CN105274059A - Two breast cancer stem cell lines capable of being stably cultured and keeping original characteristics, separation method and uses thereof - Google Patents
Two breast cancer stem cell lines capable of being stably cultured and keeping original characteristics, separation method and uses thereof Download PDFInfo
- Publication number
- CN105274059A CN105274059A CN201510330647.5A CN201510330647A CN105274059A CN 105274059 A CN105274059 A CN 105274059A CN 201510330647 A CN201510330647 A CN 201510330647A CN 105274059 A CN105274059 A CN 105274059A
- Authority
- CN
- China
- Prior art keywords
- stem cell
- breast carcinoma
- carcinoma stem
- posterity
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses two breast cancer stem cell lines capable of being stably cultured and keeping original characteristics, separation method and uses thereof. A breast cancer tumor specimen just cut off from the tumor is taken, then is subjected to collagenase digestion and is filtered; a flow cytometer sorts CD44<+>, CD24<-> and ALDH1<+> cells, the cells are adjusted to a purity of more than 98%; a stem cell culturing agent for breast cancer cell is prepared; the sorted cells are screened in a monoclonal manner and the obtained monoclone cells are inoculated in an ultralow adhesion culture dish containing breast cancer stem cell culturing agents; penicillin and streptomycin are added in the original culturing medium; culturing is performed in CO<2> cultivation box. In the continuous culturing process, the breast cancer stem cell lines capable of being stably cultured and keeping original characteristics keep ball formation ability, self-updating ability, CD44<+>, CD24<-> /low Lin- ALDH1<+> phenotype, pluripotency differentiation ability, in vitro soft agar tumorigenesis ability, in vivo tumorigenesis ability in nude mouse, and in vivo tumorigenesis pluripotency differentiation ability in nude mouse.
Description
Technical field:
The invention belongs to field of pharmaceutical biology, be specifically related to two strain Absorbable organic halogens and go down to posterity and keep the breast carcinoma stem cell system of former characteristic and separation method thereof and application.
Background technology:
Mammary cancer is the first malignant tumour of women, and sickness rate increases year by year.According to American Cancer Society (ACS) 2012 annual data statistics, the U.S. increases diagnosed SARS case 230,000 newly, increases 29%, death 40,000, increases by 14%.China along with lifestyle change, urbanization process accelerate, and breast molybdenum target x-ray check popularization, the case newly detected every year rises year by year, Chinese Shanghai breast cancer incidence by 1972 17,/10 ten thousand rise to 2007 69.22/10 ten thousand.Meanwhile, the incidence of Chinese Breast Cancer presents the feature of rejuvenation relative to western countries.After onset peak age of most of western countries mammary cancer appears at 60 years old.In China, onset peak age of mammary cancer is advanced by 10 to 15 years about then appearing at 45-50 year.Its histological type more tends to the strong type of invasive ability, poorer more.On Area distribution, morbidity city is higher than agriculture city, and developed area is higher than economic backward area.Along with social astogeny, patient with breast cancer's number will be more, estimate that China's mammary cancer new cases in 2011 reach 2,500,000 in 1,100,000,2021.This means in China, vast life and the life being in the women of career and family noontide of mammary cancer serious harm, become " the primary killer " that threaten women's health.It has caused the great attention of the World Health Organization and medical profession personage to the serious harm of human health.Tumor stem cell has stem cell properties, can carry out self and Multidirectional Differentiation, and playing conclusive effect to the formation of tumour, growth, resistance, recurrence and transfer, is the difficult point place of oncotherapy.There is self and differentiation capability, in continuous fission process, more likely obtain the chance of repeatedly suddenling change and become the tumour cell of pernicious breeding, thus producing tumour.And the resistance of these tumor stem cells and tumour, recurrence and transfer are closely bound up.Therefore, kill tumor stem cell and become a kind of new ideas of cancer therapy.But as far as we know, there is no the breast carcinoma stem cell system that the clinical source that Absorbable organic halogens goes down to posterity is set up in any laboratory at present, Gu Er, the breast carcinoma stem cell system that the Absorbable organic halogens in the urgent need to setting up clinical source goes down to posterity also is applied to clinical and scientific research.
Summary of the invention:
First object of the present invention is to provide two strain Absorbable organic halogens and goes down to posterity and the breast carcinoma stem cell system keeping former characteristic, it is characterized in that, is separated by the following method and obtains:
(1), take the breast cancer tumour sample just excised, first through collagenase digesting process, refilter;
(2), selected by flow cytometry apoptosis goes out CD44
+, CD24
-and ALDH1
+cell, regulate require that cell purity is more than 98%;
(3), breast carcinoma stem cell nutrient chemical is configured, the cell sub-elected in step (2) is inoculated in the culture dish of the ultralow adhesion containing breast carcinoma stem cell nutrient chemical after mono-clonal screening, penicillin is added and Streptomycin sulphate is dual anti-, in CO in original cuiture
2namely incubator cultivation obtains two strain Absorbable organic halogens and goes down to posterity and the breast carcinoma stem cell system keeping former characteristic, respectively called after XM322 and XM607.
Described in step (1) through collagenase digesting process, preferably use collagenase III, in every milliliter of tissue juice, add 250 unit collagenase III, then be placed in 37 DEG C of constant incubators and cultivate 4 hours.
