol of 1ml, mixing;
(7) according to the DMSF adding 100 μ l in 1g tissue, and carry out ultrasonic;
(8) by the power adjustments of Ultrasound Instrument to AMP50%, carry out ultrasonic, each ultrasonic 5-7 second, midfeather 10 seconds;
(9) centrifugal, must trim time centrifugal, rotating speed is 13000rpm, and centrifugation time is 30 minutes;
(10) get supernatant, according to supernatant volume, add 5 × sample-loading buffer, in boiling water, boil 20 minutes.Put into-80 DEG C of preservations.
2.12.2 the mensuration of protein concentration
(1) taking BSA adds in tri-distilled water, is dissolved into the protein standard substance of 2.0mg/ml completely, is 1.5mg/ml, 1.0mg/ml, 0.75mg/ml, 0.5mg/ml, 0.25mg/ml, 0.125mg/ml with tri-distilled water dilution;
(2) dilute sample, heart tissue generally dilutes 20 times, and final volume is 60 μ l, i.e. add the tri-distilled water of 57 μ l in the sample of 3 μ l;
(3) add 1 volume BCA reagent B (50:1) by 50 volume BCA reagent A and prepare appropriate BCA working solution, fully mix;
(4) in the pipe of each sample, all add the protein quantification liquid of 200 μ l, mixing, puts into 37 DEG C of incubator 20min, opens microplate reader preheating;
Each hole of (5) 96 orifice plates add 200 μ l hatch after solution;
(6) measure at microplate reader 560nm place.Protein concentration is calculated according to standard curve.
2.12.3 glue and loading
(1) prepare 12%SDS-PAGE separation gel, injecting edge strip thickness after mixing is between two blocks of cleaned glass plates of 1.5mm, it adds skim isopropyl alcohol, and left at room temperature is to cohesion;
(2) after glue to be separated is polymerized completely, blot isopropanol layer, and by tri-distilled water wash clean isopropanol layer, pour into 5% concentrated glue, insert application of sample comb, left at room temperature.After glue solidifies completely, extract comb, with electrophoresis wash buffer well several;
(3) install electrophoresis tank, perfusion electrophoretic buffer, adds the sample handled well in well according to predetermined order.
2.12.4 electrophoresis, transferring film and dyeing
(1) power supply of gel-electrophoretic apparatus is connected, initial voltage 80V;
(2) leading edge of Bromophenol Blue dye improves voltage to 120V after entering separation gel upper limb, continues the lower edge of electrophoresis separation gel until bromophenol blue is swum out;
(3), after electrophoresis terminates, take off PAGE glue and be soaked in transfering buffering liquid;
(4) get the capable methanol of the pvdf membrane onesize with glue to activate, together with filter paper and sponge to be soaked in transfering buffering liquid more than 10 minutes stand-by;
(5) successively sponge, three metafiltration paper, pvdf membrane, gel, three metafiltration paper and sponge are put well in plastic splint with sandwich assay, catch up with the bubble between clean each layer with Glass rod;
(6) plastic splint is put into electric turn trough, with gel near negative pole, pvdf membrane, near positive pole, finally covers electric turn trough with trash ice, 200mA constant current transferring film 2 hours;
(7) be soaked in by pvdf membrane in Ponceaux dye liquor, jolting is dyeed 10 minutes;
(8) after protein band occurs, with the Ponceaux background color on deionized water rinsing pvdf membrane;
(9) according to the Position Approximate of albumen Marker estimation purpose albumen, the pvdf membrane of clip corresponding site.
2.12.5 immune detection
(1) pvdf membrane is placed in confining liquid, jog 1 hour under room temperature;
(2) pvdf membrane is enclosed in plastic bag, add the primary antibodie of being diluted by confining liquid, remove all bubbles, 4 DEG C of shaken over night;
(3) film is washed with TBST, 15 minutes × 3 times;
(4) enclose in plastic bag by pvdf membrane, add the alkali phosphatase enzyme mark diluted by confining liquid corresponding two resist, and remove all bubbles, room temperature shake 1-1.5 hour;
(5) film is washed with TBST, 15 minutes × 3 times.
2.12.6 chemiluminescence and exposure
(1) two kinds of reagent in chemical luminescence reagent kit ECL (Puli's Lay, Beijing, China) are respectively got 1ml, mix in the ratio of 1:1, shake with film in darkroom and hatch 3 minutes;
(2) by all bands, put into Puli's Lay lucifuge film magazine and expose, put into 2-3 and open film, compress lid;
(3) take out film, the X-ray with colour developing band scans, and uses KODAK exposure system (KODAKMedicalX-RayProcessor) to detect.The relative intensity of each band is normalized by the β-actin of its correspondence, and with using image analysis software Bio-RadQuantityOnesoftware (Bio-Rad, California, USA) semi-quantitative analysis is carried out, statistics is worth based on the value of GADPH, and result used is the result repeating for three times to test.
The required antibody of table 2.WesternBlot experiment
2.13mRNA extracts and reverse transcription real-time quantitative PCR
2.13.1RNA extract
2.13.1.1 preparation and solution preparation
(1) rotary head of cracking tissue was first used for 75% soak with ethanol one night, then use DEPC water soaking 2 hours, just may be used for experiment;
(2) table top experiment estrade gauze being stained with the super-clean bench of 75% ethanol is wiped clean, and notes ventilation to open, discharges the dust of vent.By general 4-5 time of alcohol wipe, ensure all clean after with DEPC water wiping desktop, DEPC water will wear double gloves and mask to health is harmful;
(3) before the experiments, with ultraviolet radiation about 30 minutes;
(4) size of drawing materials be less than 30mg;
(5) before adding BufferRLT homogenate, tissue is not allowed to melt;
(6) DNAseI cannot shake mixing, mixing of can only turning upside down gently.With the DNAseI of the RNase-freewater dissolved solid of 550 μ l, ensure not lose any DNaseI when noting opening pipe.Should be injected in the bottle of DNase I with the RNasefreewater of the syringe of an import by 550 μ l, put upside down mixing gently;
(7) may there is precipitation after storage in BufferRLT, can heat and precipitation is dissolved again, then room temperature is cooled to, BufferRLT will add the β mercaptoethanol (10 μ l β mercaptoethanols join the RLTbuffer of 1ml) of 14.3M before the use, matching while using;
(8) before use BufferRPE, add 100% ethanol of 4 volumes according to the explanation on bottle, the RPE of a whole bottle is all added ethanol, on lid, then beat a hook, indicate and add ethanol.
2.13.1.2 experimental procedure
(1) water-bath is heated to 55 DEG C, prepares the 7th step and use;
(2) from liquid nitrogen, tissue is taken out;
(3) determine that the amount of tissue is no more than 30mg;
(4) carry out the 5th step operation by organizing to be placed in applicable pipe, if only need a part for tissue to cut required tissue so as early as possible, put into suitable pipe and carry out the 5th step operation, action must be fast;
(5) tissue is placed in suitable pipe, adds the BufferRLT (add mercaptoethanol, matching while using, polygamy 100 μ l prevents not) of 300 μ l.Homogenate is abundant, general 20-40 second, need not be placed on ice, after each even complete tissue, check and whether be stuck in the inside in a organized way in drill bit;
(6) in homogenate, add the RNase-freewater of 590 μ l, then add the ProteinaseKsolution of 10 μ l, pressure-vaccum mixes, and complete one of homogenate just adds one, prevents RNA from degrading;
(7) heat 10 minutes in 55 DEG C;
(8) centrifugal at 20-25 DEG C, speed is 10000g, 3 minutes time, has a small amount of precipitation and generates, sometimes form skim on solution upper strata;
(9) drawing in the centrifuge tube of the general 900 μ l to another one 1.5ml or 2ml of supernatant, try not to be drawn onto precipitation, should rifle head be inserted under the thin layer of liquid level when sucting clearly;
(10) add 0.5 volume, the ethanol of general 450 μ l, in supernatant, puts upside down mixing gently, not centrifugal, may form precipitation, but can not affect experimental result after adding ethanol;
(11) sample (can comprise the precipitation of formation) drawing 700 μ l enters the collecting pipe that RNaseMiniSpinColumn puts into 2ml, puts on group at Guan Gai.Centrifugal 10000g, the time is 15 seconds, removes flow-through;
(12) repeat the 11st step, remaining sample is carried out the operation of the 11st step, collectiontube also uses in the 13rd step;
(13) BufferRW1 inhaling 350 μ l joins in RNaseMiniSpinColumn, centrifugal 10000g, and the time is 15 seconds, discards flow-through, and collectiontube also will use in 15 again;
(14) add in the BufferRDD of DNaseIstocksolution to 70 μ l of 10 μ l, mixing of turning upside down gently after preparing, ten million can not shake, and all puts back in the refrigerator of 4 DEG C after adding by the whole box of DNase, preserves;
(15) DNaseIincubationmix drawing 80 μ l is directly added on RNeasysilica-gelmembrane, then be placed on room temperature on platform and place 15 minutes, guarantee directly to be added on film, it is insufficient that the MIX as fruit part is stained with to wall or O-ring, DNA can digest;
(16) draw in BufferRW1350 μ l to RNaseMiniSpinColumn, centrifugal 10000g, the time is 15 seconds, discards flow-through and collectiontube;
(17) RNaseMiniSpinColumn is put into the collectiontube of a new 2ml.Draw the BufferRPE (adding ethanol) of 500 μ l to RNaseMiniSpinColumn, pass upper orifice gently, centrifugal >8000g, the time is 15 seconds, rinses column, discards flow-through;
(18) BufferRPE (adding ethanol) of 500 μ l is drawn to RNaseMiniSpinColumn, pass upper orifice gently, centrifugal >8000g, time is 2 minutes, allow RNeasysilica-gelmembrane become dry, after centrifugal end, column is removed from collectiontube, make column not touch flow-through, prevent from carrying ethanol;
(19) in order to not residual ethanol, discard collectiontube and flow-through just now, change a new collectiontube, centrifugal one minute of 10000g on microcentrifuge, make RNeasysilica-gelmembrane become dry as far as possible, collecting pipe is not thrown away, and collects and is always used in this step;
(20) RNaseMiniSpinColumn is placed on a new 1.5mlcollectiontube, the RNase-freewater drawing 30-50 μ l is directly added to RNeasysilica-gelmembrane.Gently shut pipe lid, centrifugal 10000g, the time is 1 minute;
(21) if the output of required RNA is greater than 50 μ g, so repeat the 20th step, wash in same collecting pipe.Need not new water, just passable with the water just washed;
(22) with new PCR pipe subpackage, often pipe 5-8 μ l ,-80 DEG C of preservations.
