CN105274116A - Nucleic acid for preparation of humanized antibody and application of nucleic acid - Google Patents
Nucleic acid for preparation of humanized antibody and application of nucleic acid Download PDFInfo
- Publication number
- CN105274116A CN105274116A CN201510686616.3A CN201510686616A CN105274116A CN 105274116 A CN105274116 A CN 105274116A CN 201510686616 A CN201510686616 A CN 201510686616A CN 105274116 A CN105274116 A CN 105274116A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- gene
- acid molecule
- people
- carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 108020004707 nucleic acids Proteins 0.000 title claims abstract description 47
- 102000039446 nucleic acids Human genes 0.000 title claims abstract description 47
- 150000007523 nucleic acids Chemical class 0.000 title claims abstract description 47
- 238000002360 preparation method Methods 0.000 title claims description 6
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 58
- 108700005091 Immunoglobulin Genes Proteins 0.000 claims abstract description 25
- 239000012634 fragment Substances 0.000 claims abstract description 6
- 241001465754 Metazoa Species 0.000 claims description 33
- 210000004027 cell Anatomy 0.000 claims description 16
- 108010019476 Immunoglobulin Heavy Chains Proteins 0.000 claims description 15
- 102000006496 Immunoglobulin Heavy Chains Human genes 0.000 claims description 13
- 108090000765 processed proteins & peptides Proteins 0.000 claims description 12
- 230000009261 transgenic effect Effects 0.000 claims description 12
- 238000000034 method Methods 0.000 claims description 10
- 230000006269 (delayed) early viral mRNA transcription Effects 0.000 claims description 6
- 230000006303 immediate early viral mRNA transcription Effects 0.000 claims description 6
- 102100024222 B-lymphocyte antigen CD19 Human genes 0.000 claims description 4
- 101000980825 Homo sapiens B-lymphocyte antigen CD19 Proteins 0.000 claims description 4
- 210000001161 mammalian embryo Anatomy 0.000 claims description 4
- 230000008707 rearrangement Effects 0.000 claims description 3
- 102000017727 Immunoglobulin Variable Region Human genes 0.000 claims description 2
- 108010067060 Immunoglobulin Variable Region Proteins 0.000 claims description 2
- 210000001082 somatic cell Anatomy 0.000 claims description 2
- 239000007943 implant Substances 0.000 claims 1
- 101710095183 B-cell antigen receptor complex-associated protein alpha chain Proteins 0.000 abstract description 5
- 102100027205 B-cell antigen receptor complex-associated protein alpha chain Human genes 0.000 abstract description 5
- 101710166261 B-cell antigen receptor complex-associated protein beta chain Proteins 0.000 abstract description 5
- 102100027203 B-cell antigen receptor complex-associated protein beta chain Human genes 0.000 abstract description 5
- 230000004048 modification Effects 0.000 abstract description 2
- 238000012986 modification Methods 0.000 abstract description 2
- 108010021625 Immunoglobulin Fragments Proteins 0.000 abstract 1
- 241000894007 species Species 0.000 abstract 1
- 241000699666 Mus <mouse, genus> Species 0.000 description 33
- 241000699670 Mus sp. Species 0.000 description 22
- 108060003951 Immunoglobulin Proteins 0.000 description 19
- 238000001514 detection method Methods 0.000 description 19
- 102000018358 immunoglobulin Human genes 0.000 description 19
- 238000002965 ELISA Methods 0.000 description 15
- 230000009466 transformation Effects 0.000 description 14
- 230000036039 immunity Effects 0.000 description 10
- 238000003209 gene knockout Methods 0.000 description 9
- 108091007433 antigens Proteins 0.000 description 8
- 102000036639 antigens Human genes 0.000 description 8
- 238000005516 engineering process Methods 0.000 description 8
- 210000002966 serum Anatomy 0.000 description 8
- 239000000427 antigen Substances 0.000 description 7
- 235000018102 proteins Nutrition 0.000 description 7
- 102000004169 proteins and genes Human genes 0.000 description 7
- 101710189008 Immunoglobulin kappa light chain Proteins 0.000 description 6
- WNROFYMDJYEPJX-UHFFFAOYSA-K aluminium hydroxide Chemical compound [OH-].[OH-].[OH-].[Al+3] WNROFYMDJYEPJX-UHFFFAOYSA-K 0.000 description 6
- 230000000694 effects Effects 0.000 description 6
- 238000012216 screening Methods 0.000 description 6
- 241000699660 Mus musculus Species 0.000 description 5
- 108091008053 gene clusters Proteins 0.000 description 5
- 238000011830 transgenic mouse model Methods 0.000 description 5
- 101100519158 Arabidopsis thaliana PCR2 gene Proteins 0.000 description 4
- 101150102573 PCR1 gene Proteins 0.000 description 4
- 210000003719 b-lymphocyte Anatomy 0.000 description 4
- 238000010363 gene targeting Methods 0.000 description 4
- 238000011813 knockout mouse model Methods 0.000 description 4
- 230000009471 action Effects 0.000 description 3
- 229910021502 aluminium hydroxide Inorganic materials 0.000 description 3
- 210000004369 blood Anatomy 0.000 description 3
- 239000008280 blood Substances 0.000 description 3
- 238000002347 injection Methods 0.000 description 3
- 239000007924 injection Substances 0.000 description 3
- 238000004519 manufacturing process Methods 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 108091033409 CRISPR Proteins 0.000 description 2
- 241000283073 Equus caballus Species 0.000 description 2
- 241000124008 Mammalia Species 0.000 description 2
- 241000283973 Oryctolagus cuniculus Species 0.000 description 2