Filtration described in step (1), preferably uses 40mm filter screen to filter.
Breast carcinoma stem cell nutrient chemical described in step (2), preferably, its formula is: in serum-free DMEM-F12, add 10ng/mL Basic Fibroblast Growth Factor, 20ng/mL Urogastron, 2%B27 and 5ug/mL Regular Insulin.
Mono-clonal screening described in step (2), preferred method is: be diluted to single cell by severe 1:2 limiting dilution assay, and is dripped by cell dispersal in 96 orifice plates, and basis of microscopic observation confirms as single cell, and person cultivates further.
Penicillin described in step (3), its addition is preferably 100U/mL, described Streptomycin sulphate, and its addition is preferably 0.1mg/mL.
CO described in step (3)
2incubator, is preferably 5%CO
2incubator.
Described selected by flow cytometry apoptosis goes out CD44
+, CD24
-and ALDH1
+cell by prior art routine operation.
Second object of the present invention is to provide two strain Absorbable organic halogens and goes down to posterity and keep the breast carcinoma stem cell of former characteristic to tie up to the application prepared and treat in breast cancer medicines.
Pass through biochip technology, measure the expression of its microRNAs, and compare with the expression of the microRNAs of mammary epithelial cell system and breast cancer cell line, measure the differential expression of optimum (mammary epithelial cell system) and pernicious (breast cancer cell line and breast carcinoma stem cell system), explore interference microRNAs possible in the application of application breast carcinoma stem cell, the microRNA measuring its minimum expression is miR-34a.In conjunction with the efficient specific amplification system " VISA " (VP16-GAL4-WPREintegratedsystemicamplifier) in patent application 201210064390.X, and be successfully applied to the plasmid T-VISA-miR-34a of breast cancer treatment.After using T-VISA-miR-34a to carry out treatment breast carcinoma stem cell, gene chip finds that its cDNA changes situation, and measures its possible treatment path in conjunction with DAVI network data base.Further by vivo and vitro test, measure the treatment plasmid T-VISA-miR-34a of structure to the result for the treatment of of breast carcinoma stem cell system and therapy mechanism.Medicine T-VISA-miR34a liposome of the present invention has breast carcinoma stem cell system and breast cancer cell line efficiently kills ability for a long time, and to normal cell without killing action, to body height safety.
Two strain breast carcinoma stem cell systems (XM322 and XM607) that the present invention sets up, have stable can repeatedly going down to posterity, and the characteristic of tumour cancer stem cell.The equal cultured continuously of two strain breast carcinoma stem cells more than 4 years, and passes 20 generations more than continuously.In continuous passage process, two strain cells all remain stem cell balling-up, self, CD44
+cD24
-/lowlin
-aLDH1
+phenotype, pluripotent differentiation, external soft agar become in knurl ability, nude mouse to become in knurl ability, nude mouse knurl pluripotent differentiation ability.
The breast carcinoma stem cell system that two strain clinical source of the present invention can go down to posterity repeatedly stably sets up, find in its application of exploration, the low expression of microRNA-34a is the most significant, kill breast carcinoma stem cell safely and effectively by building TV-miR-34a lipid physical efficiency, Mechanism Study finds that it is worked by microRNA-34a-CTNNB1-survivin path.Therefore, huge effect is played by the research eliminating mammary cancer by the stable breast carcinoma stem cell system of going down to posterity of foundation, and has broad prospects.
Accompanying drawing illustrates:
Fig. 1 is the balling-up of the breast carcinoma stem cell of two strain clinical source and external self-renewal capacity, and scale is 250 μm; ;
Fig. 2 is the CD44 of the breast carcinoma stem cell of two strain clinical source
+cD24
-/lowlin
-aLDH1
+phenotype;
Fig. 3 is the ability that breast carcinoma stem cell has pluripotent differentiation in vitro;
Fig. 4 is the body interior one-tenth knurl ability of breast carcinoma stem cell;
Fig. 5 is the interior tumor stem cell ability keeping going down to posterity of body of breast carcinoma stem cell, and scale is 100 μm;
Fig. 6 is the body interior maintenance pluripotent differentiation ability of breast carcinoma stem cell, and scale is 50 μm;
Fig. 7 is the external breast carcinoma stem cell effectively can eliminating green glimmering chromoprotein mark of TV-miR-34a, and scale is 50 μm;
Fig. 8 is that sample rna extracts quality monitoring scatter diagram (volcano figure);
Fig. 9 is the benign breast epithelial cell line of gene chip mensuration and the microRNAs differential expression of malignant breast cell system (breast carcinoma stem cell system and breast cancer cell line);
Figure 10 is the gene expression difference situation after TV-miR-34a acts on breast carcinoma stem cell system;
Figure 11 be differential expression genes through DAVI because of its possible effect path of network database analysis;
Figure 12 is the T-VISA-miR34a plasmid construct schematic diagram built.
Embodiment:
Following examples further illustrate of the present invention, instead of limitation of the present invention.Experimental technique in following examples if no special instructions, is ordinary method.Experiment material in following examples if no special instructions, is all buy from the biochemical reagents company of routine obtained.
