CN105274056A - Method for establishing hepatocellular carcinoma cis-platinum drug-resisting cell strain - Google Patents
Method for establishing hepatocellular carcinoma cis-platinum drug-resisting cell strain Download PDFInfo
- Publication number
- CN105274056A CN105274056A CN201410314627.4A CN201410314627A CN105274056A CN 105274056 A CN105274056 A CN 105274056A CN 201410314627 A CN201410314627 A CN 201410314627A CN 105274056 A CN105274056 A CN 105274056A
- Authority
- CN
- China
- Prior art keywords
- cell
- cis
- platinum
- hepatocellular carcinoma
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a method for establishing a hepatocellular carcinoma cis-platinum drug-resisting cell strain. The method is characterized by comprising the following steps: step 1, taking human hepatoma carcinoma LM3 cells, thawing the cells, and culturing the cells by adopting DMEM culture solution in a culture box; step 2, taking the LM3 cells in the logarithmic phase, planting the LM3 cells in the logarithmic phase in a 24 well-plate, respectively adding 0.1mu mol/L cis-platinum, 0.25 mu mol/L cis-platinum, 0.5 mu mol/L cis-platinum, 1 mu mol/L cis-platinum, 2 mu mol/L cis-platinum, 5 mu mol/L cis-platinum, and 10 mu mol/L cis-platinum into the 24 well-plate, and carrying out passage or liquid change timely, wherein after the addition of cis-platinum, the maximum concentration for keeping the long-term growth of the cells is taken as the optimum concentration; and step 3, searching for the optimum concentration as 0.5 mu mol/L, and exciting the cells for the term of 4 months with the optimum concentration, and thus obtaining the hepatocellular carcinoma cis-platinum drug-resisting cell strain. The obtained hepatocellular carcinoma cis-platinum drug-resisting cell strain can be used for searching for the tumour drug-resisting marker and screening and evaluating novel anti-tumor drugs, etc.
Description
Technical field
The invention belongs to field of biomedicine technology, relate to the establishment method of a kind of hepatocellular carcinoma cisplatin-resistant cell strain.
Background technology
Primary hepatocarcinoma is current one of modal malignant tumour in the world, its sickness rate is rank the 6th in malignant tumour, and mortality ratio then occupies the 3rd, and has been middle and advanced stage during the diagnosis of most of liver cancer patient, postoperative frequent relapse and metastasis, causes the prognosis of liver cancer patient poor.Chemotherapy is one of important means of Hepatoma therapy, but in chemotherapy normal occur and insoluble be multi-drug resistance of the tumor (multidrugresistance, MDR), namely the chemicals that tumour is simultaneously different with mechanism of action to various structures produces crossing drug resistant, and it is the major cause of chemotherapy failure.Therefore overcome multi-drug resistance of the tumor and prevent or reverse multiple drug resistance of tumor generation for raising chemotherapy effect very important.And tumor drug resistance is machine-processed, tumor cell drug resistance reverses, develop and evaluate new drug etc. has important using value for studying to set up tumor drug resistance cell strain.
Cis-platinum (cis-diaminedichloroplatinum, CDDP) belongs to cell cycle nonspecific agent (CCNSA), has cytotoxicity, can the DNA replication dna process of anticancer, and damage structure on its cytolemma, having stronger broad spectrum anticancer effect, is clinical treatment liver cancer common drug.
Summary of the invention
The object of the present invention is to provide the strain of a kind of hepatocellular carcinoma cisplatin-resistant cell, another object of the present invention is to provide the construction process of this drug-resistant cell strain.
Main technical schemes of the present invention is for induction object with human liver cell JEG-3 LM3, set up cis-platin concentrations gradient, find maximum resistance to concentration, namely, cell can be survived and the concentration of slowly growth, and with this concentration long-time stimulus cell more than 4 months, final acquisition human hepatocellular carcinoma cisplatin-resistant cell strain LM3/CDDP cell strain.