- 241001494479 Pecora Species 0.000 description 2
- 241000282898 Sus scrofa Species 0.000 description 2
- 108700019146 Transgenes Proteins 0.000 description 2
- 230000003187 abdominal effect Effects 0.000 description 2
- 230000003044 adaptive effect Effects 0.000 description 2
- 239000002671 adjuvant Substances 0.000 description 2
- 230000009824 affinity maturation Effects 0.000 description 2
- 125000003275 alpha amino acid group Chemical group 0.000 description 2
- 210000004507 artificial chromosome Anatomy 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 238000004945 emulsification Methods 0.000 description 2
- 238000012239 gene modification Methods 0.000 description 2
- 230000005017 genetic modification Effects 0.000 description 2
- 235000013617 genetically modified food Nutrition 0.000 description 2
- 238000001727 in vivo Methods 0.000 description 2
- 230000002779 inactivation Effects 0.000 description 2
- 230000003993 interaction Effects 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 238000012827 research and development Methods 0.000 description 2
- 241000894006 Bacteria Species 0.000 description 1
- 108010001857 Cell Surface Receptors Proteins 0.000 description 1
- 108020004414 DNA Proteins 0.000 description 1
- 238000008157 ELISA kit Methods 0.000 description 1
- 241000196324 Embryophyta Species 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 241000287828 Gallus gallus Species 0.000 description 1
- 108010044091 Globulins Proteins 0.000 description 1
- 102100029572 Immunoglobulin kappa constant Human genes 0.000 description 1
- 108010090227 Immunoglobulin kappa-Chains Proteins 0.000 description 1
- 102100029620 Immunoglobulin lambda constant 2 Human genes 0.000 description 1
- 108010004020 Immunoglobulin lambda-Chains Proteins 0.000 description 1
- 241001529936 Murinae Species 0.000 description 1
- 240000004808 Saccharomyces cerevisiae Species 0.000 description 1
- 230000001363 autoimmune Effects 0.000 description 1
- 229960000074 biopharmaceutical Drugs 0.000 description 1
- 238000010241 blood sampling Methods 0.000 description 1
- 230000007910 cell fusion Effects 0.000 description 1
- 230000011748 cell maturation Effects 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 230000002860 competitive effect Effects 0.000 description 1
- 238000009402 cross-breeding Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000018109 developmental process Effects 0.000 description 1
- 230000008034 disappearance Effects 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 238000004520 electroporation Methods 0.000 description 1
- 239000013604 expression vector Substances 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 230000006801 homologous recombination Effects 0.000 description 1
- 238000002744 homologous recombination Methods 0.000 description 1
- 210000004408 hybridoma Anatomy 0.000 description 1
- 238000002513 implantation Methods 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 238000001638 lipofection Methods 0.000 description 1
- 230000035800 maturation Effects 0.000 description 1
- 102000006240 membrane receptors Human genes 0.000 description 1
- 238000000520 microinjection Methods 0.000 description 1
- VQWNELVFHZRFIB-UHFFFAOYSA-N odn 1826 Chemical compound O=C1NC(=O)C(C)=CN1C(O1)CC(O)C1COP(O)(=O)OC1CC(N2C(NC(=O)C(C)=C2)=O)OC1COP(O)(=O)OC1CC(N2C3=C(C(NC(N)=N3)=O)N=C2)OC1COP(O)(=O)OC1CC(N2C(N=C(N)C=C2)=O)OC1COP(O)(=O)OC1CC(N2C3=NC=NC(N)=C3N=C2)OC1COP(O)(=O)OC1CC(N2C3=C(C(NC(N)=N3)=O)N=C2)OC1COP(O)(=O)OC1CC(N2C(NC(=O)C(C)=C2)=O)OC1COP(O)(=O)OC1CC(N2C(N=C(N)C=C2)=O)OC1COP(O)(=O)OC1CC(N2C(N=C(N)C=C2)=O)OC1COP(O)(=O)OC1CC(N2C(NC(=O)C(C)=C2)=O)OC1COP(O)(=O)OC(C(O1)COP(O)(=O)OC2C(OC(C2)N2C3=C(C(NC(N)=N3)=O)N=C2)COP(O)(=O)OC2C(OC(C2)N2C(N=C(N)C=C2)=O)COP(O)(=O)OC2C(OC(C2)N2C3=NC=NC(N)=C3N=C2)COP(O)(=O)OC2C(OC(C2)N2C3=C(C(NC(N)=N3)=O)N=C2)COP(O)(=O)OC2C(OC(C2)N2C(NC(=O)C(C)=C2)=O)COP(O)(=O)OC2C(OC(C2)N2C3=NC=NC(N)=C3N=C2)COP(O)(=O)OC2C(OC(C2)N2C(N=C(N)C=C2)=O)COP(O)(=O)OC2C(OC(C2)N2C(N=C(N)C=C2)=O)COP(O)(=O)OC2C(OC(C2)N2C(NC(=O)C(C)=C2)=O)COP(O)(O)=O)CC1N1C=C(C)C(=O)NC1=O VQWNELVFHZRFIB-UHFFFAOYSA-N 0.000 description 1
- 239000013612 plasmid Substances 0.000 description 1
- 210000004180 plasmocyte Anatomy 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 230000008054 signal transmission Effects 0.000 description 1
- 210000004988 splenocyte Anatomy 0.000 description 1
- 210000000130 stem cell Anatomy 0.000 description 1
- 238000010254 subcutaneous injection Methods 0.000 description 1
- 239000007929 subcutaneous injection Substances 0.000 description 1
- 230000001225 therapeutic effect Effects 0.000 description 1
- 238000002560 therapeutic procedure Methods 0.000 description 1
- 239000013598 vector Substances 0.000 description 1
- 230000009385 viral infection Effects 0.000 description 1
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Environmental Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Animal Behavior & Ethology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Plant Pathology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a nucleic acid. The nucleic acid comprises a human immunoglobulin gene or fragments thereof and is characterized by further comprising a human CD79 gene sequence. By the nucleic acid, the problem of incompatibility between BCR and each of Ig alpha and Ig beta of the human immunoglobulin gene in different species is solved, and secondary modification of a humanized antibody expressed by the nucleic acid is not needed.