Embodiment 1:
One, the Absorbable organic halogens of separation and Culture clinical source goes down to posterity and keeps the breast carcinoma stem cell system of former characteristic
(1), take the breast cancer tumour sample just excised, in every milliliter of tissue juice, add 250 unit collagenase III, then be placed in 37 DEG C of constant incubators cultivations, 4 hours digestion process, re-use 40mm filter screen and filter;
(2), flow cytometer (CytomicsFC500) sub-elects CD44
+, CD24
-and ALDH1
+cell, regulate and require cell purity (CD44 and CD24 antibody is from CellSignaling company more than 98%; ALDH1 antibody is from Technologies company);
(3), configuration breast carcinoma stem cell nutrient chemical: add 10ng/mL Basic Fibroblast Growth Factor (purchased from Invitrogen company) in serum-free DMEM-F12 (purchased from Invitrogen company), 20ng/mL Urogastron (purchased from Invitrogen), 2%B27 (purchased from Invitrogen company) and 5ug/mL Regular Insulin (purchased from NovoNordisk company), the cell sub-elected in step (2) (is diluted to single cell by severe 1:2 limiting dilution assay through mono-clonal screening, and cell dispersal is dripped in 96 orifice plates, basis of microscopic observation confirms as single cell, and person cultivates further) after be inoculated in the culture dish (purchased from Corning company) of the ultralow adhesion containing breast carcinoma stem cell nutrient chemical, penicillin (addition is 100U/mL) is added and Streptomycin sulphate (addition is 0.1mg/mL) is dual anti-in original cuiture, in 5%CO
2namely incubator cultivation obtains two strain Absorbable organic halogens and goes down to posterity and the breast carcinoma stem cell system keeping former characteristic, respectively called after XM322, XM607.
Under the suspension culture agent cultivation of the breast carcinoma stem cell of clinical source, stablize vitro culture 20 generation, last more than 4 years, still keep good balling-up ability, as shown in Figure 1.Respectively all keep breast carcinoma stem cell surface markers CD24 for cell
-cD44
+lin
-aLDH1
+, as shown in Figure 2.
In pluripotent differentiation test, add 0.50% bovine serum albumin (available from Sigma), the breast carcinoma stem cell of the clinical source of vitro culture keeps differentiation capability under 0.5% bovine serum albumin condition, as shown in Figure 3.
Breast carcinoma stem cell XM322, XM607 of clinical source become knurl when 1000 cells with regard in enough bodies, and clinical source breast cancer cell needs 100000 cells still enough not become knurl.Breast carcinoma stem cell becomes knurl ability to strengthen along with going down to posterity in mouse, as shown in Figure 4.
Breast carcinoma stem cell XM322, XM607 of the present invention in vivo Absorbable organic halogens go down to posterity, as shown in Figure 5.
Tissue after breast carcinoma stem cell XM322, XM607 of the present invention become knurl in vivo has the ability of mammary cancer differentiation mark, as shown in Figure 6.
Two, the making of MicroRNAs and mRNA gene chip and analysis
The making of MicroRNAs chip and analysis:
1, normal breast epithelial (184A1 and MCF-12A) and breast cancer cell line (MDA-MB-231, MCF-7, MDA-MB-468 and SK-Br-3 are all purchased from ATCC company) is adopted to extract its total serum IgE (Trizol method);
2, after Total RNAs extraction first and through Agilent2100 biological analyser electrophoresis and be defined as high-quality preparation sample, then to use with further experiment;
3, sample is through GeneSpringGX (AgilentTechnologies, Beijing Bo Aojing allusion quotation biotech company) measure further and kernel of mass pair, and represent with scatter diagram, can find out that the difference condition of genetic expression between A group sample and B group sample has good repeatability intuitively from the volcano figure of Fig. 8, sample quality is good, the quality good (A sample and B sample refer to and RNA twice repeated sample that breast carcinoma stem cell extracts detect the repeatability of twice sample) of sample before showing genechip detection.Wherein X-axis (lateral shaft) and Y-axis (longitudinal axes) are coordinate respectively with fluorescence signal intensity, in figure, each point represents the fluorescence signal intensity of a probe sets (gene) on chip, redness represents Ratio value >=2 of B/A, that is: the gene of rise occurs B/A; Green represents Ratio value≤0.5 of B/A, that is: the gene of downward occurs B/A; Black represents the Ratio value of B/A between 0.5 and 2.0, and both express basic indifference, and result as shown in Figure 8.
4, the expression of difference microRNAs shown in Figure 9, gene chip is presented in benign breast epithelial cell line and pernicious (breast cancer cell and breast carcinoma stem cell), the change situation of both microRNAs (upper table refers to lower in malignant clone, and following table refers to the micro-RNAs raised in malignant clone).
The making of mRNA chip and analysis:
1, breast carcinoma stem cell system (MDA-MB-231SC and MCF-7SC in breast cancer cell line source is adopted, and XM322 and XM607 in clinical samples of the present invention source) TV-miR-34a of transfection carrier contrast and Green Fluorescent Protein respectively, the TV-miR-34a group that transfection green fluorescent protein (GFP) marks went out the cell with GFP through selected by flow cytometry apoptosis after 48 hours, extract its total serum IgE respectively to prepare to detect (Trizol reagent, Invitrogen company) further;
2, cDNA is synthesized by SuperScriptChoiceSystem (InvitrogenLifeTechnologies, Beijing Bo Aojing allusion quotation biotech company) operation execution, gene chip adopts Affymetrix chip to measure, and by AffymetrixGenechipCommandConsole (AffymetrixMicroarraySuite) software analysis result;
3, breast carcinoma stem cell is under T-VISA-miR-34a effect, and gene chip measures its gene alteration situation as shown in Figure 10, and left side is the gene lowered, and right side is the gene raised;
4, differential expression genes is through DAVI because of its possible effect path of network database analysis, and result as shown in figure 11.