The construction process that the invention provides the strain of a kind of hepatocellular carcinoma cisplatin-resistant cell is as follows:
(1) use DMEM nutrient solution after getting human liver cancer cell LM3 cell recovery, in 37 DEG C, cultivate in 5%CO2 incubator;
(2) for looking for optimum cis-platinum irritating concentration, take the logarithm vegetative period LM3 cell kind in 24 orifice plates, add 0.1 μ g/mL, 0.25 μ g/mL, 0.5 μ g/mL, 1 μ g/mL, 2 μ g/mL, 5 μ g/mL, 10 μ g/mL cis-platinums respectively, go down to posterity in good time or change liquid.
When going down to posterity at every turn or change liquid, all add respective concentration cis-platinum.Using cis-platinum add rear cell can survive and the maximum resistance to concentration of slowly growth as screening concentration.
When the concentration of cis-platinum is 0.5 μ g/mL, LM3 cell can be survived but be grown slowly; When concentration is less than 0.5 μ g/mL, LM3 cell not only can large number of viable, can also comparatively fast grow; LM3 complete cell death when concentration is greater than 0.5 μ g/mL.Therefore, we determine that screening concentration is 0.5 μ g/mL, and continue long-time stimulus cell 4 months with this screening concentration, and finally screen the LM3 mdr cell that can grow fast under 0.5 μ g/mL cis-platinum stimulates, its maximum resistance to concentration can reach 3 μ g/mL.
Present invention also offers a kind of hepatocellular carcinoma cisplatin-resistant cell strain obtained according to above-mentioned construction process.
The invention provides the strain of a kind of hepatocellular carcinoma cisplatin-resistant cell, the construction process of this cell strain is as follows:
After recovery human hepatoma cell strain LM3 cell, with the DMEM nutrient solution containing 10% foetal calf serum, in 37 DEG C, cultivate in 5%CO2 incubator; The human hepatoma cell strain LM3 cell of taking the logarithm vegetative period is inoculated in culture hole; In culture hole, add cis-platinum to final concentration is 0.5 μ g/mL, goes down to posterity in good time or changes liquid; After going down to posterity at every turn or changing liquid, all adding cis-platinum to final concentration is 0.5 μ g/mL, cultured continuously more than 3 months; Screen the human hepatoma cell strain LM3 cell that still can grow fast and be cisplatin-resistant cell strain.
Cisplatin-resistant cell strain of the present invention is after 0.5 μ g/mL cis-platinum stimulates 4 months, the human hepatoma cell strain LM3 cell that still can grow fast.
The maximum resistance to concentration of cisplatin-resistant cell strain of the present invention is 3 μ g/L.
Cisplatin-resistant cell strain called after LM3/CDDP of the present invention.
The present invention, by morphological observation, growth curve mensuration, the mensuration of cell cycle and scratch experiment, evaluates the biological characteristics of liver cancer persister LM3/CDDP, successfully sets up LM3/CDDP persister.
Present invention also offers the application of liver cancer cisplatin-resistant cell strain LM3/CDDP in screening antineoplastic drugs.
Present invention also offers liver cancer cisplatin-resistant cell strain LM3/CDDP and prepare the application in antitumor drug.
Invention effect and effect
Of the present inventionly set up the strain of hepatocellular carcinoma cisplatin-resistant cell method is simple, the present invention can be used for the change of the morphology after analyzing liver cancer cell cisplatin resistance and biological phenotype; Research tumour is to the method for the molecular mechanism of cisplatin resistance and reversing tumor resistance and screen other antitumor drugs; Find tumor drug resistance mark and screening and assessment new type antineoplastic medicine etc., there is higher research and production using value.
Accompanying drawing explanation
Fig. 1 is that proof diagram is set up in the induction of liver cancer persister LM3/CDDP cell;
Fig. 2 is the cellular form of LM3 and LM3/CDDP cell under opticmicroscope; Wherein a is LM3, b is LM3/SORA;
Fig. 3 is LM3 and LM3/CDDP cell growth curve figure;
Fig. 4 is LM3 and LM3/CDDP cell cycle;
Fig. 5 is the scratch experiment figure of LM3 and LM3/CDDP cell;
Fig. 6 is that in LM3 and LM3/CDDP cell, P-gpmRNA contains spirogram; And
Fig. 7 is LM3 and LM3/CDDP cell Xarelto (Sorafenib) post-stimulatory growth curve chart.