2.13.1.3 the concentration determination of total serum IgE
(1) draw appropriate total serum IgE sample, add DEPC-ddH
2o dilutes by certain multiple, with ultraviolet spectrophotometer difference working sample absorbance (OD under 260nm and 280nm wavelength
260and OD
280), with DEPC-ddH
2o is as blank;
(2) according to absorbance ratio (OD
260and OD
280) investigate the purity of RNA sample: if ratio is within 1.8-2.0 scope, then illustrates that in RNA, pollutant load is lower, can accept; If ratio <1.8, then to illustrate in solution albumen or other organic pollutions obvious; If ratio >2.0, then illustrating that RNA has been hydrolyzed becomes oligonucleotide;
(3) assay: according to the absorbance (OD under 260nm wavelength
260) calculate the concentration of total serum IgE sample, i.e. RNA concentration (μ g/ml)=OD
260× 40 × extension rate.
2.13.2 reverse transcription:
(1) Reverse Transcription box used: Fermentas (RevertAidFirstStrandcDNASynthesisKit, K1622), melts reagent all in test kit, and mixing, after simply centrifugal, is positioned on ice;
(2) in the following order reagent is added in the pipe of aseptic, nuclease free, is positioned on ice;
| total RNA: | 4μl |
| oligo(dT)18primer: | 1μl |
| Water,nuclease-free: | 7μl |
| Total volume: | 12μl |
(3) if RNA template contains GC enriched sequence, or containing secondary structure, mix gently, simply centrifugal, then hatch 5 minutes at 65 DEG C.In cooled on ice;
(4) according to following order application of sample:
| 5×Reaction Buffer | 4μl |
| Ribolock TM RNase Inhibitor(20u/μl) | 1μl |
| 10mM dNTP Mix | 2μl |
| RevertAid TM M-MulV Reverse Transcriptase(200u/μl) | 1μl |
| Total volume | 20μl |
(5) mixing is rear centrifugal gently;
(6) reverse transcription reaction parameter
Table 3. reverse transcription parameter list
| Temperature | Time |
| 65℃ | 5 minutes |
| 42℃ | 60 minutes |
| 70℃ | 5 minutes |
| 4℃ | ∞ |
(7) product of the reverse transcription obtained can preserve a week at-20 DEG C, can preserve for a long time at-70 DEG C.
2.13.3 thermograde PCR
(1) primer information
Table 4. primer information
| Primer | Sequence | Annealing temperature |
| ATP-5D forwards | 5'CACTGTGAATGCGGACTCCT 3' | 57.2℃ |
| ATP-5D backwards | 5'GGATTTGGATCTCAGCCCGT 3' | 58.4℃ |
(2) the EP pipe of dress primer to be placed on centrifuge with centrifugal more than 10 seconds at full speed, primer is dissolved in water according to the explanation on label.Dilute 5 times stand-by;
(3) MaximaSYBRGreen/ROXqPCRMasterMix (2 ×), the MIX newly taken out are placed in the sack of lucifuge, put back to as early as possible after being finished;
(4) PCR instrument of design temperature gradient, because according to the annealing temperature of gradient setting (1) 52.0 (2) 53.1 (3) 54 (4) 55 (5) 56 (6) 57.5 (7) 58.5 (8) 59.6 (9) 60.7 (10) 62 (11) 63 (12) 6412 gradient, run glue again after running PCR, the brightness according to product just can determine the suitableeest annealing temperature;
(5) according to following table preparation reaction system:
Table 5.PCR reaction system
| Maxima SYBR Green/ROX qPCR Master Mix(2×) | 10μl |
| cDNA | 0.5μl |
| Forwards primer | 0.5μl |
| Backwards primer | 0.5μl |
| Water(ddH 2O) | 8.5μl |
| Total volume | 20μl |
(6) this test have chosen a temperature 60 C.
(7) PCR response parameter
Table 6.PCR response parameter
| Operation | Temperature | Time |
| Denaturation | 95℃ | 3 minutes |
| Degeneration | 95℃ | 15 seconds |
| Annealing | 56℃、58.5℃、60.7℃、62℃ | 15 seconds |
| Extend | 72℃ | 20 seconds |
| Extend | 72℃ | 10 minutes |
| Preserve | 4℃ | ∞ |
Degeneration, annealing, extension circular response 35 times;
(8) terminate after product temporarily can be placed on 4 DEG C of preservations, prepare run glue;
(9) the suitableeest annealing temperature of DNA sepharose electrophoresis checking, and whether the band that primed reverse transcription goes out is single.
2.13.4 real-time quantitative PCR
(1) reagent in SYBRGreen/ROXqPCRMasterMix test kit is melted, mix up and down, put upside down, centrifugal.Taken out by primer, primer information is as follows:
Table 7. primer information
| Primer | Sequence | Annealing temperature |
| ATP-5D forwards | 5'CACTGTGAATGCGGACTCCT 3' | 57.2℃ |
| ATP-5D backwards | 5'GGATTTGGATCTCAGCCCGT 3' | 58.4℃ |
| GAPDH forwards | 5'GGCACAGTCAAGGCTGAGAAT 3' | 64.6℃ |
| GAPDH backwards | 5'ATGGTGGTGAAGACGCCAGTA 3' | 62.8℃ |
(2) according to following table preparation reaction system:
Table 8. real-time quantitative PCR reaction system
| Maxima SYBR Green/ROX qPCR Master Mix(2×) | 10μl |
| cDNA | 0.5μl |
| Forwards primer | 0.5μl |
| Backwards primer | 0.5μl |
| Water(ddH 2O) | 8.5μl |
| Total volume | 20μl |
(3) after being added to 96 orifice plates, the reactant liquor that mixing gently mixes, but can not shake, can not bubble be produced;
(4) start to circulate, the response parameter of real-time quantitative PCR is as follows:
Table 9. real-time quantitative PCR response parameter
| Operation | Temperature | Time |
| Incubate in advance | 50℃ | 2 minutes |
| Denaturation | 95℃ | 10 minutes |
| Degeneration | 95℃ | 15 seconds |
| Annealing | 60℃ | 15 seconds |
| Extend | 72℃ | 20 seconds |
| Extend | 72℃ | 10 minutes |
| Preserve | 4℃ | ∞ |
Degeneration, annealing, extension circular response 40 times;
(5) carry out data analysis, and PCR afterproduct agarose gel electrophoresis is analyzed.
CTnI in 2.14 serum, MDA, MPO assay and ATP, ADP, AMP assay in heart tissue
2.14.1 cTnI assay in serum
(1) Reperfu-sion got blood after 90 minutes, anticoagulant heparin, 4 DEG C, and centrifugal 15 minutes of 3000rpm, gets supernatant.Wherein cTnI content is detected with rat cTnIElisa test kit;
(2) in room temperature, equilibrium temperature 30 minutes must be reached before use test kit;
(3) except blank well (distilled water), respectively the standard substance (100 μ l/ hole) of specimen and variable concentrations are added in respective aperture, sample is added on bottom ELISA Plate hole, do not touch hole wall as far as possible, rock mixing gently, notice that mixing is very important, seal reacting hole with shrouding gummed paper;
(4) incubation: with shrouding film shrouding rearmounted 37 DEG C of incubation half an hour;
(5) dosing: by for subsequent use after 30 × concentrated cleaning solution distilled water diluting 30 times;
(6) wash plate: get rid of liquid in most hole, every hole adds cleaning mixture 300 μ l, leaves standstill and gets rid of most liquid after 30 seconds, absorbent paper pats dry, washes plate 5 times;
(7) add cTnI first antibody working solution (50 μ l/ hole), except blank well, seal plate hole;
(8) incubation: put 37 DEG C of incubations 30 minutes;
(9) wash: get rid of liquid in most hole, every hole adds cleaning mixture 300 μ l, leave standstill and get rid of most liquid after 30 seconds, absorbent paper pats dry, washes plate 5 times;
(10) develop the color: except blank well, add substrate working solution (100 μ l/ hole), shake mixing gently, 37 DEG C of lucifuges develop the color 10 minutes;
(11) stop: every hole adds stop buffer 50 μ l, cessation reaction;
(12) measure: the absorbance (OD value) sequentially measuring each hole with blank air-conditioning zero, 450nm wavelength by microplate reader.The OD value that the OD value of each standard substance and specimen deducts zero hole is actual OD value, calculates protein concentration according to standard curve.