Three, the preparation of TV-miR-34a liposome
TV-miR-34a treats the structure of carrier:
(1) pCRII-TOPO-hTERT plasmid clone
1, ordinary method extracts the DNA of MCF-7 Breast Cancer Cell (purchased from American ATCC company);
2, using this DNA as template, the PCR primer of design amplification hTERT, hTERTPCR upstream (Forward) and downstream (Reverse) primer:
Forward：5'-atatctagaggcccctccctcgggttaccccacagc-3'(XbaI)
Reverse：5'-atagatcttatgcggccgcccacgtgcgcagcaggacgcagcgc-3'
3, with MCF-7 Breast Cancer Cell DNA for template, hTERT promotor PCR primer (Forward:5'-atatctagaggcccctccctcgggttaccccacagc-3'; Reverse:5'-atagatcttatgcggccgcccacgtgcgcagcaggacgcagcgc-3'), PfuDNApolymerase, dNTP and PCR reaction solution, amplification obtains hTERT promotor (-416to+1) product; Its PCR reaction system: 10 × PCRbuffer5 μ l, each 1 μ l of upstream (Forward) and downstream (Reverse) primer, MCF-7 cell DNA is template 100ngDNA, 25mMMgCl
23 μ l, 10mMdNTPs1 μ l, Pfu-Taq (1U/ μ l), last moisturizing to 50 μ l; PCR reaction conditions: 94 DEG C of thermally denature 5min, 94 DEG C of sex change 1min, 55 DEG C of annealing 1min, 72 DEG C extend 2min, carry out 30 circulations altogether; Last 72 DEG C extend 10min;
4, PCR primer Qiangen company (U.S.) pcr dna reclaims test kit recovery, and reclaim about 418bp size segment, method is with reference to its specification sheets.
5, the PCR primer 2 μ l will reclaimed, pCRII-TOPO (Invitrogen, Carlsbad, CA) 1 μ l, DNAligasebuffer1 μ l, last moisturizing to 10 μ l, 4 DEG C of ligation 10min;
6, after being mixed with 50 μ lE.coliDH5 α competent cells by 2 μ l connection products, ice bath 30min, 42 DEG C of hot agitated reaction 45sec of water-bath, then place 3min on ice, and add the LB substratum 500 μ l of preheating, at 37 DEG C, 250rpm jolts 30min.
7, get 200 μ lLB substratum bacterium liquid, on coating ampicillinLB culture plate, cultivate 16 hours at 37 DEG C; Picking positive monoclonal, extracts plasmid;
8, digested plasmid qualification, carries out sequencing analysis, confirms that hTERT promotor has been inserted in cloning vector pCRII-TOPO, called after pCRII-TOPO-hTERT.
(2), pGL3-hTERT-Luc plasmid clone
1, pCRII-TOPO-hTERT plasmid is cut with KpnI/Xho1 enzyme, pGL-3-basic plasmid (Promega company is cut with KpnI/Xho1 enzyme, Madison, WI), containing luciferase Luciferase gene in this plasmid, enzyme cuts system: 10 × BufferA2 μ l, KpnI/Xho11 μ l, plasmid 5 μ g, moisturizing to 20 μ l, 37 DEG C of water-baths 1 hour;
2, digestion products electrophoresis in 1 × TAEAgarose gel, 120v electrophoresis 30 minutes, reclaims hTERT (418bp size) segment and pGL-3-Basis (4792bp size) segment;
3, digestion products Qiangen company (U.S.) pcr dna reclaims test kit recovery, and method is with reference to its specification sheets;
4, the hTERT product 6 μ l reclaimed, the pGL-3-basic product 2 μ l of recovery, DNAligase1 μ l, buffer1 μ l, last moisturizing to 10 μ l, 4 DEG C of ligations 4 hours;
5, after 2 μ l connection products being mixed with 50 μ lE.coliDH5 α competent cells, ice bath 30min, 42 DEG C of hot agitated reaction 45sec of water-bath, then place 3min on ice, and add the LB substratum 500 μ l of preheating, at 37 DEG C, 250rpm jolts 30min;
6, get 200 μ lLB substratum bacterium liquid, on coating AmpicillinLB culture plate, cultivate 16 hours at 37 DEG C; Picking positive monoclonal, extracts plasmid;
7, digested plasmid qualification, carries out sequencing analysis, confirms hTERT promotor in insertion vector pGL-3-basic, called after pGL3-hTERT-Luc plasmid.