Description
Technical field
The invention belongs to biological technical field, relate generally to a kind of nucleic acid molecule and the application in humanized antibody preparation thereof.
Background technology
Antibody is the important biological medical product of a class, in the prevention and therapy process of human diseases, played important effect.The different developmental stage such as antibody and full humanized antibody is reinvented on the development experience of therapeutic antibodies mouse source antibody, chimeric antibody, reshaping antibody, surface.Full humanized antibody (FullHumanizedAntibody), refers to the antibody on all four with human antibody protein sequence obtained through genetic modification or transgenic animal immunity.Full humanized antibody is not owing to containing animal proteinum, and therefore side effect is lower, and action effect is better, has become the main research and development direction of current and following antibody engineering.The full humanized antibody of transgenic animal (TransgenicHumanizedAntibody) refers to human immunoglobulin gene fully or partially through transgenosis or turn artificial chromosome techniques, be transferred to [antibody gene disappearance (or inactivation) that animal is endogenous] in Animal genome, make animal expression human antibodies, thus obtain full humanized antibody.
Transformed by the external immunoglobulin gene to people, proceed in animal body, an important technology of current humanized antibody research and development again with the antibody of antigen immune improved animal acquisition high-affinity, up to now, U.S. FDA approved 7 humanized antibodies utilizing the method to prepare.The method of current main-stream is the heavy chain immunoglobulin and the light chain gene that the heavy chain immunoglobulin of the mankind and light chain gene are substituted animal self, makes it carry out in animal body resetting the antibody protein generating the mankind.But along with going deep into of research, although find that the human immunoglobulin gene fragment that proceeds to can reset in animal body and express, its performance producing people's antibody protein will lower than without the animal autoantibody production effect before genetic modification.For mouse, its reason mainly when antibody the primary stage that B cell is grown as B cell surface receptor (BCR) time, itself and the signal protein Ig α in mouse source and the interaction of Ig β are not optimum (namely the Ig α in mouse source BCR and mouse source and the Ig α of Ig β or people BCR and people and Ig β repercussion effect are best), therefore have impact on the plasmocyte that the growth of the type conversion of antibody, affinity maturation and B cell is the production antibody of maturation.For overcoming this difficult problem, (Naturebiotechnology, 2014 such as Lee; 32 (4): 356-363) by three human immunoglobulin gene (IgH, Ig κ and Ig λ) variable region substitute the immune globulin variable region of mouse, and constant region uses the respective segments of mouse immuning ball protein, utilize this strategy can overcome the above-mentioned problem mentioned, obtain behaviour source, variable region, constant region is the chimeric antibody in mouse source, then the constant region that the transformation of the constant region in mouse source is people source by the transformation passing through downstream, obtains full humanized antibody.The shortcoming that this method exists needs to carry out secondary transformation could obtain full humanized antibody.
Summary of the invention
A kind of can carrying out in animal body is the object of the present invention is to provide to reset the nucleic acid molecule of expressing humanized antibody, this nucleic acid molecule overcomes human immunoglobulin gene problem due to BCR and Ig α and Ig β interaction non-compatibility in different plant species, the method that the Lee simultaneously mentioned in relative background technology adopts, its humanized antibody of expressing is without the need to carrying out secondary transformation.
The invention provides a kind of nucleic acid molecule, include human immunoglobulin gene or its fragment, and people CD79 gene order.
Above-mentioned CD79 gene order comprises the encoding sequence of CD19 α protein peptide and CD79 β protein peptide.The aminoacid sequence of CD19 α protein peptide and CD79 β protein peptide is respectively as shown in SEDIDNO.3 and SEDIDNO.2.
Above-mentioned people CD79 gene order is as shown in SEDIDNO.1.
The above-mentioned people CD79 sequence proceeded to can be arranged on human immunoglobulin gene's carrier or proceed to the genome of mouse or pig.Preferably, above-mentioned people CD79 sequence is arranged in any one end at people Ig nucleic acid molecule two ends.Described people CD79 sequence is positioned at front end or the rear end, C district in human normal immunoglobulin V district.