2.14.2 rat heart muscle MDA assay
(1) test kit is GBD Corp. M015-80MDA detection kit.Before experiment, A, B liquid and enzyme conjugates are respectively got one (50 μ l) mixing.Become navy blue in 10 seconds, illustrate that test kit is rich active;
(2) in room temperature, equilibrium temperature 30 minutes must be reached before use reagent;
(3) will organize and take out from-80 DEG C, and first melt a little on ice, then shred with eye scissors, encase with tinfoil and put into liquid nitrogen, the good tinfoil of Care Mark, prevents a period of time in liquid nitrogen, tissue is fully frozen in, prepares RIPA lysate during this period;
(4) the RIPA lysate of 3ml, adds the cocktail of 30 μ l in 3mlRIPA;
(5) smashed by tissue with little hammer, get general 70 μ about g, put on ice, every four tissues just add lysate after having pounded, and ratio 1 μ g adds 1.5 μ l lysates, mixes up after adding lysate with rifle, and tissue and lysate are fully mixed;
(6) ultrasonic, time ultrasonic ultrasonic 8 seconds at every turn, 10 seconds, interval, ultrasonic 5 times, ensured do not have obvious piece of tissue, opens centrifuge pre-cooling when ultrasonic;
(7) trim, centrifugal, centrifugal 4 DEG C, 3000g, 10 minutes.When trim, test kit is taken out from 4 DEG C of refrigerators, but plank is not taken out;
(8) take out ELISA Plate according to Blank (water of 50 μ l), standard substance concentration from low to high (50 μ l), be added in blank hole, add sample (65 μ l) successively, first add sample and add standard substance again;
(9) in each hole, the enzyme labelling liquid of the Enzymeconjugate of the red bottle of 100 μ l is added with the volley of rifle fire;
(10) seal with sealed membrane, ELISA Plate is placed in 37 DEG C and hatches 1 hour;
(11) buffer dilution is become 1 × working solution, ratio is 1:100;
(12) fully ELISA Plate is washed 5 times, at every turn with the buffer of 300 μ l, for the last time water is all patted dry;
(13) each 50 μ l of A, B two liquid that add of each hole, then first seal with preservative film, then encase with tinfoil, lucifuge puts into 37 DEG C, takes out after 20 minutes;
(14) each hole adds 50 μ l stop buffers, cessation reaction;
(15) 450nm place reads light absorption value, does standard curve, carries out data analysis.
2.14.3 cardiac muscular tissue MPO measures
(1) Reperfu-sion is after 90 minutes, cores dirty, isolates left ventricular ischemia district (about 150mg) on ice, extracts histone, carry out protein quantification according to preceding method;
(2) used kit is that MPO detection kit (R & D, Minnesota, USA) equilibrium temperature must reach 30 minutes before use reagent in room temperature;
(3) except blank well (distilled water), respectively the standard substance (100 μ l/ hole) of specimen and variable concentrations are added in respective aperture, sample is added on bottom ELISA Plate hole, does not touch hole wall as far as possible, rock mixing gently, seal reacting hole with shrouding gummed paper;
(4) incubation: use the rearmounted 37 DEG C of incubations of shrouding film shrouding 2 hours;
(5) dosing: by for subsequent use after 30 × concentrated cleaning solution distilled water diluting 30 times;
(6) wash plate: get rid of liquid in most hole, every hole adds cleaning mixture 300 μ l, leaves standstill and gets rid of most liquid after 30 seconds, absorbent paper pats dry, washes plate 5 times;
(7) add MPO first antibody working solution (50 μ l/ hole), except blank well, seal plate hole;
(8) incubation: put 37 DEG C of incubations 1 hour;
(9) wash: get rid of liquid in most hole, every hole adds cleaning mixture 300 μ l, leave standstill and get rid of most liquid after 30 seconds, absorbent paper pats dry, washes plate 5 times;
(10) develop the color: except blank well, add substrate working solution (100 μ l/ hole), shake mixing gently, 37 DEG C of lucifuges develop the color 10 minutes;
(11) stop: every hole adds stop buffer 50 μ l, cessation reaction;
(12) measure: the absorbance (OD value) sequentially measuring each hole with blank air-conditioning zero, 450nm wavelength by microplate reader.The OD value that the OD value of each standard substance and specimen deducts zero hole is actual OD value, calculates protein concentration according to standard curve.
2.14.4 rat tissue ATP measures
(1) Reperfu-sion is after 90 minutes, cores dirty, isolates left ventricular ischemia district (about 150mg) on ice, extracts histone, carry out protein quantification according to preceding method;
(2) used kit is that RatAdenosineTriphosphateELISAKit (R & D, Minneapolis, Minnesota, USA) equilibrium temperature must reach 30 minutes before use reagent in room temperature;
(3) dilution of standard substance and application of sample: at enzyme mark bag by the accurate sample wells 10 of bidding on plate hole, add standard substance 100 μ l respectively in first, second hole, then add standard dilutions 50 μ l in first, second hole, mixing; Then from the first hole, the second hole, respectively get 100 μ l be added to the 3rd hole and the 4th hole respectively, then add standard dilutions 50 μ l respectively in the 3rd, the 4th hole, mixing; Then in the 3rd hole and the 4th hole, first respectively get 50 μ l to discard, respectively get 50 μ l and be added to respectively in the 5th, the 6th hole, then in the 5th, the 6th hole, add standard dilutions 50 μ l respectively, mixing; From the 5th, the 6th hole, respectively get after mixing that 50 μ l are added to the 7th respectively, in octal, again the 7th, add standard dilutions 50 μ l respectively in octal, after mixing from the 7th, get 50 μ l respectively octal and be added in the 9th, the tenth hole, add standard dilutions 50 μ l respectively in the 90 hole again, from the 90 hole, respectively get 50 μ l after mixing and discard.After dilution, each hole application of sample amount is all 50 μ l, and concentration is respectively 150ng/ml, 100ng/ml, 50ng/ml, 25ng/ml, 12.5ng/ml;
(4) application of sample: establish blank well (blank control wells does not add sample and enzyme marking reagent, and respectively step operation is identical for all the other), testing sample hole respectively.In enzyme mark bag is by testing sample hole on plate, first adds sample diluting liquid 40 μ l, and then adds testing sample 10 μ l, the final dilution factor of sample is 5 times.Sample is added on bottom ELISA Plate hole by application of sample, does not touch hole wall as far as possible, rocks mixing gently;
(5) incubation: use the rearmounted 37 DEG C of incubations of shrouding film shrouding 30 minutes;
(6) dosing: by for subsequent use after 30 × concentrated cleaning solution distilled water diluting 30 times;
(7) wash: carefully take shrouding film off, discard liquid, dry, cleaning mixture is filled it up with in every hole, leaves standstill and discards after 30 seconds, so repeats 5 times, pats dry;
(8) enzyme-added: every hole adds ATP labelled reagent 50 μ l, except blank well;
(9) incubation: use the rearmounted 37 DEG C of incubations of shrouding film shrouding 30 minutes;
(10) wash plate: get rid of liquid in most hole, every hole adds cleaning mixture 300 μ l, leaves standstill and gets rid of most liquid after 30 seconds, absorbent paper pats dry, washes plate 5 times;
(11) develop the color: every hole first adds developer A50 μ l, then adds developer B50 μ l, and shake mixing gently, 37 DEG C of lucifuges develop the color 15 minutes;
(12) stop: every hole adds stop buffer 50 μ l, cessation reaction, now blue standing turns yellow;
(13) measure: the absorbance (OD value) sequentially measuring each hole with blank air-conditioning zero, 450nm wavelength by microplate reader.Mensuration should be carried out within 15 minutes after adding stop buffer.