(3), pGL3-Luc-WPRE plasmid clone
1, cut pGEM-3Z-WPRE plasmid (Promega company, Madison, WI) with Asp718/SalI enzyme, then use DNApolymerase flush end; PGL-3-basic plasmid (Promega company, Madison, WI) is cut with SmalI enzyme; Enzyme cuts system: 10XBufferA2 μ l, Asp7181 μ l/SalI1 μ l, plasmid 5 μ g, moisturizing to 20 μ l, 37 DEG C of water-baths 1 hour;
2, digestion products electrophoresis in 1XTAEAgarose gel, 120v electrophoresis 30 minutes, reclaims WPRE (590bp size) segment and pG-L3-Basic (about 4800bp size) segment;
3, digestion products Qiangen company (U.S.) pcr dna reclaims test kit recovery, and method is with reference to its specification sheets;
4, the WPRE product 6 μ l reclaimed, the pGL-3-basic product 2 μ l of recovery, DNAligase1 μ l, buffer1 μ l, last moisturizing to 10 μ l, 4 DEG C of ligations 4 hours;
5, after 2 μ l connection products mix with 50 μ lE.coliDH5 competent cells, ice bath 30min, 42 DEG C of hot agitated reaction 45sec of water-bath, then place 3min on ice, and add the LB substratum 500 μ l of preheating, at 37 DEG C, 250rpm jolts 30min;
6, get 200 μ lLB substratum bacterium liquid, on coating AmpicillinLB culture plate, cultivate 16 hours at 37 DEG C; Picking positive monoclonal, extracts plasmid;
7, digested plasmid qualification, carries out sequencing analysis, confirms that WPRE inserts in pGL-3-basic, called after pGL3-Luc-WPRE plasmid.
(4), pGL3-hTERT-TSTA-Luc plasmid clone
1, cut pCRII-TOPO-hTERT plasmid with HindIII/NotI enzyme, then use DNApolymerase flush end; PGL3-TSTA-Luc plasmid (Invitrogen, Carlsbad, CA) is cut with MSCI/NheI enzyme, then use DNApolymerase flush end, enzyme cuts system: 10XBufferA2 μ l, HindIII/NotIorMSCI/NheI1 μ l, plasmid 5 μ g, moisturizing to 20 μ l, 37 DEG C of water-baths 1 hour;
2, digestion products electrophoresis in 1XTAEAgarose gel, 120v electrophoresis 30 minutes, reclaims hTERT (418bp size) segment and pGL3-TSTA-Luc (7300bp size) segment;
3, digestion products Qiangen company (U.S.) pcr dna reclaims test kit recovery, and method is with reference to its specification sheets;
4, the hTERT product 6 μ l reclaimed, the pGL3-TSTA-Luc product 2 μ l of recovery, DNAligase1 μ l, buffer1 μ l, last moisturizing to 10 μ l, 4 DEG C of ligations 4 hours;
5, after 2 μ l connection products mix with 50 μ lE.coliDH5 α competent cells, ice bath 30min, 42 DEG C of hot agitated reaction 45sec of water-bath, then place 3min on ice, and add the LB substratum 500 μ l of preheating, at 37 DEG C, 250rpm jolts 30min;
6, get 200 μ lLB substratum bacterium liquid, on coating AmpicillinLB culture plate, cultivate 16 hours at 37 DEG C; Picking positive monoclonal, extracts plasmid;
7, digested plasmid qualification, carries out sequencing analysis, confirms that hTERT promotor inserts in carrier pGL3-TSTA-Luc, called after pGL3-hTERT-TSTA-Luc plasmid.
(5), T-VISA-Luc plasmid clone
1, pGL3-Luc – WPRE plasmid is cut with NotI/BglII enzyme; Cut pGL3-hTERT-TSTA-Luc plasmid with NotI/BglII enzyme, enzyme cuts system: 10XBufferA2 μ l, NotI1 μ l, BglII1 μ l, plasmid 5 μ g, moisturizing to 20 μ l, 37 DEG C of water-baths 1 hour;
2, digestion products electrophoresis in 1XTAEAgarose gel, 120v electrophoresis 30 minutes, reclaims WPRE (590bp size) segment and pGL3-hTERT-TSTA-Luc (7593bp size) segment;
3, digestion products Qiangen company (U.S.) DNA reclaims test kit recovery, and method is with reference to its specification sheets;
4, the WPRE product 6 μ l reclaimed, the pGL3-hTERT-TSTA-Luc product 2 μ l of recovery, DNAligase1 μ l, buffer1 μ l, last moisturizing to 10 μ l, 4 DEG C of ligations 4 hours;
5, after 2 μ l connection products mix with 50 μ lE.coliDH5 competent cells, ice bath 30min, 42 DEG C of hot agitated reaction 45sec of water-bath, then place 3min on ice, and add the LB substratum 500 μ l of preheating, at 37 DEG C, 250rpm jolts 30min;
6, get 200 μ lLB substratum bacterium liquid, on coating AmpicillinLB culture plate, cultivate 16 hours at 37 DEG C; Picking positive monoclonal, extracts plasmid;
7, digested plasmid qualification, carries out order-checking and confirms that called after pGL3-hTERT-TSTA-Luc-WPRE plasmid is called for short pGL3-hTERT-VISA-Luc plasmid, i.e. T-VISA-Luc plasmid.