In above-mentioned nucleic acid molecule, the structure of CD79 gene order as Figure 1-1.Position is as shown in Figure 1-2 in above-mentioned nucleic acid molecule for CD79.The structure of described nucleic acid molecule as Figure 1-3.
Preferably, above-mentioned human normal immunoglobulin antibody gene or its fragment behaviour immune globulin antibody heavy chain gene.The present invention does not need to carry out inside transformation to human immunoglobulin gene.
Above-mentioned human immunoglobulin gene includes V district gene, D district gene, the J district gene of human immunoglobulin heavy chain's gene.Above-mentioned human immunoglobulin heavy chain's gene can also comprise the 3 '-control region (hLCR) etc. of hC μ, hC γ, hC α, hC δ and/or hC ξ heavy chain gene and/or people.
Such as, the gene cluster of above-mentioned nucleic acid molecule as shown in Figure 2 (black surround position is the people CD79 sequence imported).
By above transformation, above-mentioned nucleic acid molecule can form the signal transmission body that B cell is grown, and is conducive to IgM cell and is converted into IgG cell, and affinity maturation.
A kind of expression vector, comprises above-mentioned nucleic acid molecule.A kind of cell, comprises above-mentioned nucleic acid molecule or above-mentioned carrier.A kind of animal, as mouse, pig etc., comprises above-mentioned nucleic acid molecule.A kind of humanized antibody, is obtained by above-mentioned nucleic acid molecule rearrangement, numbering scheme.Above-mentioned nucleic acid molecule or carrier or cell are preparing the application in humanized antibody.Above-mentioned nucleic acid molecule or carrier or the application of cell in preparation transgenic animal.
Turn human normal immunoglobulin transgenic animal by proceeding to through the human immunoglobulin gene of above-mentioned transformation in animal body to obtain, or the animal of not expressing with autoimmunization globulin gene further carries out hybridizing the genetically engineered animal obtaining and only express people's antibody protein.Utilize antigen immune to proceed to the animal of human immunoglobulin gene's (heavy chain, light chain), obtain full humanized antibody.Such as:
Adopt above-mentioned nucleic acid molecule or carrier or cell to prepare the method for transgenic animal, comprise the following steps:
(1) acquisition of described nucleic acid molecule;
(2) described nucleic acid molecule is built into carrier;
(3) carrier containing described nucleic acid molecule is imported to host cell (comprising stem cell, induced dry-cell and somatocyte) or embryo;
(4) by (mosaic preparation) or somatic cell clone in the embryo of the cell implantation host animal containing people Ig;
(5) animal (comprising the animals with the gene inactivation of host's endogenous immunoglobulin) turning people Ig gene of breed heterozygosis, isozygotying.
Above-mentioned host animal is Mammals, as mouse, rabbit, pig, ox, sheep, chicken, horse etc.Above-mentioned carrier is artificial chromosome (as yeast, bacterium), phage, plasmid etc.The method of above-mentioned vector introduction host cell, comprises electroporation, virus infection, liposome transfection and microinjection etc.
Beneficial effect
1. the full humanized antibody that the present invention produces has high-affinity.
2. the present invention can utilize a kind of transgenic animal strain to produce dissimilar various antibody, and the present invention is applicable to many animals.
3. host autoimmune sphaeroprotein of the present invention is not expressed or below detection limit.
4. gene rearrangement efficiency of the present invention is high, and VDJC resets, sudden change is consistent with human body with utilization ratio.
5. the full humanized antibody of direct production of the present invention, do not need to carry out secondary transformation, expression in vivo amount can reach health adult's level.
6. the present invention does not need to carry out inside transformation to human immunoglobulin gene.
Accompanying drawing explanation
Fig. 1-1 turns people CD79 gene structure figure
Fig. 1-2 turns people CD79 gene structure and screening-gene
Fig. 1-3 turns people CD79 gene and hIg position result figure.
The transformation descendant immunoglobulin heavy chain gene clustering architecture figure of Fig. 2 embodiment 1
Fig. 3 embodiment 1 human normal immunoglobulin Kappa light chain gene clustering architecture figure
Fig. 4 embodiment 1 human normal immunoglobulin lambda light chain gene clustering architecture figure
Fig. 5 embodiment 1 mouse immunoglobulin heavy gene cluster
The gene targeting of Fig. 6 embodiment 1 knock-out mice immunoglobulin heavy chain gene
Fig. 7 embodiment 1 mouse immuning ball protein light chain gene bunch
The gene targeting of Fig. 8 embodiment 1 knock-out mice light chain immunoglobulin gene
Embodiment
Below by specific embodiment, the present invention is specifically described; herein means out following examples to be only used to further illustrate the present invention; can not be interpreted as limiting the scope of the invention, the person skilled in the art of this area can make some nonessential improvement and adjustment according to foregoing invention content to the present invention.