2.14.5 rat tissue ADP measures
(1) Reperfu-sion is after 90 minutes, cores dirty, isolates left ventricular ischemia district (about 150mg) on ice, extracts histone, carry out protein quantification according to preceding method;
(2) used kit is that RatAdenosinediphosphateELISAKit (R & D, Minneapolis, Minnesota, USA) equilibrium temperature must reach 30 minutes before use reagent in room temperature;
(3) dilution of standard substance and application of sample: at enzyme mark bag by the accurate sample wells 10 of bidding on plate hole, add standard substance 100 μ l respectively in first, second hole, then add standard dilutions 50 μ l in first, second hole, mixing; Then from the first hole, the second hole, respectively get 100 μ l be added to the 3rd hole and the 4th hole respectively, then add standard dilutions 50 μ l respectively in the 3rd, the 4th hole, mixing; Then in the 3rd hole and the 4th hole, first respectively get 50 μ l to discard, respectively get 50 μ l and be added to respectively in the 5th, the 6th hole, then in the 5th, the 6th hole, add standard dilutions 50 μ l respectively, mixing; From the 5th, the 6th hole, respectively get after mixing that 50 μ l are added to the 7th respectively, in octal, again the 7th, add standard dilutions 50 μ l respectively in octal, after mixing from the 7th, get 50 μ l respectively octal and be added in the 9th, the tenth hole, add standard dilutions 50 μ l respectively in the 90 hole again, from the 90 hole, respectively get 50 μ l after mixing and discard.After dilution, each hole application of sample amount is all 50 μ l, and concentration is respectively 900nmol/L, 600nmol/L, 300nmol/L, 150nmol/L, 75nmol/L;
(4) application of sample: establish blank well (blank control wells does not add sample and enzyme marking reagent, and respectively step operation is identical for all the other), testing sample hole respectively.In enzyme mark bag is by testing sample hole on plate, first adds sample diluting liquid 40 μ l, and then adds testing sample 10 μ l, the final dilution factor of sample is 5 times.Sample is added on bottom ELISA Plate hole during application of sample, does not touch hole wall as far as possible, rock mixing gently;
(5) incubation: use the rearmounted 37 DEG C of incubations of shrouding film shrouding 30 minutes;
(6) dosing: by for subsequent use after 30 × concentrated cleaning solution distilled water diluting 30 times;
(7) wash: carefully take shrouding film off, discard liquid, dry, cleaning mixture is filled it up with in every hole, leaves standstill and discards after 30 seconds, so repeats 5 times, pats dry;
(8) enzyme-added: every hole adds ADP labelled reagent 50 μ l, except blank well;
(9) incubation: use the rearmounted 37 DEG C of incubations of shrouding film shrouding 30 minutes;
(10) wash plate: get rid of liquid in most hole, every hole adds cleaning mixture 300 μ l, leaves standstill and gets rid of most liquid after 30 seconds, absorbent paper pats dry, washes plate 5 times;
(11) develop the color: every hole first adds developer A50 μ l, then adds developer B50 μ l, and shake mixing gently, 37 DEG C of lucifuges develop the color 15 minutes;
(12) stop: every hole adds stop buffer 50 μ l, cessation reaction, now blue standing turns yellow;
(13) measure: the absorbance (OD value) sequentially measuring each hole with blank air-conditioning zero, 450nm wavelength by microplate reader.Mensuration should be carried out within 15 minutes after adding stop buffer.
2.14.6 rat tissue AMP measures
(1) Reperfu-sion is after 90 minutes, cores dirty, isolates left ventricular ischemia district (about 150mg) on ice, extracts histone, carry out protein quantification according to preceding method;
(2) used kit is that RatAdenosineMonophosphateELISAKit (R & D, Minneapolis, Minnesota, USA) equilibrium temperature must reach 30 minutes before use reagent in room temperature;
(3) dilution of standard substance and application of sample: at enzyme mark bag by the accurate sample wells 10 of bidding on plate hole, add standard substance 100 μ l respectively in first, second hole, then add standard dilutions 50 μ l in first, second hole, mixing; Then from the first hole, the second hole, respectively get 100 μ l be added to the 3rd hole and the 4th hole respectively, then add standard dilutions 50 μ l respectively in the 3rd, the 4th hole, mixing; Then in the 3rd hole and the 4th hole, first respectively get 50 μ l to discard, respectively get 50 μ l and be added to respectively in the 5th, the 6th hole, then in the 5th, the 6th hole, add standard dilutions 50 μ l respectively, mixing; From the 5th, the 6th hole, respectively get after mixing that 50 μ l are added to the 7th respectively, in octal, again the 7th, add standard dilutions 50 μ l respectively in octal, after mixing from the 7th, get 50 μ l respectively octal and be added in the 9th, the tenth hole, add standard dilutions 50 μ l respectively in the 90 hole again, from the 90 hole, respectively get 50 μ l after mixing and discard.After dilution, each hole application of sample amount is all 50 μ l, and concentration is respectively 900nmol/L, 600nmol/L, 300nmol/L, 150nmol/L, 75nmol/L;
(4) application of sample: establish blank well (blank control wells does not add sample and enzyme marking reagent, and respectively step operation is identical for all the other), testing sample hole respectively.In enzyme mark bag is by testing sample hole on plate, first adds sample diluting liquid 40 μ l, and then adds testing sample 10 μ l, the final dilution factor of sample is 5 times.Sample is added on bottom ELISA Plate hole during application of sample, does not touch hole wall as far as possible, rock mixing gently;
(5) incubation: use the rearmounted 37 DEG C of incubations of shrouding film shrouding 30 minutes;
(6) dosing: by for subsequent use after 30 × concentrated cleaning solution distilled water diluting 30 times;
(7) wash: carefully take shrouding film off, discard liquid, dry, cleaning mixture is filled it up with in every hole, leaves standstill and discards after 30 seconds, so repeats 5 times, pats dry;
(8) enzyme-added: every hole adds AMP labelled reagent 50 μ l, except blank well;
(9) incubation: use the rearmounted 37 DEG C of incubations of shrouding film shrouding 30 minutes;
(10) wash plate: get rid of liquid in most hole, every hole adds cleaning mixture 300 μ l, leaves standstill and gets rid of most liquid after 30 seconds, absorbent paper pats dry, washes plate 5 times;
(11) develop the color: every hole first adds developer A50 μ l, then adds developer B50 μ l, and shake mixing gently, 37 DEG C of lucifuges develop the color 15 minutes;
(12) stop: every hole adds stop buffer 50 μ l, cessation reaction, now blue standing turns yellow;
(13) measure: the absorbance (OD value) sequentially measuring each hole with blank air-conditioning zero, 450nm wavelength by microplate reader.Mensuration should be carried out within 15 minutes after adding stop buffer.
The immunohistochemistry views of ICAM-1, MPO, CD18 in 2.15 cardiac muscular tissues
(1) Reperfu-sion is after 90 minutes, opens thoracic cavity, and take out heart, the paraformaldehyde solution being placed in 4% fixes 48 hours, through dehydration, transparent, waxdip, embedding, prepares wax stone, is finally prepared into paraffin section;
(2) paraffin section dewaxes, and dewaxes 15 minutes in dimethylbenzene I, dewaxes 10 minutes in dimethylbenzene II;
(3) after dewaxing, to cut into slices in 100% ethanol I 5 minutes, to transfer in 100% ethanol II 3 minutes;
In (4) 95% ethanol I 3 minutes, in 95% ethanol II 2 minutes;
In (5) 80% ethanol 2 minutes;
1-2 minute in (6) 70% ethanol;
(7) distill washing 1 time, washing is gently propose section up and down gently, washes 5 minutes;
(8) carry out antigen retrieval with the sodium citrate of 0.01M, liquor sodii citratis is filled it up with, and specimen is towards one side, and lid is opened, and uses microwave oven to be warmed up to 90 DEG C, then suspends, put into specimen, and regulate firepower to 60, the time is 10 minutes;
(9) room temperature natural cooling, is generally 2 hours;
(10) PBS wash buffer 3 times, each washing time is 5 minutes;
(11) with 3% H
2o
2lucifuge, room temperature 30 minutes;
(12) PBS wash buffer 3 times, each washing time is 5 minutes;
(13) 0.1%BSA, closes 15 minutes;
(14) antibody diluent dilution primary antibodie, the amount of liquid that each heart tissue needs is 50 μ l, is placed in wet box, 4 DEG C of night incubation;
(15) from 4 DEG C, take out section, after rising again one hour, PBS washes 3 times, and each time is 5 minutes;
(16) rabbit two step method detectable (middle China fir, PV-6001), adds biotin labeled two and resists, the amount of liquid about 50 μ l of each organization need, incubated at room temperature 1 hour;
(17) PBS washes 3 times, and each time is 5 minutes;
(18) DAB colour developing, at any time in Microscopic observation colour developing situation, tap water color development stopping;
(19) dewater up, gummy mounting, at Microscopic observation and taking pictures.
2.16 statistical analysis
All data mean ± SE represent, application SPSS13.0 statistical software, the method for One-WayANOVA or Two-wayANOVA is added up data, and p ﹤ 0.05 represents that difference has statistical significance.
3 experimental results
3.1Rg1 is on the impact of the infarct size that I/R mediates
Table 10.Rg1 is on the impact (x ± s) of the infarct size that I/R mediates
Note: * p<0.05vs.Sham; #p<0.05vs.I/R
Fig. 1 .Rg1 affects cartogram to the myocardial infarction area that I/R mediates.Figure 1A represents that ischemia-reperfusion is after 90 minutes, the result of myocardial infarction district (IA)/myocardial ischemia district (AAR) after Sham group, I/R group, Rg1+I/R each dosage group Cardiac muscle sections TTC and EvensBlue dyeing.Figure 1B represents that ischemia-reperfusion is after 90 minutes, the statistical result of myocardial ischemia district (AAR)/left ventricular area (LV) after Sham group, I/R group, Rg1+I/R each dosage group heart sections TTC and EvensBlue dyeing.*p<0.05vs.Sham；#p<0.05vs.I/R。
Fig. 1 is each group of rat heart muscle myocardial infarction area/ischemic areas, the statistical result of myocardial ischemia-area/myocardial area.Rg1 in the dosage of 1mg/kg and 5mg/kg, the increase of the rat myocardial infarction model area that I/R all can be suppressed to cause, and effect the best (Figure 1A) of 5mg/kg dosage.For this reason, this research selects 5mg/kg dosage to study.Figure 1B shows the statistical result of each group of rat ischemia area/left ventricular area ratio.Do not have significant difference between each group, point out in this research process, the degree of ischemia of each group is homogeneous, model equilibrium and standard.