Embodiment
Further illustrate the present invention by the following examples,
Further illustrate the present invention by the following examples, but enforcement of the present invention is not limited only to this.
The human liver cancer cell LM3 cell that embodiment is used, hereinafter referred to as LM3 cell, purchased from the Chinese Academy of Sciences; Embodiment cis-platinum used is the product of the 50mg specification of commercially available SelleckChemicals company.
LM3CON in each accompanying drawing represents that with normal LM3 cell as a control group, LM3CDDP represents liver cancer persister LM3/CDDP.
< embodiment one >
The induction establishment method of liver cancer persister LM3/CDDP cell
(1) DMEM nutrient solution is used after getting LM3 cell recovery, in 37 DEG C, 5%CO
2cultivate in incubator;
(2) for looking for optimum cis-platinum irritating concentration, taking the logarithm vegetative period LM3 cell kind in 24 orifice plates, adding 0.1 μ g/L, 0.25 μ g/L, 0.5 μ g/L, 1 μ g/L, 2 μ g/L, 5 μ g/L, 10 μ g/L cis-platinums respectively, go down to posterity in good time or change liquid.When going down to posterity at every turn or change liquid, all correspondingly add each concentration chemotherapeutic.With chemotherapeutic add rear cell can survive and the peak concentration of slowly growth for optimum concn.In the present embodiment, the long term growth of indication refers to the growth time of more than 3 months.
Experimental result shows: when the concentration of cis-platinum is 0.5 μ g/mL, LM3 cell can be survived but be grown slowly; When concentration is less than 0.5 μ g/mL, LM3 cell not only can large number of viable, can also comparatively fast grow; LM3 complete cell death when concentration is greater than 0.5 μ g/mL.Therefore, we determine that screening concentration is 0.5 μ g/mL.
(3) use optimum concn 0.5 μ g/L long-time stimulus cell 4 months, obtain cisplatin-resistant cell strain.With the LM3 cell that this cell and the same period cultivate, after cell counting, plant in 24 orifice plates, every hole kind 5 × 10
4individual cell, adds the cis-platinum (0.5 ~ 15 μ g/L) of concentration gradient, takes pictures after 96 hours after 24 hours.The mdr cell obtained as shown in Figure 1.LM3/CDDP cell still can growth metabolism when 3 μ g/mL concentration compared with LM3 cell, and substratum its colour changed into yellow, illustrates that LM3/CDDP cell has good resistance (each numeral cis-platin concentrations used, unit μ g/mL).The maximum resistance to concentration of LM3/CDDP cell can reach 3 μ g/mL.
< embodiment two >
The morphological observation of liver cancer persister LM3/CDDP cell
Use inverted phase contrast microscope to observe viable cell form: the LM3 cell in vegetative period of taking the logarithm respectively and LM3/CDDP cell, after physiological saline clean and change liquid, under inverted microscope magnification 200 times, observe viable cell form.As shown in Fig. 2 (a), can observe LM3 cell size basically identical by light microscopic, many pseudopodium sample polygon, part is circular.And as shown in Fig. 2 (b), LM3/CDDP cell size can be observed by light microscopic and differ, have circle and polygon, and polygon comes in every shape.
< embodiment three >
The growth curve of liver cancer persister LM3/CDDP cell measures
LM3, LM3/CDDP cell of taking the logarithm vegetative period, counts with 0.5% trysinization, and inoculating into 96 orifice plates by the density of 5000 cells in every hole and to establish 3 multiple holes, every hole adds 200 μ L substratum again, is positioned over 37 DEG C, cultivates in 5%CO2 incubator.Respectively at 0h, 24h, 48h, the each time point of 72h and 96h absorbs substratum, and every hole adds 100 μ LCCK8 working fluids, cultivates after 1 hour in incubator, put into microplate reader with 570nm wavelength detecting, read the OD value in every hole and calculating mean value, take time as X-coordinate, OD value mean value is ordinate zou, be depicted as growth curve.