Embodiment 1
The human immunoglobulin gene of transformation proceeded in Mice Body, then the mouse of immunity containing human immunoglobulin gene obtains full humanized antibody, concrete steps are as follows:
1. the Optimizing Reconstruction of human immunoglobulin gene
1) transformation of human immunoglobulin heavy chain's gene
People CD79 gene is proceeded to containing on the YAC of people Ig or BAC carrier by homologous recombination, builds the gene cluster of human immunoglobulin heavy chain's gene (black surround position is the people CD79 gene order imported) as shown in Figure 2.Include be followed successively by human immunoglobulin heavy chain's gene V district, D district, J district, hIgHC μ, hIgHC δ, hIgHC γ 3, hIgHC γ 1, hIgHC α 1, hLCR, hCD79.As Figure 1-1, its gene order is as shown in SEDIDNO.1 for the internal structure of hCD79; Include the encoding sequence of CD79 α protein peptide and CD79 β protein peptide; The aminoacid sequence of CD79 α protein peptide and CD79 β protein peptide is respectively as shown in SEDIDNO.3 and SEDIDNO.2.
2) transformation of human normal immunoglobulin Kappa light chain gene
Human normal immunoglobulin kappa light chain gene includes all or part of V district of human normal immunoglobulin kappa light chain gene, J district, C district, and KDE district.Gene cluster as shown in Figure 3.
3) transformation of human normal immunoglobulin lambda light chain gene
Human normal immunoglobulin lambda light chain gene includes all or part of V district of human normal immunoglobulin lambda light chain gene, J district and C district, adds enhanser structure at end simultaneously.Gene cluster as shown in Figure 4.
2. the cultivation of humanized antibody transgenic mice
1) cultivation of human immunoglobulin heavy chain's DNA murine is turned
Utilize existing conventional transgenic technology by 1 of step 1) in build human immunoglobulin heavy chain's gene proceed in Mice Body.What obtained by PCR detection and the two standard screening of ELISA detection turns human immunoglobulin heavy chain's transgenic mice.
The PCR primers designed used is:
PCR1
For：TGCTTGGAACTGGATCAGGCAGTC
Rev：TTGCTTAACTCCACACCTGCTCCTG
PCRproductsize：329bp
PCR2
For：TTGAGGAGACTGTCCATCCTTCAC
Rev：GAGAGGGCATCTTGGTCTTCTTTC
PCRproductsize：471bp
The antibody identified of ELISA used is: sigma (I1886) and sigma (A8792), with normal adults and healthy mice serum in contrast.
2) cultivation of human normal immunoglobulin kappa light chain gene mouse is turned
Utilize existing conventional transgenic technology by 2 of step 1) in build human normal immunoglobulin kappa light chain gene proceed in Mice Body.What obtained by PCR detection and the two standard screening of ELISA detection turns human normal immunoglobulin kappa chain transgene mouse.
The PCR primers designed used is:
PCR1：
FOR：TGCTCTGACCTCTGAGGACCTGTCTGTA
Rev：TTCAGGCAGGCTCTTACCAGGACTCA
PCRproductsize：616bp
PCR2：
For：CACCCAAGGGCAGAACTTTGTTACT
Rev：GAGGAAAGAGAGAAACCACAGGTGC
PCRproductsize：596bp
The antibody identified of ELISA used is: sigma (K3502) and sigma (A7164), with normal adults and healthy mice serum in contrast.
3) cultivation of human normal immunoglobulin lambda light chain gene mouse is turned
Utilize existing conventional transgenic technology by 3 of step 1) in build human normal immunoglobulin lambda light chain gene proceed in Mice Body.What obtained by PCR detection and the two standard screening of ELISA detection turns human normal immunoglobulin lambda chain transgene mouse.
The PCR primers designed used is:
PCR1：
For：AGCACAATGCTGAGGATGTTGCTCC
Rev：ACTGACCCTGATCCTGACCCTACTGC
PCRproductsize：562bp
PCR2：
FOR：CTCTGCTGCTCCTCACCCTCCTCACTCAGG
REV：GAGAGTGCTGCTGCTTGTATATGAGCTGCA
PCRproductsize：462bp
The antibody identified of ELISA used is: sigma (L1645) and sigma (A5175), with normal adults and healthy mice serum in contrast.
4) cultivation (Fig. 5, Fig. 6) of immunoglobulin heavy chain gene knock-out mice
Utilize Crispr/Cas9 technology, build immunoglobulin heavy chain gene knock-out mice.Select the IgHC μ of mouse immunoglobulin heavy gene as gene knockout site (knock out site and gene knockout effect is shown in Fig. 6), adaptive immune immunoglobulin heavy chain knock out mice.The immunoglobulin heavy chain gene knock-out mice of two standard screening acquisition is detected by PCR detection and ELISA.
The PCR primers designed used is:
PCR：
For：AGCACCATTTCCTTCACCTGGAAC
Rev：CAAGGAGCAAATGACCATGTCTGG
PCR primer: 760bp.Then cut with BstEII enzyme, gene targeting be 753bp, what do not have gene targeting is two bands of 500bp and 260bp.
The antibody identified of ELISA used is: sigma (M8644) and sigma (A8786), with normal adults and healthy mice serum in contrast.
5) cultivation (Fig. 7, Fig. 8) of immunoglobulin (Ig) kappa light chain gene knock-out mice
Conventional gene is utilized to knock out technology, the whole constant region (C) of knock-out mice immunoglobulin (Ig) kappa light chain gene, adaptive immune sphaeroprotein Kappa light chain gene knock-out mice.Detected by PCR and ELISA detection two standard screening acquisition mouse immuning ball protein kappa light chain gene knock-out mice.