(6), pGL3-T-VISA-miR34a plasmid
1, with people has-miR-34a (MI0000268) sequence: the uggcagugucuuagcugguugu of miRBase warehouse publication, corresponding DNA sequence dna is: TGGCAGTGTCTTAGCTGGTTGT, another synthesis stochastic sequence (without target spot in popularity): 5 '-GACUAACGCAAGUCCACUGAU-3 ', according to the oligonucleotide strand of above sequences Design synthesis loop-stem structure, add BglII, NheI restriction enzyme site respectively at 5 ' end of two pairing strands, loop ring sequence is CTCGAG.Oligonucleotide strand (Ying Weijie base trade Co., Ltd synthesizes, Shanghai) renaturation in vitro becomes double-strand (renaturation buffer: 100mmol/LTris-HCl, pH8.0; 10mmol/LEDTA, pH8.0; 1mol/LNaCl.Renaturation program: hatch 10min for 95 DEG C, powered-down slowly cools to room temperature), the renaturation product getting 5 μ L500nmol/L detects through the agarose gel electrophoresis of 5%;
2, cut pGL3-hTERT-VISA-Luc plasmid sticky end with BglII/NheI enzyme, enzyme cuts system: 10XBufferA2 μ l, BglII1 μ l, NheI1 μ l, plasmid 5 μ g, moisturizing to 20 μ l, 37 DEG C of water-baths 1 hour;
3, pGL3-hTERT-VISA-Luc plasmid enzyme restriction product and renaturation has-miR-34a hairpin structure electrophoresis in 1XTAEAgarose gel, 120v electrophoresis 30 minutes, reclaims miR-34ashRNA fragment (493bp) and pGL3-hTERT-VISA segment (1650bp) (enzyme cuts except luciferase gene);
4, digestion products Qiangen company (U.S.) DNA reclaims test kit recovery, and method is with reference to its specification sheets;
5, the miR-34ashRNA product 6 μ l reclaimed, the pGL3-hTERT-VISA product 2 μ l of recovery, DNAligase1 μ l, buffer1 μ l, last moisturizing to 10 μ l, room temperature ligation is spent the night;
6, after 2 μ l connection products mix with 50 μ lE.coliDH5 α competent cells, ice bath 30min, 42 DEG C of hot agitated reaction 45sec of water-bath, then place 3min on ice, and add the LB substratum 500 μ l of preheating, at 37 DEG C, 250rpm jolts 30min;
7, get 200 μ lLB substratum bacterium liquid, on coating AmpicillinLB culture plate, cultivate 16 hours at 37 DEG C; Picking positive monoclonal, extracts plasmid;
8, digested plasmid qualification, carry out order-checking and confirm, miR-34ashRNA is inserted in pGL3-hTERT-VISA, called after pGL3-T-VISA-miR34a plasmid.
(7), pUK21-T-VISA-miR34a treats carrier
1, cut pGL3-T-VISA-miR34a plasmid with NotI/SalI enzyme, enzyme cuts system: 10XBufferA2 μ l, NotI1 μ l, SalI1 μ l, plasmid 5 μ g, moisturizing to 20 μ l, 37 DEG C of water-baths 1 hour, cut pUK21 plasmid with NotI/SalI enzyme, the enzyme system of cutting is: 10XBufferA2 μ l, NotI1 μ l, SalI1 μ l, plasmid 5 μ g, moisturizing to 20 μ l, 37 DEG C of water-baths 1 hour;
2, digestion products electrophoresis in 1XTAEAgarose gel, 120v electrophoresis 30 minutes, reclaims T-VISA-miR34a fragment) (1049bp) and pUK21 fragment (816bp).
3, digestion products Qiangen company (U.S.) DNA reclaims test kit recovery, and method is with reference to its specification sheets;
4, the T-VISA-miR34a product 6 μ l reclaimed, the pUK21 product 2 μ l of recovery, DNAligase1 μ l, buffer1 μ l, last moisturizing to 10 μ l, 4 DEG C of ligations 4 hours;
5, after 2 μ l connection products mix with 50 μ lE.coliDH5 α competent cells, ice bath 30min, 42 DEG C of hot agitated reaction 45sec of water-bath, then place 3min on ice, and add the LB substratum 500 μ l of preheating, at 37 DEG C, 250rpm jolts 30min;
6, get 200 μ lLB substratum bacterium liquid, on coating KanamycinLB culture plate, cultivate 16 hours at 37 DEG C; Picking positive monoclonal, extracts plasmid;
7, digested plasmid qualification, carry out order-checking to confirm, T-VISA-miR34a fragment is inserted into the NotI/SalI site of pUK21 plasmid, and called after pUK21-T-VISA-miR34a treats carrier, is called for short T-VISA-miR34a and treats carrier (its plasmid map as shown in figure 12).T-VISA-miR-34a can kill the breast carcinoma stem cell of band GFP mark effectively, as shown in Figure 7.
It is that the miR-34ashRNA double-strand of synthesis is after renaturation that pUK21-T-VISA-miR34a treats carrier, miR-34ashRNA fragment is inserted into the BglII/NheI/ flush end site of pGL3-hTERT-TSTA-Luc-WPRE plasmid, produces pGL3-T-VISA-miR34a plasmid.After pGL3-T-VISA-miR34a plasmid NotI/SalI enzyme is cut, T-VISA-miR34a fragment is inserted into the NotI/SalI site of pUK21 plasmid, produces pUK21-T-VISA-miR34a and treats carrier, treat carrier referred to as T-VISA-miR34a.
PUK21-T-VISA-miR34a treats carrier and mainly comprises hTERT promotor, WPRE, G5E4T and Gal4-VP2 gene and miR-34ashRNA sequence.HTERT promotor control Gal4-VP2 (VP16 of two copies, has strong transcripting activating characteristic) antigen-4 fusion protein gene; Gal4-VP2 fusion rotein is combined with Gal4 response element G5E4T, start transcribing in a large number of microRNA34a, the complete or incomplete pairing of the target genes such as microRNA34a and Bcl-2, CD44 3 ' UTR, degraded target gene mRNA or suppress it to translate, thus cause apoptosis.
The preparation of liposome:
Lipid is taken out from refrigerator (DOTAP is stored in-20 DEG C, cholesterol is stored in-4 DEG C), return to room temperature.2 Rotary Evaporators respectively to 30 DEG C of heating in water bath, 50 DEG C.Take 68.75mg cholesterol, put into 1000ml round-bottomed flask.100mgDOTAP and 25mgChloroform is added in round-bottomed flask.Rotate flask, make it fully mix.In the water bath of 30 DEG C, rotate round-bottomed flask 2min, make it mix, flask walls forms thin film.Open vacuum aspirator, 30min at 30 DEG C.5% glucose solution adding 8.9ml preheating dissolves dry film, with 105 turns/min fast rotational 45min at 50 DEG C.Then reduce temperature to 35 DEG C and rotate 10min.Flask is sealed, overnight at room temperature, lucifuge with preservative film (or paraffin).Measurement volumes, adds distilled water to 8.9ml.In the ultrasonic water bath case of 50 DEG C, (200W) carries out supersound process 1 minute to flask.Successively by 1.0 μm at 50 DEG C, 0.45 μm, 0.22 μm, the filter membrane of 0.1 μm (1.0 μm, 0.45 μm is the polysufone filter membrane of Whatman, and article No. is respectively #6780-1310 and #6780-1304; 0.22 μm, 0.1 μm is the Anotop filter membrane of Whatman, and article No. is respectively #6808-1122 and #6809-1112), put into clean vial finally by the liposome of 0.1 μm.Fill test tube 10 seconds with nitrogen, liposome is stored in test tube and is placed in 4 DEG C keep in Dark Place (preventing air from entering) for subsequent use simultaneously.
The preparation of T-VISA-miR34a liposome:
T-VISA-miR34a treats carrier and is dissolved in 5% glucose solution, makes its final concentration be 1ug/ul, and diluted with 5% glucose solution by the liposome storing the embodiment 2 of concentration (20mM) is working concentration (8mM) simultaneously.The T-VISA-miR34a of 1 μ gDNA/ul treats carrier and slowly adds (treatment carrier: liposome=20ug:50ul) in the liposome of 8mM, leaves standstill 20 minutes at room temperature, reaction, forms medicine T-VISA-miR34a liposome.
And then examine and determine, biological nature detects and the Quality Control such as intracellular toxin, aseptic subpackaged.Finished product is examined and determine, packaging, 4-8 DEG C of preservation; First put room temperature before using 20 minutes, can in vitro study be directly used in, also can be used for In vivo study, also can use with after 5% glucose solution dilution.
Claims (8)
1. liang strain Absorbable organic halogens goes down to posterity and keeps the breast carcinoma stem cell system of former characteristic, it is characterized in that, is separated by the following method and obtains:
(1), take the breast cancer tumour sample just excised, first through collagenase digesting process, refilter;
(2), selected by flow cytometry apoptosis goes out CD44
+, CD24
-and ALDH1
+cell, regulate require that cell purity is more than 98%;
(3), breast carcinoma stem cell nutrient chemical is configured, the cell sub-elected in step (2) is inoculated in the culture dish of the ultralow adhesion containing breast carcinoma stem cell nutrient chemical after mono-clonal screening, penicillin is added and Streptomycin sulphate is dual anti-, in CO in original cuiture
2namely incubator cultivation obtains two strain Absorbable organic halogens and goes down to posterity and the breast carcinoma stem cell system keeping former characteristic.
2. two strain Absorbable organic halogens according to claim 1 go down to posterity and keep the breast carcinoma stem cell system of former characteristic, it is characterized in that, described in step (1) through collagenase digesting process, specifically use collagenase III, add 250 unit collagenase III in every milliliter of tissue juice, then be placed in 37 DEG C of constant incubators cultivations 4 hours.
3. two strain Absorbable organic halogens according to claim 1 go down to posterity and keep the breast carcinoma stem cell system of former characteristic, it is characterized in that, the filtration described in step (1), filter for using 40mm filter screen.
4. two strain Absorbable organic halogens according to claim 1 go down to posterity and keep the breast carcinoma stem cell system of former characteristic, it is characterized in that, breast carcinoma stem cell nutrient chemical described in step (2), its formula is: in serum-free DMEM-F12, add 10ng/mL Basic Fibroblast Growth Factor, 20ng/mL Urogastron, 2%B27 and 5ug/mL Regular Insulin.
5. two strain Absorbable organic halogens according to claim 1 go down to posterity and keep the breast carcinoma stem cell system of former characteristic, it is characterized in that, mono-clonal screening described in step (2), method is: be diluted to single cell by severe 1:2 limiting dilution assay, and cell dispersal is dripped in 96 orifice plates, basis of microscopic observation confirms as single cell, and person cultivates further.
6. two strain Absorbable organic halogens according to claim 1 go down to posterity and keep the breast carcinoma stem cell system of former characteristic, it is characterized in that, the penicillin described in step (3), and its addition is 100U/mL, described Streptomycin sulphate, and its addition is 0.1mg/mL.
7. two strain Absorbable organic halogens according to claim 1 go down to posterity and keep the breast carcinoma stem cell system of former characteristic, it is characterized in that, the CO described in step (3)
2incubator is 5%CO
2incubator.
8. according to claim 1 two strain Absorbable organic halogens go down to posterity and keep former characteristic breast carcinoma stem cell system preparation treatment breast cancer medicines in application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510330647.5A CN105274059A (en) | 2015-06-15 | 2015-06-15 | Two breast cancer stem cell lines capable of being stably cultured and keeping original characteristics, separation method and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510330647.5A CN105274059A (en) | 2015-06-15 | 2015-06-15 | Two breast cancer stem cell lines capable of being stably cultured and keeping original characteristics, separation method and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105274059A true CN105274059A (en) | 2016-01-27 |
Family
ID=55143895
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510330647.5A Pending CN105274059A (en) | 2015-06-15 | 2015-06-15 | Two breast cancer stem cell lines capable of being stably cultured and keeping original characteristics, separation method and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105274059A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110396501A (en) * | 2019-08-01 | 2019-11-01 | 江苏省人民医院（南京医科大学第一附属医院） | Three-dimensional spheroid culture method for maintaining dryness of breast cancer stem cells in vitro |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103243075A (en) * | 2013-05-23 | 2013-08-14 | 成都美进生物科技有限公司 | Separation method of breast cancer stem cells |
-
2015
- 2015-06-15 CN CN201510330647.5A patent/CN105274059A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103243075A (en) * | 2013-05-23 | 2013-08-14 | 成都美进生物科技有限公司 | Separation method of breast cancer stem cells |
Non-Patent Citations (2)
| Title |
|---|
| FRANCISCO FERRO DE BEÇA 等: ""Cancer stem cells markers CD44, CD24 and ALDH1 in breast cancer special histological types"", 《J CLIN PATHOL》 * |
| 郑文博 等: ""乳腺癌干细胞的培养及鉴定"", 《南方医科大学学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110396501A (en) * | 2019-08-01 | 2019-11-01 | 江苏省人民医院（南京医科大学第一附属医院） | Three-dimensional spheroid culture method for maintaining dryness of breast cancer stem cells in vitro |
| CN110396501B (en) * | 2019-08-01 | 2020-10-30 | 江苏省人民医院（南京医科大学第一附属医院） | Three-dimensional spheroid culture method for maintaining dryness of breast cancer stem cells in vitro |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108624561B (en) | Primary tumor cell culture medium, culture method and application | |
| CN103627673B (en) | A kind of human glioma cell line and its method for building up and application | |
| CN103146688A (en) | Application of long-chain non-coding RNA as blood molecular marker for disease diagnosis | |
| CN107447033A (en) | A kind of diagnosis of colorectal carcinoma biomarker and its application | |
| CN102250840B (en) | Human pancreatic cancer cell line and its application | |
| CN106867967A (en) | The LM3 cell lines and its construction method of Midkine stable low-expressions | |
| CN106282347A (en) | HoxC11 as biomarker preparation adenocarcinoma of lung pre-diagnostic reagent in application | |
| CN108949988A (en) | A kind of application of long-chain non-coding RNA SNHG6 in breast cancer diagnosis or treatment | |
| CN111718995B (en) | Biomarker for nasopharyngeal carcinoma metastasis diagnosis and/or prognosis evaluation | |
| CN103667441B (en) | A kind of Hsa-miR-145-5p test kit and the application of ripe body analogies thereof | |
| CN105219881A (en) | The test kit of a kind of detection by quantitative ERCC1-202 and application | |
| Templeton et al. | Methods for culturing human femur tissue explants to study breast cancer cell colonization of the metastatic niche | |
| CN105255832A (en) | Human bile duct cancer cell line and applications thereof | |
| CN110229901A (en) | Gene hsa_circ_0027089 relevant to triple negative breast cancer diagnosis and treatment and its application | |
| CN105274059A (en) | Two breast cancer stem cell lines capable of being stably cultured and keeping original characteristics, separation method and uses thereof | |
| CN104531760B (en) | The short hairpin RNA interference plasmid and its application process of Dp71 albumen | |
| CN105483246A (en) | Application of differential expression of gene in oral cancer diagnosis | |
| CN105288659A (en) | Application of TENM1 gene and its expression product on diagnosis and treatment of papillary adenocarcinoma | |
| CN103451303B (en) | Kit for detecting expression level of human ERCC1 (excision repair cross complementation 1) through PCR (polymerase chain reaction) method | |
| CN113817683A (en) | Culture medium for lung cancer organoid and application thereof | |
| CN105925530A (en) | High-metastasis pancreatic cancer cell strain and construction method and application thereof | |
| CN105132547A (en) | Application of STAC2 gene and STAC2 gene coding protein in inhibition of pelvic organ prolapse | |
| CN111635939A (en) | Product for detecting RBP1 gene or protein and application | |
| CN104403996A (en) | Human gastric cancer cell line with 5-fluorouracil resistance and establishing method and application thereof | |
| CN104740649B (en) | Applications of the PLEKHA5 in tumour diagnostic reagent is prepared |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160127 |
|
| RJ01 | Rejection of invention patent application after publication |