Result as shown in Figure 3.The growth curve chart of LM3, LM3/CDDP, result as shown in Figure 3.Survey two cell growth curves continuously to find through too much sky, two cell growth curve plesiomorphisms, result as shown in Figure 3, and the rate of propagation of cisplatin-resistant cell strain LM3/CDDP compared with normal tumor cell line LM3 is faster, and be cultured to 96 little curves constantly still upwards, and now the growth curve of normal tumor cell line LM3/CON tends towards stability, display mdr cell LM3/CDDP has good resistance.
< embodiment four >
Detect the cell cycle
LM3, LM3/CDDP cell is planted respectively in 6 orifice plates, 0.1%FBSDMEM synchronization 12h, be changed to 10%FBSDMEM substratum, at corresponding time point collecting cell, suck substratum, the digestion damping fluid peptic cell of the pancreatin with 0.5%, 1mMEDTA, with the ethanol fixed cell of 70%, it is to be measured to put 4 DEG C of preservations.Before flow cytometry analysis, be placed in whizzer at 1000g, namely, under the condition of 1000 times of universal gravity constant, centrifugal 10min, removes stationary liquid.Use propidium iodide (PI) dyeing.Flow cytometer analysis immediately, cell cycle analysis software Modifit2.0 result.Detected result as shown in Figure 4.
Obtain LM3/CDDP cell by instrumental analysis to occur obviously to change compared with the cell cycle distribution of LM3, it mainly changes the G0/G1 phase showing as cisplatin-resistant cell strain LM3/CDDP and reduces, and G2/M phase and S phase showed increased, the molecular marker for increased proliferation of display cisplatin-resistant cell strain LM3/CDDP.As shown in Figure 4, data are as shown in table 1 for result.The lifting of S phase and G2 phase, illustrates that cell proliferation is accelerated.The DNA synthesis of cisplatin-resistant cell strain LM3/CDDP compared with normal tumor cell line LM3 is accelerated, and propagation is accelerated.Point out the grade malignancy of we cisplatin-resistant cell strain LM3/CDDP stronger.
Table 1
< embodiment five >
Cell scratch experiment
(1) passage cell: will LM3, LM3/CDDP 0.5% trysinization process of logarithmic phase be entered, centrifugal, abandon supernatant, precipitate with perfect medium DMEM re-suspended cell, blow even rear counting cells and be adjusted to the concentration of required cell, plant single cell suspension in six orifice plates, every porocyte number is 4 × 10
5individual.
(2) starved cells: treat that 24-48 hour cell is adherent, when density reaches 90%, changing normal incubation medium is the substratum not containing somatomedin or serum-free, makes cell hungry 12 hours.
(3) cut: the monolayer cell covered with in each hole with 100ul aseptic rifle head draws rapidly and lightly 1 ~ 3 road trace, 1 × PBS rinses and removes the cell come off, and the substratum changing serum-free continues to cultivate, until the space of cut covers with cell.PBS damping fluid and phosphoric acid buffer, can prepare or buy commercial product voluntarily.
(4) to take pictures observation: the process examining under a microscope scratch removal, respectively at several time point Taking Pictures recording such as 0h, 24h, 48h, 72h, 96h, more different cell injury repairs the difference of speed.
Result as shown in Figure 5 the injury repairing of cisplatin-resistant cell strain LM3/CDDP compared with normal tumor cell line LM3 and value-added speed faster.
< embodiment six >
P-gp gene expression amount determination experiment in LM3/CDDP cell
P-gp albumen (P-glyeoprotein, P-pg) belongs to ATP in conjunction with box protein called membrane transporters superfamily, and it has the dependent drug efflux function of ATP, medicine can be pumped outside cytolemma and reduce drug concentration.P-gp overexpression on tumor cell membrane is that tumour cell produces one of important mechanisms of resistance.