The PCR primers designed used is:
PCR1：
For：CCCTTCCCTAGCCAAAGGCAACTA
Rev：CACAACGGGTTCTTCTGTTAGTCC
PCRproductsize：466
PCR2：
For：CACACCTCCCCCTGAACCTGAAAC
Rev：GTTGTGGGTAGTGCCCAGCCTTGC
PCRproductsize：464bp
The antibody identified of ELISA used is: SouthemBiotech (1170-01) and SouthernBiotech (1170-05), with normal adults and healthy mice serum in contrast.
6) cross combination obtains humanized antibody transgenic mice
By second step 1), 2), 3), 4), 5) mouse that step obtains carries out cross breeding, detect through PCR and ELISA, final obtain high expression level human normal immunoglobulin, and do not express (or low expression) rat immune globulin humanized antibody transgenic mice be used for next step research.
3. the acquisition of full humanized antibody
1) OVA immunity the 2nd step 6) the humanized antibody transgenic mice that obtains
The mouse in 8 week age is selected to carry out immunity.
Just exempt from:
1. dilute OVA (SigmaA7641) antigen with PBS, final concentration is 5mg/ml, adds 50ugCpG (ODN1826, tlrl-1826, Invivogen), add appropriate aluminium hydroxide (vac-alu-50, Invivogen), aluminum hydroxide concentration is made to be 1%.
2. incite somebody to action ready antigen 0.75mL 1. to mix by 1: 1 with CFA adjuvant (SigmaF5881), use MIXPAC
tMsyringe makes it emulsification, every mouse, and injected dose is 200ul (0.5mg), carries out subcutaneous injection immunity.
Two exempt from:
1. within the 16th day, carry out two after just exempting to exempt from, dilute antigen with PBS, final concentration is 2.5mg/ml, adds 25ugCpG, adds appropriate aluminium hydroxide, makes aluminum hydroxide concentration be 1%.
2. incite somebody to action ready antigen 0.75mL 1. to mix by 1: 1 with IFA adjuvant, use MIXPAC
tMsyringe makes it emulsification, and every injected in mice dosage is 200ul (0.25mg), carries out abdominal injection immunity.
Three exempt from:
1. two exempt from the 16th day after carry out three and exempt from, dilute antigen with PBS, final concentration is 1.25mg/ml, adds 12.5ugCpG, adds appropriate aluminium hydroxide, makes aluminum hydroxide concentration be 1%.
2. direct injection antigen protein, by 1. middle method preparation, every injected in mice dosage is that 200ul (0.25mg) carries out abdominal injection immunity.
2) mouse antibodies detects
Latter 10 days of 3rd immunity, gets respectively and is numbered 4115,4116, and No. 4117 mouse are got blood and carry out ELISA detection, and with normal adults and wild-type mice in contrast, detect the content of mouse IgG and the content of human IgG in immunized mice serum respectively, result is as follows:
1. the content detection of mouse IgG
Use test kit is mouse IgG ELISA kit (Abcam, ab157719)
4115: below detection limit
4116: below detection limit
4117: below detection limit
Normal adults: below detection limit
Wild-type mice: 0.8mg/ml
Result shows: the mouse IgG expression amount of the humanized antibody mouse after immunity is extremely low.
2. the detection of human IgG in mice serum
Use test kit behaviour IgGELISA test kit (Abcam, ab100547)
4115：9.8mg/ml
4116：8.7mg/ml
4117：7.5mg/ml
Normal adults: 10.2mg/ml
Wild-type mice: < 0.1ng/ml
Result shows: the humanized IgG expression amount of the humanized antibody mouse after immunity is higher.
3. OVA affinity of antibody measures
Choose No. 3556 mouse, by its splenocyte and hybridoma cell fusion, screening monoclonal antibody, ELISA screens 3 the highest cell clones of expression amount, utilize competitive ELISA detection method (CEB459Ge, Cloud-CloneCorp) carry out the detection of anti ova affinity of antibody, the antibody that result shows most high-affinity is 280pM.
Embodiment 2
Improved human immunoglobulin gene proceeded to pig is that host animal (immunoglobulin gene knock-out pig) obtains following result:
The detection of expression of human IgG in pig blood: select PCR to detect transgenic pig that 205,206 positive two proceed to said gene, blood sampling, separation of serum, detects the expression amount of human IgG in blood, with normal adults and with the monthly age common pig in contrast.The antibody that the ELISA used identifies is: sigma (I1886) and sigma (A8792).
Result is as follows:
4115：0.5mg/ml
4116：0.1mg/ml
4117：0.2mg/ml
Normal adults: 10.2mg/ml
Common pig: < 0.1ng/ml
Result shows: the gene proceeded to can at the heavy chain of antibody albumen of pig expression in vivo people.
The present invention is to the modification scheme of human immunoglobulin gene, applicable equally in other Mammals, and such as, pig, rabbit, sheep, horse etc. can realize the beneficial effect of full humanization antibody expression of the present invention equally as host animal.
Claims (15)
1. a nucleic acid molecule, includes human immunoglobulin gene or its fragment, characterized by further comprising: people CD79 gene order.
2. nucleic acid molecule as claimed in claim 1, described CD79 gene comprises the encoding sequence of CD19 α protein peptide and CD79 β protein peptide.
3. nucleic acid molecule as claimed in claim 2, CD19 α protein peptide is as shown in SEDIDNO.3, and CD79 β protein peptide is as shown in SEDIDNO.2.