Fig. 2 .Rg1 is on the impact of myocardial infarction area after I/R.Fig. 2 represents that ischemia-reperfusion is after 90 minutes, and Sham group, I/R group, Rg1+I/R each dosage group heart sections TTC and EvensBlue dye.White portion is infarcted region (InfarctareaIA), red area is ischemic region (AAR), blue region is non-ischemic region.
Fig. 2 shows ischemia 30 minutes, respectively organizes the change of myocardial ischemia in rats and myocardial infarction area during Reperfu-sion 90 minutes.The infarcted region that white portion in figure is, red area is ischemic area.Compared with sham operated rats, see larger white dye infarcted region in I/R group rat heart muscle, the white dye infarcted region of Rg1 group obviously reduces.
3.2Rg1 is on the impact of the cardiomorphology that I/R causes
Fig. 3 .Rg1 is on the impact of the cardiomorphology that I/R causes.Fig. 3 represents heart HE colored graph after Sham group, Rg1+Sham group, I/R group, Rg1+I/R group rat Reperfu-sion.Bar＝50μm。
Fig. 3 represents that Reperfu-sion is respectively organized rat heart muscle for 90 minutes and organized HE coloration result.Compared with sham operated rats, the fiber alignment of I/R group rat heart muscle is disorderly, can be observed part cardiac muscle fiber and occurs fracture, have infiltration and interstice's edema of inflammatory cell.Rg1 obviously can reduce the damage of the rat heart muscle tissue that I/R causes.
3.3Rg1 is on the impact of the myocardial cell F-actin that I/R causes
Fig. 4 .Rg1 is on the impact of the myocardial cell F-actin that I/R causes.The F-actin dyeing that after Fig. 4 represents Sham group, Rg1+Sham group, I/R group, Rg1+I/R group rat Reperfu-sion, heart phalloidin carries out.In figure, redness is that F-actin is positive.Bar＝50μm。
F-actin is one of key component of cytoskeleton, is that cardiac muscle fiber produces the important functional unit of shrinking.Fig. 4 shows the result that each group of rat cell skeleton F-actin dyes.In figure, red dye person is intracellular F-actin.Compared with sham operated rats, F-actin arrangement disorder in IR group rat myocardial cell, part myocardial cell F-actin ruptures dissolving.Rg1 can reduce the damage of the myocardial cell F-actin that I/R causes significantly.
The impact of cTnI content in the cardiac muscular tissue that 3.4Rg1 causes I/R and serum
The impact (x ± s) of cTnI content in the cardiac muscular tissue that table 11.Rg1 causes I/R and serum
Note: * p<0.05vs.Sham; #p<0.05vs.I/R
The impact of cTnI content in the cardiac muscular tissue that Fig. 5 .Rg1 causes I/R and serum.Fig. 5 A, 5B represent westernblot band and the optical density statistical value of cTnI in Sham group, Rg1+Sham group, I/R group, Rg1+I/R group rat Reperfu-sion rear myocardium tissue.The content of cTnI in serum after the Sham group that the Elisa method that represents Fig. 5 C detects, Rg1+Sham group, I/R group, Rg1+I/R group rat Reperfu-sion.*p<0.05vs.Sham；#p<0.05vs.I/R。
Fig. 5 shows the result of Rg1 to cTnI horizontal analysis in I/R rat heart muscle tissue and serum.As shown in figure 5, compared with sham operated rats, in I/R group rat heart muscle, cTnI expression significantly reduces, and Rg1 can suppress the reduction (Fig. 5 B) of cTnI level significance.Fig. 5 C shows cTnI horizontal expression statistical result in rat blood serum.Compared with sham operated rats, I/R can cause the rising of the cTnI horizontal expression in rat blood serum, the rising of the cTnI horizontal expression in the serum that Rg1 can suppress I/R to cause.Illustrate in cardiac muscular tissue and meet with the cTnI level change in serum.
3.5Rg1 is on the impact of the apoptosis of cardiac muscle that I/R causes
Table 12.Rg1 is on the impact (x ± s) of the apoptosis of cardiac muscle that I/R causes
| Group | n | Apoptosis Cells/field |
| Sham | 6 | 0.00±0.00 |
| Rg1+Sham | 6 | 0.00±0.00 |
| I/R | 6 | 17.00±2.55* |
| Rg1+I/R | 6 | 7.20±1.48# |
Note: * p<0.05vs.Sham; #p<0.05vs.I/R
Fig. 6 .Rg1 is on the impact of the myocardial apoptosis that I/R causes.The apoptosis dyeing that after Fig. 6 represents Sham group, Rg1+Sham group, I/R group, Rg1+I/R group rat Reperfu-sion, TUNEL test kit carries out and cartogram.Figure Green is that TUNEL is positive, and blueness is nucleus.Bar＝50μm。*p<0.05vs.Sham；#p<0.05vs.I/R。
The result of what Fig. 6 A showed the is interior TUNEL Positive Cell Counts of each group of rat heart muscle tissue.Increasing of TUNEL positive cell number in the rat heart muscle tissue that Rg1 can suppress I/R to cause significance.
The image of what Fig. 6 B showed the is interior TUNEL positive cell of each group of rat heart muscle tissue.In figure, blue dye person is nucleus, and green dye person is TUNEL positive cell.TUNEL positive cell is not observed in sham operated rats and background group rat heart muscle tissue.A fairly large number of TUNEL positive cell can be observed, the part myocardial cell generation apoptosis of prompting rat in I/R group rat heart muscle tissue.In Rg1 group rat heart muscle tissue, TUNEL positive cell quantity obviously reduces.
3.6Rg1 is on the impact of the apoptosis-related protein that I/R causes
Table 13.Rg1 is on the impact (x ± s) of the apoptosis-related protein that I/R causes
| Group | n | Bax/Bcl-2(％) | Cleaved caspase-3(％) |
| Sham | 6 | 1.15±0.84 | 0.62±0.24 |
| Rg1+Sham | 6 | 0.92±0.54 | 0.56±0.07 |
| I/R | 6 | 4.67±1.53* | 1.17±0.38* |
| Rg1+I/R | 6 | 1.30±1.02# | 0.62±0.20# |
Note: * p<0.05vs.Sham; #p<0.05vs.I/R
Fig. 7 .Rg1 organizes the impact of apoptosis-related protein to the rat heart muscle that I/R causes.Fig. 7 represents westernblot band and the optical density statistical value of Bcl-2, Bax and cleaved-Caspase-3 after Sham group, Rg1+Sham group, I/R group, Rg1+I/R group rat Reperfu-sion.*p<0.05vs.Sham；#p<0.05vs.I/R。
Fig. 7 shows the result that Rg1 analyzes the apoptosis-related protein WesternBlot in I/R rat heart muscle tissue.As shown in 7A, compared with sham operated rats, in I/R group rat heart muscle, the protein Bcl-2 of apoptosis inhibit significantly reduces, and short apoptotic protein Bax raises after I/R significance, and Rg1 can suppress the ratio of Bax/Bcl-2 to raise (Fig. 7 B) in significance ground.Fig. 7 C shows the expression statistical result of the cleavedCaspase-3 in rat heart muscle tissue extraction albumen.Compared with sham operated rats, the rising that I/R can cause the cleavedCaspase-3 in rat heart muscle to express, the rising that in the cardiac muscular tissue that Rg1 can suppress I/R to cause, cleavedCaspase-3 expresses.
3.7Rg1 is on the impact of the PI3K/AKT signal path that I/R causes
Table 14.Rg1 is on the impact (x ± s) of the PI3K/AKT signal path that I/R causes
| Group | n | P-PI3K/PI3K(％) | P-Akt/Akt(％) |
| Sham | 6 | 0.05±0.03 | 0.30±0.21 |
| Rg1+Sham | 6 | 0.04±0.01 | 0.31±0.17 |
| I/R | 6 | 0.16±0.03* | 0.42±0.15 |
| Rg1+I/R | 6 | 0.24±0.04*# | 0.92±0.27*# |
Note: * p<0.05vs.Sham; #p<0.05vs.I/R
Fig. 8 .Rg1 organizes the impact of PI3K/AKT signal path to the rat heart muscle that I/R causes.Fig. 8 represents P-PI3K after Sham group, Rg1+Sham group, I/R group, Rg1+I/R group rat Reperfu-sion, total PI3K, P-Akt, the westernblot band of total Akt and optical density statistical value.*p<0.05vs.Sham；#p<0.05vs.I/R。
Fig. 8 shows the result that Rg1 analyzes the PI3K/AKT signal path WesternBlot in I/R rat heart muscle tissue.As shown in 8A, compared with sham operated rats, in I/R group rat heart muscle, the phosphorylation level of PI3K significantly raises, and the phosphorylation level of Akt also slightly raises, and Rg1 pre-administration can raise the ratio (Fig. 8 B, Fig. 8 C) of P-PI3K/PI3K and P-Akt/Akt in significance ground further.