First obtain complementary DNA (cDNA) (cDNA) by the method for reverse transcription, process is as follows:
(1) LM3, LM3/CDDP cell is planted respectively in 6 orifice plates, be cultured to density 70%-80%;
(2) TRIZOL1ml is added, incubated at room 15min;
(3) 200 μ l chloroform thermal agitation 30sec are added, the static 5min of room temperature;
(4) 4 DEG C, 12,000rpm, centrifugal 15min;
(5) draw the aqueous phase containing RNA in upper strata to manage in new 1.5mlEp, in, add 500 μ l isopropanol precipitating RNA, concuss 30sec, the static 10min of room temperature; The Ep pipe implemented in name refers to eppendorf board centrifuge tube;
(6) 4 DEG C, 12,000rpm, centrifugal 15min;
(7) abandon supernatant, add the washing with alcohol RNA precipitation of 0.5ml75%, 4 DEG C, 12,000rpm, centrifugal 5min;
(8) remove ethanol, under blower, dry up RNA, with 30 μ lDEPC water dissolution RNA during transparence precipitation to appear;
(9) content of RNA is measured with ultraviolet spectrophotometer ,-20 DEG C of preservations;
(10) reverse transcription synthesis cDNA first chain:
<1> gets RNA2 μ g, 10 μMs of random primer (TaKaRa company) 1 μ l, and DEPC water is mended to 17.5 μ l.
<2>70 DEG C of insulation 5min, sex change 5min on ice immediately.
<3> adds 5 × buffer5 μ l, the dNTP1.5 μ l of 10mmol/L, RNaseInhibitor (40U/ μ l, TaKaRa company) 1 μ l, reversed transcriptive enzyme 1 μ l, cumulative volume to 25 μ l, after abundant mixing, 422h DEG C.
The cDNA that <4> obtains is placed on-20 DEG C and saves backup.
Then quantitative fluorescent PCR is carried out:
(1) reaction system following (25 μ l):
Primer sequence, this primer sequence is synthesized by Shanghai Sheng Gong biotechnology limited-liability company
TGATTTTGGCCATCAGTCCTGP-gp-forward
CCTCTTCAGCTACTGCTCCAGCP-gp-reverse
Wherein, Up-Primer: upstream primer; Down-Primer: downstream primer; TaqmanSYRB:Taqman probe; MilliQH
2the pure water that O:millipore company produces; TotalVolume: cumulative volume.
(2) reaction conditions: 95 DEG C of denaturation 10min, 95 DEG C of sex change 30sec, 60 DEG C of annealing 30sec, 72 DEG C extend 40sec, 40 circulations, and 72 DEG C of whole ends extend 10min.By AppliedBiosystems7300/7900FastReal-TimePCRSystem software analysis result.The mRNA content compared with normal tumor cell line LM3 of LM3/CDDP cell P-gp gene is many as shown in Figure 6, and the P-gp protein expression namely reacting LM3/CDDP cell is many, has stronger resistance.
< embodiment seven >
Liver cancer persister LM3/CDDP cell and the post-stimulatory growth curve determination experiment of LM3 cell Xarelto (sorafenib).
LM3, LM3/CDDP cell of taking the logarithm vegetative period, counts with 0.5% trysinization, inoculates into 96 orifice plates and set up mdr cell dosing group, be labeled as lc+sora in figure by the density of 5000 cells in every hole; Mdr cell control group, is labeled as lc+con in figure; LM3 cell dosing group, is labeled as lm3+sora and LM3 cell controls group, is labeled as lm3+con in figure in figure, every hole adds 200 μ L substratum again, is positioned over 37 DEG C, cultivates in 5%CO2 incubator, adherent rear stimulating group adds 8 μm of ol/Lsorafenib, the not dosing of blank group; In 0h, 24h, the each time point of 48h, 72h, 96h absorbs substratum, every hole adds 100 μ LCCK8 working fluids, cultivate after 1 hour in incubator, put into microplate reader with 450nm wavelength detecting, read the OD value also calculating mean value in every hole, take time as X-coordinate, OD value mean value is ordinate zou, be depicted as growth curve.