4. nucleic acid molecule as claimed in claim 1, described people CD79 gene is as shown in SEDIDNO.1.
5. the arbitrary described nucleic acid molecule of claim 1-4, in described nucleic acid molecule, the structure of CD79 gene as Figure 1-1.
6. the arbitrary described nucleic acid molecule of claim 1-5, described people CD79 gene is arranged in any one end at nucleic acid molecule two ends.
7. the nucleic acid molecule as described in as arbitrary in claim 1-6, described human immunoglobulin gene or its fragment comprise V district gene, D district gene, the J district gene of IgH.
8. nucleic acid molecule as claimed in claim 7, described human immunoglobulin heavy chain's gene also comprises hC γ, hC α, hC δ and/or hC ξ heavy chain gene and/or hLCR.
9. nucleic acid molecule as claimed in claim 7 or 8, described people CD79 gene is positioned at front end or the rear end, C district in human normal immunoglobulin V district.
10. a carrier, comprise as claim 1-9 arbitrarily as described in nucleic acid molecule.
11. 1 kinds of cells, comprise as claim 1-9 arbitrarily as described in carrier as described in nucleic acid molecule or claim 10.
12. 1 kinds of humanized antibodies, are obtained by the arbitrary nucleic acid molecule rearrangement of claim 1-9, numbering scheme.
Described in carrier described in the arbitrary described nucleic acid molecule of 13. claim 1-9 or claim 10 or claim 11, cell is preparing the application in humanized antibody.
The application of cell in preparation transgenic animal described in carrier described in the arbitrary described nucleic acid molecule of 14. claim 1-9 or claim 10 or claim 11.
15. adopt cell described in carrier described in the arbitrary described nucleic acid molecule of claim 1-9 or claim 10 or claim 11 to prepare the method for transgenic animal, comprise the following steps:
(1) acquisition of described nucleic acid molecule;
(2) described nucleic acid molecule is built into carrier;
(3) carrier containing described nucleic acid molecule is imported to host cell or embryo;
(4) by containing people Ig cell implant host animal embryo in or somatic cell clone;
(5) animal turning people Ig gene of breed heterozygosis, isozygotying.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510686616.3A CN105274116B (en) | 2015-10-21 | 2015-10-21 | Nucleic acid molecule for preparing humanized antibody and application thereof |
| PCT/CN2015/095737 WO2017067042A1 (en) | 2015-10-21 | 2015-11-27 | Nucleic acid molecules for preparing humanized antibody and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510686616.3A CN105274116B (en) | 2015-10-21 | 2015-10-21 | Nucleic acid molecule for preparing humanized antibody and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105274116A true CN105274116A (en) | 2016-01-27 |
| CN105274116B CN105274116B (en) | 2020-09-29 |
Family
ID=55143950
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510686616.3A Active CN105274116B (en) | 2015-10-21 | 2015-10-21 | Nucleic acid molecule for preparing humanized antibody and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN105274116B (en) |
| WO (1) | WO2017067042A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108486125A (en) * | 2018-03-27 | 2018-09-04 | 重庆金迈博生物科技有限公司 | A kind of nucleic acid molecules and its application in preparing people source single domain antibody |
| CN110662421A (en) * | 2017-01-19 | 2020-01-07 | 开放式单克隆技术股份有限公司 | Human antibodies from transgenic rodents having multiple heavy chain immunoglobulin loci |
| CN112040769A (en) * | 2018-03-24 | 2020-12-04 | 瑞泽恩制药公司 | Genetically modified non-human animals for the production of therapeutic antibodies against peptide-MHC complexes, methods of manufacture and uses thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1560081A (en) * | 2004-02-17 | 2005-01-05 | 大连帝恩生物工程有限公司 | Preparing human source monoclone antibody by mouse capable of producing human IgGl weight chain-k light chain and application thereof |
| CN101263158A (en) * | 2005-08-03 | 2008-09-10 | 人类多克隆治疗股份有限公司 | Suppression of B-cell apoptosis in transgenic animals expressing humanized immunoglobulin |
| WO2009012268A1 (en) * | 2007-07-16 | 2009-01-22 | Genentech, Inc. | Anti-cd79b antibodies and immunoconjugates and methods of use |
| CN101506235A (en) * | 2006-09-01 | 2009-08-12 | 人类多细胞株治疗学公司 | Enhanced expression of human or humanized immunoglobulin in non-human transgenic animals |
| CN103917650A (en) * | 2011-08-05 | 2014-07-09 | 瑞泽恩制药公司 | Humanized universal light chain mice |
| CN104342455A (en) * | 2010-06-22 | 2015-02-11 | 瑞泽恩制药公司 | Mice expressing alight chain with human lambda variable and mouse constant regions |
-
2015
- 2015-10-21 CN CN201510686616.3A patent/CN105274116B/en active Active
- 2015-11-27 WO PCT/CN2015/095737 patent/WO2017067042A1/en active Application Filing
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1560081A (en) * | 2004-02-17 | 2005-01-05 | 大连帝恩生物工程有限公司 | Preparing human source monoclone antibody by mouse capable of producing human IgGl weight chain-k light chain and application thereof |