The impact of the Rho kinases that 3.8Rg1 causes I/R and substrate thereof
The impact (x ± s) of the Rho kinases that table 15.Rg1 causes I/R and substrate thereof
| Group | n | ROCK1(％) | P-MYPT1/MYPT1(％) |
| Sham | 6 | 0.26±0.14 | 0.17±0.11 |
| Rg1+Sham | 6 | 0.17±0.10 | 0.11±0.06 |
| I/R | 6 | 0.68±0.21* | 0.51±0.15* |
| Rg1+I/R | 6 | 0.32±0.15# | 0.25±0.13# |
Note: * p<0.05vs.Sham; #p<0.05vs.I/R
Rho kinases in the rat heart muscle tissue that Fig. 9 .Rg1 causes I/R and the impact of substrate thereof.Fig. 9 represents westernblot band and the optical density statistical value of ROCK1, P-MYPT1 after Sham group, Rg1+Sham group, I/R group, Rg1+I/R group rat Reperfu-sion, total MYPT1.*p<0.05vs.Sham；#p<0.05vs.I/R。
Fig. 9 shows the result that Rg1 analyzes the Rho kinases in I/R rat heart muscle tissue and substrate WesternBlot thereof.As shown in 9A, compared with sham operated rats, in I/R group rat heart muscle, the phosphorylation level of ROCK1 level and MYPT1 significantly raises, and Rg1 pre-administration can suppress the expression of ROCK1 to raise in significance ground, suppresses the phosphorylation (Fig. 9 B, Fig. 9 C) of MYPT1.
3.9Rg1 is on the impact of the cardiac hemodynamic that I/R causes
The hemodynamic impact of rat heart that Figure 10 .Rg1 causes I/R.Figure 10 represents the index of Sham group, Rg1+Sham group, I/R group, the dirty contractile function of Rg1+I/R group Ischemia and Reperfusion in vivo in Rats Process-centric: the change of the whole last diastolic pressure (B) of heart rate (A), left ventricle, left ventricular systolic pressure (C), left ventricular diastolic pressure (D), the maximum climbing speed of left ventricle (E), the maximum fall off rate of left ventricle (F).*p<0.05vs.Sham；#p<0.05vs.I/R。
Figure 10 shows the change of each group of rat heart rate (A), the whole last diastolic pressure (B) of left ventricle, left ventricular systolic pressure (C), left ventricular diastolic pressure (D), the maximum climbing speed of left ventricle (E), the maximum fall off rate of left ventricle (F).Compared with sham operated rats, the reduction of I/R group rat left ventricle systolic pressure, left ventricular diastolic pressure and last diastolic pressure rising eventually, the maximum climbing speed of left ventricle reduces, the maximum fall off rate of left ventricle raises, the above-mentioned change that Rg1 can suppress I/R to cause.
3.10Rg1 is on the impact of the cardiac blood flow that I/R causes
Table 16.Rg1 is on the impact (x ± s) of the cardiac blood flow that I/R causes
Note: * p<0.05vs.Sham; #p<0.05vs.I/R
Figure 11 .Rg1 is on the impact of the rat heart blood flow that I/R causes.Figure 11 represents cardiac blood flow exploded view and cartogram after Sham group, Rg1+Sham group, I/R group, Rg1+I/R group rat Reperfu-sion.*p<0.05vs.Sham；#p<0.05vs.I/R。
The statistical result of what Figure 11 A showed is each group of rat heart surface blood flow.Rg1 when Reperfu-sion 60 and 90 minutes, the reduction of the rat heart that inhibits I/R to cause surface blood flow significance.
Figure 11 B show be rat heart surface blood flow image.Compared with sham operated rats, I/R group rat was when ischemia 30 minutes, and namely during Reperfu-sion 0 minute, heart surface blood flow reduces significantly, though recover to some extent after Reperfu-sion, but, in Reperfu-sion 90 timesharing, still significantly lower than sham operated rats.Rg1 group rat heart surface blood flow does not significantly change at ischemia for 30 minutes compared with I/R, but, from Reperfu-sion 30 minutes, rat heart surface blood flow starts to recover, when Reperfu-sion 60 and 90 minutes, the reduction of the rat heart surface blood flow that inhibit I/R to cause significance.
3.11Rg1 is on the impact of energy metabolism after I/R
Table 17.Rg1 is to the impact (x ± s) of ADP, AMP, ATP after I/R
| Group | n | ADP/ATP(％) | AMP/ATP(％) |
| Sham | 6 | 0.92±0.16 | 1.61±0.25 |
| Rg1+Sham | 6 | 0.89±0.18 | 1.54±0.14 |
| I/R | 6 | 1.54±0.25* | 2.16±0.36* |
| Rg1+I/R | 6 | 0.93±0.31# | 1.56±0.20# |
Note: * p<0.05vs.Sham; #p<0.05vs.I/R
Figure 12 .Rg1 is on rat heart muscle tissue energy state impact after I/R.Figure 12 represents the ratio of ADP/ATP (A) and AMP/ATP (B) after Sham group, Rg1+Sham group, I/R group, Rg1+I/R group rat Reperfu-sion.*p<0.05vs.Sham；#p<0.05vs.I/R。
The ratio of ADP/ATP, AMP/ATP in each group of rat heart muscle tissue that the Elisa method that shows Figure 12 detects.Compared with sham operated rats, ADP/ATP, AMP/ATP of I/R group raise significantly.Rg1 can the suppression I/R of significance cause the rising of ADP/ATP, AMP/ATP ratio.
Table 18.Rg1 is to the impact (x ± s) of ATP-5D, P-MLC after I/R
| Group | n | ATP-5D(％) | P-MLC(％) |
| Sham | 6 | 0.61±0.04 | 0.24±0.12 |
| Rg1+Sham | 6 | 0.62±0.12 | 0.35±0.16 |
| I/R | 6 | 0.32±0.09* | 0.69±0.21* |
| Rg1+I/R | 6 | 0.79±0.14# | 0.28±0.10# |
Note: * p<0.05vs.Sham; #p<0.05vs.I/R
The impact that in the rat myocardial cell that Figure 13 .Rg1 causes I/R, ATP-5D and P-MLC expresses.Figure 13 represents westernblot band and the optical density statistical value of ATP-5D and P-MLC after Sham group, Rg1+Sham group, I/R group, Rg1+I/R group rat Reperfu-sion.*p<0.05vs.Sham；#p<0.05vs.I/R。
Figure 13 shows the result that Rg1 analyzes the WesternBlot of ATP-5D and P-MLC in I/R rat heart muscle tissue.As shown in 13A, compared with sham operated rats, in I/R group rat heart muscle, the level of ATP-5D significantly reduces, and the phosphorylation level of MLC significantly raises, and Rg1 pre-administration can change above-mentioned change (Figure 13 B, Figure 13 C) in significance ground.
Table 19.Rg1 is on the impact (x ± s) of ATP-5DmRNA after I/R
| Group | n | ATP5D mRNA(2 -DDct) |
| Sham | 6 | 1.00±0.15 |
| Rg1+Sham | 6 | 1.03±0.20 |
| I/R | 6 | 0.20±0.09* |
| Rg1+I/R | 6 | 0.87±0.17# |
Note: * p<0.05vs.Sham; #p<0.05vs.I/R
The impact that in the rat myocardial cell that Figure 14 .Rg1 causes I/R, ATP-5DmRNA expresses.Figure 14 represents the real-time quantitative PCR statistical value of ATP-5DmRNA after Sham group, Rg1+Sham group, I/R group, Rg1+I/R group rat Reperfu-sion.*p<0.05vs.Sham；#p<0.05vs.I/R。
Figure 14 shows the analysis result of Rg1 to ATP-5DmRNA in I/R rat heart muscle tissue.As shown in the figure, compared with sham operated rats, in I/R group rat heart muscle, the level of ATP-5DmRNA significantly reduces, and Rg1 pre-administration can suppress the reduction of ATP-5DmRNA level significance.This result is analyzed consistent with WesternBlot.
Table 20.Rg1 is on the impact (x ± s) of MDA in I/R rear myocardium tissue
| Group | n | MDA level in heart(nmol/mg) |
| Sham | 6 | 1.86±0.21 |
| Rg1+Sham | 6 | 1.85±0.20 |
| I/R | 6 | 4.06±0.30* |
| Rg1+I/R | 6 | 2.71±0.40# |
Note: * p<0.05vs.Sham; #p<0.05vs.I/R
Figure 15 .Rg1 organizes MDA content to affect on rat heart muscle after I/R.Figure 15 represents MDA content after Sham group, Rg1+Sham group, I/R group, Rg1+I/R group rat Reperfu-sion.*p<0.05vs.Sham；#p<0.05vs.I/R。
The content of MDA in each group of rat heart muscle tissue that the Elisa method that shows Figure 15 detects.The content of the MDA in model group rats cardiac muscular tissue is significantly higher than sham operated rats, and the rising of the MDA content that Rg1 can suppress I/R to cause significance.
3.12Rg1 is on the impact of the rat heart muscle inflammation-related factor that I/R induces
Table 21.Rg1 is on impact (x ± s) (MeanDensity) of the rat heart muscle inflammation-related factor that I/R induces
| Group | n | MPO | ICAM-1 | CD18 |
| Sham | 6 | 0.07±0.01 | 0.05±0.01 | 0.08±0.01 |
| Rg1+Sham | 6 | 0.06±0.01 | 0.03±0.01 | 0.08±0.02 |
| I/R | 6 | 0.21±0.02* | 0.15±0.03* | 0.25±0.03* |
| Rg1+I/R | 6 | 0.15±0.03# | 0.11±0.02# | 0.17±0.01# |
Note: * p<0.05vs.Sham; #p<0.05vs.I/R
Figure 16 .Rg1 is on the impact of rat heart muscle tissue inflammation factor M PO, ICAM-1, CD18 after I/R.Figure 16 D represents the image of MPO, ICAM-1, CD18 immunohistochemical staining after Sham group, Rg1+Sham group, I/R group, Rg1+I/R group rat Reperfu-sion.Brown in figure is positive.Bar＝100μm。
As Figure 16 D shows, the inflammatory factor such as sham operated rats MPO, ICAM-1, CD18 has no obvious expression, and in I/R group myocardial cell, the expression of MPO, CD18 obviously strengthens, and around blood vessel, the expression of ICAM-1 obviously strengthens, and positive cell is brown color.And the enhancing (Figure 16 A, B, C) that MPO, ICAM-1, CD18 that Rg1 can suppress I/R to cause significance express.
Table 22.Rg1 is on the impact (x ± s) of the rat myocardial cell NF-κ BP65 nuclear translocation that I/R causes
Note: * p<0.05vs.Sham; #p<0.05vs.I/R
The impact that rat myocardial cell is starched and in nucleus, NF-κ BP65 expresses that Figure 17 .Rg1 causes I/R.Figure 17 represents westernblot band and the optical density statistical value of NF-κ BP65 after Sham group, Rg1+Sham group, I/R group, Rg1+I/R group rat Reperfu-sion.*p<0.05vs.Sham；#p<0.05vs.I/R。
Figure 17 shows the result that Rg1 analyzes the WesternBlot of NF-κ BP65 in I/R rat myocardial cell slurry and nucleus.As shown in 17A, compared with sham operated rats, in I/R group rat myocardial cell slurry, the level of NF-κ BP65 significantly reduces, and in nucleus, the expression of NF-κ BP65 raises, and shows that NF-κ BP65 inserts to nucleus from cytoplasm, opens transcribing of inflammatory reaction.Rg1 pre-administration can change this change (Figure 17 B, Figure 17 C) in significance ground.
(1) this study demonstrates Rg1 and can reduce the rat myocardial infarction model area that I/R causes, improve cardiac function and heart surface blood flow, thus serve the effect improving ischemical reperfusion injury;
(2) rising of pro apoptotic protein and the reduction of anti-apoptotic proteins in rat heart muscle after Rg1 suppression I/R, maintains ATP content in I/R rear myocardium tissue, suppresses MDA to produce, and then reduce cardiac muscle fiber damage and apoptosis of cardiac muscle;
(3) Rg1 reduces the myocardial infarction area that I/R causes, and improve the promoting the circulation of blood function of heart, improving cardiac blood flow may be play its Anti-G value by PI3K/AKT signal path, NF-κ B signal path and Rho kinase signal pathway;
(4) this result of study is that Rg1 develops into clinical prevention medicament for myocardial ischemia-reperfusion injury and provides pharmacological basis.
List of references
[1]YellonDM,HausenloyDJ.Myocardialreperfusioninjury[J].NEnglJMedOverseasEd,2007,357(11):1121-35.
[2]BodenWE,O'RourkeRA,TeoKK,etal.OptimalmedicaltherapywithorwithoutPCIforstablecoronarydisease[J].NEnglJMedOverseasEd,2007,356(15):1503-16.
[3]JordanJE,ZhaoZQ,Vinten-JohansenJ.Theroleofneutrophilsinmyocardialischemia-reperfusioninjury[J].CardiovascRes,1999,43(4):860-78.
[4]CardenDL,GrangerDN.Pathophysiologyofischaemia-reperfusioninjury[J].JPathol,2000,190(3):255-66.
[5]LinSQ,WeiXH,HuangP,etal.QiShenYiQiPills(R)preventscardiacischemia-reperfusioninjuryviaenergymodulation[J].IntJCardiol,2013,168(2):967-74.
[6] Zhu Bin. the interaction of flesh ball-actin and the progress [J] in dilated cardiomyopathy mechanism thereof. Chinese critical illness emergency medicine, 2002, (01): 56-58.
[7]SumandeaMP,SteinbergSF.Redoxsignalingandcardiacsarcomeres[J].JBiolChem,2011,286(12):9921-7.
[8]HamiltonKL.Antioxidantsandcardioprotection[J].MedSciSportsExerc,2007,39(9):1544-53.
[9]PagliaroP,MoroF,TullioF,etal.Cardioprotectivepathwaysduringreperfusion:focusonredoxsignalingandothermodalitiesofcellsignaling[J].AntioxidRedoxSignal,2011,14(5):833-50.
[10]WebsterKA.Mitochondrialmembranepermeabilizationandcelldeathduringmyocardialinfarction:rolesofcalciumandreactiveoxygenspecies[J].FutureCardiol,2012,8(6):863-84.
[11]WuJ,LiJ,HuH,etal.Rho-kinaseinhibitor,fasudil,preventsneuronalapoptosisviatheAktactivationandPTENinactivationintheischemicpenumbraofratbrain[J].CellMolNeurobiol,2012,32(7):1187-97.
[12]HamidSA,BowerHS,BaxterGF.Rhokinaseactivationplaysamajorroleasamediatorofirreversibleinjuryinreperfusedmyocardium[J].AmJPhysiolHeartCircPhysiol,2007,292(6):H2598-606.
[13] Ma Yongjie, Zhu Dan, Zhong Zhiyin, etc. ginsenoside Rg1 and tanshinone IIA compatibility are to the protective effect [J] of Hypoxia/Reoxygenation Injury myocardial cell. and institute of Military Medical Science Institute prints, and 2010, (03): 243-246.
[14] banket, Liu Guinan. ginsenoside Rg1 is to the effect [J] of rats with acute myocardial infarction angiogenesis. Chinese Medical Sciences University's journal, 2007, (05): 517-519.
[15]ZhangZL,FanY,LiuML.GinsenosideRg1inhibitsautophagyinH9c2cardiomyocytesexposedtohypoxia/reoxygenation[J].MolCellBiochem,2012,365(1-2):243-50.
[16] Wang Yingting, Huang Xienan, Wang Fengan. ginsenoside Rg1 suppresses PGF_ (2 α) inducing cardiomyocytes hypertrophy [J]. Chinese Pharmacological Bulletin, 2008, (05): 611-615.
[17]DuJ,ChengB,ZhuX,etal.GinsenosideRg1,anovelglucocorticoidreceptoragonistofplantorigin,maintainsglucocorticoidefficacywithreducedsideeffects[J].Journalofimmunology(Baltimore,Md.:1950),2011,187(2):942-50.
Accompanying drawing illustrates:
Fig. 1 .Rg1 affects cartogram to the myocardial infarction area that I/R mediates.
Fig. 2 .Rg1 is on the impact of myocardial infarction area after I/R.
Fig. 3 .Rg1 is on the impact of the cardiomorphology that I/R causes.
Fig. 4 .Rg1 is on the impact of the myocardial cell F-actin that I/R causes.
The impact of cTnI content in the cardiac muscular tissue that Fig. 5 .Rg1 causes I/R and serum.
Fig. 6 .Rg1 is on the impact of the myocardial apoptosis that I/R causes.
Fig. 7 .Rg1 organizes the impact of apoptosis-related protein to the rat heart muscle that I/R causes.
Fig. 8 .Rg1 organizes the impact of PI3K/AKT signal path to the rat heart muscle that I/R causes.
Rho kinases in the rat heart muscle tissue that Fig. 9 .Rg1 causes I/R and the impact of substrate thereof.
The hemodynamic impact of rat heart that Figure 10 .Rg1 causes I/R.
Figure 11 .Rg1 is on the impact of the rat heart blood flow that I/R causes.
Figure 12 .Rg1 is on rat heart muscle tissue energy state impact after I/R.
The impact that in the rat myocardial cell that Figure 13 .Rg1 causes I/R, ATP-5D and P-MLC expresses.
The impact that in the rat myocardial cell that Figure 14 .Rg1 causes I/R, ATP-5DmRNA expresses.
Figure 15 .Rg1 organizes MDA content to affect on rat heart muscle after I/R.
Figure 16 .Rg1 is on the impact of rat heart muscle tissue inflammation factor M PO, ICAM-1, CD18 after I/R.
The impact that rat myocardial cell is starched and in nucleus, NF-κ BP65 expresses that Figure 17 .Rg1 causes I/R.
Detailed description of the invention:
Further illustrate the present invention by the following examples, but not as limitation of the present invention.
Embodiment 1
Tablet
[prescription]
Ginsenoside Rg1 100g
Microcrystalline Cellulose 50g
Micropowder silica gel 3g
Magnesium stearate 1.5g
[method for making] gets former, adjuvant mistake 100 mesh sieves respectively; Get ginsenoside Rg1, microcrystalline Cellulose, mixing, with 60% appropriate amount of ethanol as binding agent soft material, cross 20 mesh sieve granules, 60 DEG C of dryings, take out, cross 30 mesh sieve granulate, add micropowder silica gel and magnesium stearate, mixing, tabletting, makes 1000, to obtain final product.
Embodiment 2
[prescription]
Ginsenoside Rg1 75g
Microcrystalline Cellulose 37g
Micropowder silica gel 2.3g
Magnesium stearate 1.1g
[method for making] gets former, adjuvant mistake 100 mesh sieves respectively; Get ginsenoside Rg1, microcrystalline Cellulose, mixing, with 60% appropriate amount of ethanol as binding agent soft material, cross 20 mesh sieve granules, 60 DEG C of dryings, take out, cross 30 mesh sieve granulate, add appropriate micropowder silica gel and magnesium stearate, mixing, tabletting, makes 1000, to obtain final product.
Embodiment 3
[prescription]
Ginsenoside Rg1 133g
Microcrystalline Cellulose 66g
Micropowder silica gel 4g
Magnesium stearate 2g
[method for making] gets former, adjuvant mistake 100 mesh sieves respectively; Get ginsenoside Rg1 1, microcrystalline Cellulose, mixing, with 60% appropriate amount of ethanol as binding agent soft material, cross 20 mesh sieve granules, 60 DEG C of dryings, take out, cross 30 mesh sieve granulate, add appropriate micropowder silica gel and magnesium stearate, mixing, tabletting, makes 1000, to obtain final product.
Embodiment 4
Capsule, gets ginsenoside Rg1 100mg, adds appropriate amount of starch, the adjuvants such as magnesium stearate, and granulate, granulate, loads No. 1 capsule, to obtain final product.
Embodiment 5
Oral liquid, gets ginsenoside Rg1 100mg, adds suitable amount of sucrose, antiseptic, and add water 1000ml, is distributed into 10ml mono-, obtains oral liquid.
Embodiment 6
Granule, gets ginsenoside Rg1 100mg, adds appropriate dextrin, steviosin, dry granulation, granulate, subpackage, to obtain final product.
Embodiment 7
Injection, ginsenoside Rg1 150g adds water
Dissolve, another sodium chloride, ethylparaben heating water dissolve, mixing, adjust pH 5-7.Water for injection is diluted to 1000ml, and filter with hollow-fibre membrane, fill, sterilizing, to obtain final product.
Claims (10)
1. ginsenoside Rg1 is preparing the application prevented and/or treated in the medicine of myocardial ischemia.
2. application according to claim 1, is characterized in that, described in treat and/or prevent myocardial ischemia be that ginsenoside Rg1 improves energy metabolism of myocardial and cardiac function, minimizing myocardial infarction area, improves heart surface blood flow.
3. application according to claim 1, is characterized in that, described in treat and/or prevent myocardial ischemia be the cardiac muscle fiber damage that ginsenoside Rg1 can alleviate that I/R causes, suppress the apoptosis of cardiac muscle that I/R causes.
4. application according to claim 1, is characterized in that, described in treat and/or prevent myocardial ischemia be that ginsenoside Rg1 can the rising of ADP/ATP, AMP/ATP ratio that causes of the suppression I/R of significance.
5. application according to claim 1, is characterized in that, described in treat and/or prevent myocardial ischemia be the expression that ginsenoside Rg1 can improve ATP-5DmRNA and albumen in cardiac muscle, reduce the phosphorylation level of MLC.
6. application according to claim 1, is characterized in that, described in treat and/or prevent the rising that myocardial ischemia is the MDA content that ginsenoside Rg1 can suppress I/R to cause.
7. application according to claim 1, is characterized in that, described in treat and/or prevent myocardial ischemia be ginsenoside Rg1 to the release of pro-inflammatory mediator and apoptosis inhibited.
8. application according to claim 1, is characterized in that, described in treat and/or prevent myocardial ischemia be that ginsenoside Rg1 can improve the reduction of NF-κ BP65 level in I/R group myocardial cell slurry, in nucleus, the expression of NF-κ BP65 raises.
9. application according to claim 1, is characterized in that, described in treat and/or prevent myocardial ischemia be ginsenoside Rg1 I/R can be suppressed to cause MPO, ICAM-1, CD18 express enhancing; TUNEL positive cell number in cardiac muscular tissue can be suppressed, promote the expression of anti-apoptotic proteins Bcl-2, suppress the expression of pro apoptotic protein Bax and cleaved-Caspase-3.
10. application according to claim 1, is characterized in that, described in treat and/or prevent myocardial ischemia be the preventative activation of the ROCK that I/R can be suppressed to cause that takes medicine of ginsenoside Rg1 and the phosphorylation level of its substrate MYPT-1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410378683.4A CN105311045A (en) | 2014-07-31 | 2014-07-31 | Application of ginsenoside Rg1 to preparation of medicines for prevention and/or treatment of myocardial ischemia |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410378683.4A CN105311045A (en) | 2014-07-31 | 2014-07-31 | Application of ginsenoside Rg1 to preparation of medicines for prevention and/or treatment of myocardial ischemia |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105311045A true CN105311045A (en) | 2016-02-10 |
Family
ID=55240006
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410378683.4A Pending CN105311045A (en) | 2014-07-31 | 2014-07-31 | Application of ginsenoside Rg1 to preparation of medicines for prevention and/or treatment of myocardial ischemia |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105311045A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114832025A (en) * | 2022-05-17 | 2022-08-02 | 杭州医学院 | Preparation method and application of ginseng adventitious root crude extract |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102086223A (en) * | 2009-12-07 | 2011-06-08 | 北京本草天源药物研究院 | Method for preparing ginsenoside Rg1 |
-
2014
- 2014-07-31 CN CN201410378683.4A patent/CN105311045A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102086223A (en) * | 2009-12-07 | 2011-06-08 | 北京本草天源药物研究院 | Method for preparing ginsenoside Rg1 |
Non-Patent Citations (2)
| Title |
|---|
| 刘燃: "人参皂苷Rg1对缺血再灌注损伤的保护机制研究进展", 《中国循环杂志》 * |
| 张庆勇: "人参皂苷Rg1对急性心肌缺血大鼠的保护作用及其机制", 《中国优秀硕士学位论文全文数据库 医药卫生科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114832025A (en) * | 2022-05-17 | 2022-08-02 | 杭州医学院 | Preparation method and application of ginseng adventitious root crude extract |
| CN114832025B (en) * | 2022-05-17 | 2023-09-05 | 杭州医学院 | Preparation method and application of ginseng adventitious root crude extract |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zikria et al. | Hydroxyethyl starch macromolecules reduce myocardial reperfusion injury | |
| Yang et al. | Erythropoietin regulates apoptosis, inflammation and tissue remodelling via caspase-3 and IL-1β in isolated hemoperfused kidneys | |
| Ahmed et al. | Sphingosine 1-phosphate receptor modulator fingolimod (FTY720) attenuates myocardial fibrosis in post-heterotopic heart transplantation | |
| KR20170039661A (en) | Devices and methods for injectable vascular sclerofoams using a carrier matrix and uses thereof | |
| CN106038597A (en) | Application of mesenchyma stem cells to preparation of acute lung injury treating preparation | |
| CN106074468A (en) | Cinnamic aldehyde purposes in preparation can induce the derivant of vegf expression and secretion | |
| Sun et al. | Protective effects of bone marrow mesenchymal stem cells (BMMSCS) combined with normothermic machine perfusion on liver grafts donated after circulatory death via reducing the ferroptosis of hepatocytes | |
| Guo et al. | Deferoxamine alleviates iron overload and brain injury in a rat model of brainstem hemorrhage | |
| CN110339232A (en) | A kind of Chinese medicine composition prevented and/or treat ischemical reperfusion injury | |
| Andrews et al. | Structure and function in the excretory systems of some terrestrial prosobranch snails (Cyclophoridae) | |
| CN108586582B (en) | Anticoagulation polypeptide FX18 and application thereof | |
| CN105311045A (en) | Application of ginsenoside Rg1 to preparation of medicines for prevention and/or treatment of myocardial ischemia | |
| KR20210044242A (en) | Drugs used to treat tissue necrosis and improve heart function | |
| CN109893531A (en) | Purposes of the enoxolone in preparation treatment pulmonary hypertension drug | |
| CN104922700A (en) | Experimental method for applying Sirt1-Nrf2 novel oxidation resisting pathway in oxidative damage treatment | |
| CN107137404A (en) | Application of the neferine in prevention or treatment ARDS medicine is prepared | |
| Drabek et al. | Assessment of the delta opioid agonist DADLE in a rat model of lethal hemorrhage treated by emergency preservation and resuscitation | |
| Waagstein et al. | Hypertonic saline without or with dextran-70 in the treatment of experimental acute myocardial ischemia and reperfusion | |
| Chen et al. | Female-sensitive multifunctional phytoestrogen nanotherapeutics for tailored management of postmenopausal Alzheimer's disease | |
| CN105708828A (en) | Application of caffeic acid in preparation of drugs for treating hepatic microcirculation disturbance and hepatic injury | |
| CN107625777A (en) | Purposes of the rhodioside in complement inhibitor medicine is prepared | |
| Othman et al. | Ketorolac-and warfarin-induced renal toxicity: ultrastructural and biochemical study | |
| Starchenko et al. | Generаl pаthomorphology | |
| CN104208085B (en) | Protective effect of the notoginsenoside R to intestinal ischemia reperfusion injury | |
| Huang et al. | Activating Hypoxia-Inducible Factor-1α Reduces Myocardial Ischemia-Reperfusion Injury in Mice Through Hexokinase II |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 300410 Tianjin city Beichen District Huaihe road and road intersection Dingjiang tianzhijiao Park forensic Center for Intellectual Property Department Applicant after: Tasly Pharmaceutical Group Limited by Share Ltd Address before: 300410 Tianjin city Beichen District Huaihe road and road intersection Dingjiang tianzhijiao Park forensic Center for Intellectual Property Department Applicant before: Tasly Pharmaceutical Group Co., Ltd. |
|
| CB02 | Change of applicant information | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160210 |
|
| RJ01 | Rejection of invention patent application after publication |