Measured through continuous many days and find, sorafenib can suppress LM3 liver cancer cell growth, and can obviously suppress LM3/CDDP mdr cell to grow (result as shown in Figure 7) relative to blank sorafenib.Illustrate that LM3/CDDP mdr cell is responsive to sorafenib, clinical suggestion uses sorafenib to treat to cisplatin resistance patient.
Therefore drug-resistant cell strain provided by the invention can produce after resistance cis-platinum patient in clinical application, and whether Validation in vitro patient also has resistance to other cancer therapy drug, thus instructs antitumor drug that doctor selects resistance little to patient administration.
Below the preferred embodiment of the invention is illustrated, but the invention is not limited to described embodiment, those of ordinary skill in the art also can make all equivalent modification or replacement under the prerequisite without prejudice to the invention spirit, and these equivalent modification or replacement are all included in the application's claim limited range.
Claims (5)
1. set up a method for hepatocellular carcinoma cisplatin-resistant cell strain, it is characterized in that, comprise the following steps:
Step one, uses DMEM nutrient solution after getting LM3 cell recovery, in 37 DEG C, and the CO of 5%
2cultivate in incubator;
Step 2, get in step one grow to logarithmic phase described LM3 cell kind in culture hole, add the cis-platinum of 0.1 μ g/L, 0.25 μ g/L, 0.5 μ g/L, 1 μ g/L, 2 μ g/L, 5 μ g/L, 10 μ g/L respectively, go down to posterity in good time or change liquid, when going down to posterity at every turn or change liquid, all corresponding described cis-platinums adding above-mentioned concentration in each described culture hole, add rear described LM3 cell with described cis-platinum and the peak concentration grown can be kept for optimum concn;
Step 3, uses the cis-platinum long-time stimulus LM3 cell of described optimum concn, screens the LM3 cell that still can grow fast and is the strain of hepatocellular carcinoma cisplatin-resistant cell.
2. a kind of method setting up the strain of hepatocellular carcinoma cisplatin-resistant cell according to claim 1, is characterized in that:
Wherein, the time of described long-time stimulus is 4 months.
3. the method setting up the strain of hepatocellular carcinoma cisplatin-resistant cell according to claim 1, is characterized in that:
Wherein, the maximum resistance to concentration of described hepatocellular carcinoma cisplatin-resistant cell strain is 3 μ g/mL.
4. one kind as the application of hepatocellular carcinoma cisplatin-resistant cell strain in screening antineoplastic drugs in claims 1 to 3 as described in any one.
5. preparing the application in antitumor drug as the hepatocellular carcinoma cisplatin-resistant cell strain in claims 1 to 3 as described in any one for one kind.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410314627.4A CN105274056A (en) | 2014-07-03 | 2014-07-03 | Method for establishing hepatocellular carcinoma cis-platinum drug-resisting cell strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410314627.4A CN105274056A (en) | 2014-07-03 | 2014-07-03 | Method for establishing hepatocellular carcinoma cis-platinum drug-resisting cell strain |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105274056A true CN105274056A (en) | 2016-01-27 |
Family
ID=55143892
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410314627.4A Pending CN105274056A (en) | 2014-07-03 | 2014-07-03 | Method for establishing hepatocellular carcinoma cis-platinum drug-resisting cell strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105274056A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113774025A (en) * | 2021-08-26 | 2021-12-10 | 湖南丰晖生物科技有限公司 | Method for constructing colorectal cancer cisplatin resistant strain |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101732345A (en) * | 2008-11-20 | 2010-06-16 | 中国人民解放军第二军医大学 | Cisplatin spinal tumor slow-release implant and preparation method thereof |
| WO2010121245A1 (en) * | 2009-04-17 | 2010-10-21 | Niiki Pharma Inc. | Method of treating hepatocellular carcinoma |
-
2014
- 2014-07-03 CN CN201410314627.4A patent/CN105274056A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101732345A (en) * | 2008-11-20 | 2010-06-16 | 中国人民解放军第二军医大学 | Cisplatin spinal tumor slow-release implant and preparation method thereof |
| WO2010121245A1 (en) * | 2009-04-17 | 2010-10-21 | Niiki Pharma Inc. | Method of treating hepatocellular carcinoma |
Non-Patent Citations (3)
| Title |
|---|
| H.ZHANG等: "Liver cancer stem cells are selectively enriched by low-dose cisplatin", 《BRAZILIAN JOURNAL OF MEDICAL AND BIOLOGICAL RESEARCH》 * |
| 吴东等: "卵巢上皮性癌顺铂耐药细胞株OVCAR3-DDP的建立", 《道客巴巴》 * |
| 周源等: "人肝癌顺铂耐药细胞系SK-Hep1/CDDP的建立", 《癌症》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113774025A (en) * | 2021-08-26 | 2021-12-10 | 湖南丰晖生物科技有限公司 | Method for constructing colorectal cancer cisplatin resistant strain |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104140953B (en) | Breast cancer multidrug-resistant cell strain constructed by virtue of epirubicin induction as well as construction method and application thereof | |
| Zhou et al. | Self-assembled DNA nanostructure as a carrier for targeted siRNA delivery in glioma cells | |
| CN104017868A (en) | Application of SETD4 to preparation of pancreatic cancer diagnosis and / or prognosis kit and application of SETD4 blocker to preparation of medicament for treating pancreas cancer | |
| CN103952375A (en) | Hepatocellular carcinoma sorafenib-resistant cell strain and construction method thereof | |
| CN105219881A (en) | The test kit of a kind of detection by quantitative ERCC1-202 and application | |
| Zhao et al. | Carboplatin inhibits the progression of retinoblastoma through IncRNA XIST/miR-200a-3p/NRP1 Axis | |
| CN113788882B (en) | Application of bacillus subtilis AMEP412 protein in inhibiting tumor cell proliferation | |
| CN108796029B (en) | Establishment method and application of human esophageal cancer EC9706 cell multidrug resistant cell strain | |
| CN102732484B (en) | Method for establishing human nasopharyngeal carcinoma tumor stem cell line | |
| CN103966169A (en) | Chinese people tongue squamous epithelial cell cancer cell line CTSC-1 and establishment method thereof | |
| CN105412944A (en) | Effect of miR-451a cells in non-small cell lung cancer | |
| CN105274056A (en) | Method for establishing hepatocellular carcinoma cis-platinum drug-resisting cell strain | |
| CN105886507B (en) | Application of the long-chain non-coding RNA FAM83H-AS1 in preparation treatment non-small cell lung cancer drug | |
| CN104587492B (en) | Applications of the long-chain non-coding RNA molecule SNHG18 in the medicine for preparing treatment glioma | |
| CN107913284A (en) | Application of the Microrna of 367 clusters of miRNA302 in targeted inhibition angiogenesis and tumour growth | |
| CN104531760A (en) | Interference plasmid of short hairpin RNA of Dp71 protein and application of interference plasmid | |
| CN104830775B (en) | A kind of triple negative breast cancer cisplatin-resistant cell strain and its preparation method and application | |
| CN110522759B (en) | Application of miR-517b-3p inhibitor in treatment of paclitaxel drug-resistant breast cancer | |
| CN104403996A (en) | Human gastric cancer cell line with 5-fluorouracil resistance and establishing method and application thereof | |
| CN105349493B (en) | The drug resistance gastrointestinal stromal tumor cell line and nude mice model of BRAF secondary mutation construct | |
| CN104403997B (en) | Human gastric cancer cell line with cisplatin resistance and establishment method and application thereof | |
| CN103667295B (en) | siRNA for FOXC1 gene expression inhibition, and application thereof | |
| CN103432594B (en) | Application of medicine or product prepared by aptamer and used for treating multiple myeloma | |
| CN102268406B (en) | Breast carcinoma drug resistance cell lines originated from BCap37, and applications thereof | |
| CN107184983A (en) | A kind of diagnosis and treatment target of adenocarcinoma of lung |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160127 |
|
| WD01 | Invention patent application deemed withdrawn after publication |