| CN101263158A (en) * | 2005-08-03 | 2008-09-10 | 人类多克隆治疗股份有限公司 | Suppression of B-cell apoptosis in transgenic animals expressing humanized immunoglobulin |
| CN101506235A (en) * | 2006-09-01 | 2009-08-12 | 人类多细胞株治疗学公司 | Enhanced expression of human or humanized immunoglobulin in non-human transgenic animals |
| WO2009012268A1 (en) * | 2007-07-16 | 2009-01-22 | Genentech, Inc. | Anti-cd79b antibodies and immunoconjugates and methods of use |
| CN104342455A (en) * | 2010-06-22 | 2015-02-11 | 瑞泽恩制药公司 | Mice expressing alight chain with human lambda variable and mouse constant regions |
| CN103917650A (en) * | 2011-08-05 | 2014-07-09 | 瑞泽恩制药公司 | Humanized universal light chain mice |
Non-Patent Citations (2)
| Title |
|---|
| NCBI: "Homo sapiens CD79b molecule,immunoglobulin-associated beta", 《NCBI REFERENCE SEQUENCE：NG_007368.1》 * |
| 葛良鹏 等: "人源化抗体转基因动物的研究进展与趋势", 《农业生物技术》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110662421A (en) * | 2017-01-19 | 2020-01-07 | 开放式单克隆技术股份有限公司 | Human antibodies from transgenic rodents having multiple heavy chain immunoglobulin loci |
| US12016313B2 (en) | 2017-01-19 | 2024-06-25 | Omniab Operations, Inc. | Human antibodies from transgenic rodents with multiple heavy chain immunoglobulin loci |
| CN112040769A (en) * | 2018-03-24 | 2020-12-04 | 瑞泽恩制药公司 | Genetically modified non-human animals for the production of therapeutic antibodies against peptide-MHC complexes, methods of manufacture and uses thereof |
| CN108486125A (en) * | 2018-03-27 | 2018-09-04 | 重庆金迈博生物科技有限公司 | A kind of nucleic acid molecules and its application in preparing people source single domain antibody |
| CN108486125B (en) * | 2018-03-27 | 2024-01-05 | 重庆金迈博生物科技有限公司 | Nucleic acid molecule and application thereof in preparation of humanized single domain antibody |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2017067042A1 (en) | 2017-04-27 |
| CN105274116B (en) | 2020-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104994729B (en) | Encode the polynucleotides with the rodent animal antibody of human idiotype and the animal comprising the polynucleotides | |
| CN102719444B (en) | The expression that people or Humanized immunoglobulin strengthen in non-human transgenic animal | |
| Osborn et al. | High-affinity IgG antibodies develop naturally in Ig-knockout rats carrying germline human IgH/Igκ/Igλ loci bearing the rat CH region | |
| CN106255410A (en) | Produce the protein-bonded non-human animal of single domain | |
| JP6621750B2 (en) | Histidine engineered light chain antibody and genetically modified non-human animals for producing the same | |
| JP2001505059A (en) | Transgenic mammal having a human Ig locus comprising multiple VＶH and V 下 K regions, and antibodies produced therefrom | |
| CN102206275B (en) | Anti-tetanotoxin monoclonal neutral antibody, and composition and application thereof | |
| CN107090471A (en) | Common light chain mice | |
| KR20150126871A (en) | Mice expressing a limited immunoglobulin light chain repertoire | |
| CN106117364A (en) | Expression comprises Vlthe rodentine preparation method of humanization of the heavy chain of domain | |
| CN103571872B (en) | A kind of preparation method of the transgenic animal that can express people's antibody | |
| JPH04500911A (en) | Production of antibodies from transgenic animals | |
| Murphy | VelocImmune: immunoglobulin variable region humanized mice | |
| CN106164092A (en) | VL antigen binding proteins exhibiting different binding characteristics | |
| CN105274116A (en) | Nucleic acid for preparation of humanized antibody and application of nucleic acid | |
| WO2019184014A1 (en) | Nucleic acid molecule and use thereof in preparing humanized single-domain antibody | |
| CN109913493A (en) | The preparation method and application of humanization CD3 genetic modification animal model | |
| EP3235507A1 (en) | Application of binding molecule for specific binding of precursor for brain-derived neurotrophic factor | |
| CN105829534A (en) | Novel anti-human bdca-2 antibody | |
| CN118140872A (en) | Human antibodies from transgenic rodents having multiple heavy chain immunoglobulin loci | |
| CN105441455A (en) | Chimeric nucleic acid molecule and application thereof to humanized antibody preparation | |
| CN1560081A (en) | Preparing human source monoclone antibody by mouse capable of producing human IgGl weight chain-k light chain and application thereof | |
| CN102260322B (en) | Antigen peptide of Helicobacter pylori and application thereof | |
| CN102453091B (en) | Tetanus toxoid monoclonal antibody and preparation method and application thereof | |
| CN105777894A (en) | Method for preparing humanized camelidae single-domain antibody through transgenic rodent |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20161122 Address after: 402460 Chang Chang street, Rongchang, Chongqing Chang Chang Avenue, No. 53, Applicant after: Chongqing Jin Bo Bo Biotechnology Co., Ltd. Address before: 402460 Chongqing Changlong Road, Rongchang County, No. 51 Applicant before: Chongqing Academy of Animal Sciences Applicant before: Zou Xiangang |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |