CN105256077A - Influenza virus a fluorogenic quantitative PCR detection reagent kit - Google Patents
Influenza virus a fluorogenic quantitative PCR detection reagent kit Download PDFInfo
- Publication number
- CN105256077A CN105256077A CN201510848069.4A CN201510848069A CN105256077A CN 105256077 A CN105256077 A CN 105256077A CN 201510848069 A CN201510848069 A CN 201510848069A CN 105256077 A CN105256077 A CN 105256077A
- Authority
- CN
- China
- Prior art keywords
- seqidno
- influenza
- virus
- detecting
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an influenza virus a fluorogenic quantitative PCR detection reagent kit. The detection reagent kit comprises a probe for detecting oligonucleotide of the influenza virus a and upstream and downstream primers for amplification of oligonucleotides. The probe for detecting the oligonucleotide is provided with a base pair sequence shown in the SEQ ID NO:7 or the SEQ ID NO:8. No cross reaction exists when the influenza virus a fluorogenic quantitative PCR detection reagent kit detects a sample infected by other pathogens, the influenza virus a fluorogenic quantitative PCR detection reagent kit has the good specificity, and meanwhile an interior label is added in a reaction system so as to effectively prevent that detection is in false negative. The influenza virus a fluorogenic quantitative PCR detection reagent kit has the good consistency and is high in accuracy and rapid to operate, and the method is simple and convenient to implement.
Description
Technical field
The present invention relates to technical field of medical detection, more specifically, relate to a kind of influenza A virus fluorescent quantificationally PCR detecting kit.
Background technology
Influenza virus (influenzavirus), being called for short influenza virus, is that one causes the mankind and animal to suffer from grippal RNA viruses.Human influenza virus is divided into first (A), second (B), third (C) three types, is grippal pathogenic agent.Bird flu (avianinfluenza, i.e. AI) is the abbreviation of avian influenza, and it is a kind of communicable disease caused by certain hypotype of influenza A virus.On taxonomy; influenza virus belongs to Orthomyxoviridae family (Orthomyxoviridae); influenza virus belongs to (Influenzavirus); influenza virus can cause acute upper respiratory tract infection; and propagate rapidly by air, often have all over the world and be periodically very popular.
Influenza A virus particle is spherical in shape, from outer to inner can be divided into adventitia, stromatin and core three part.Adventitia major ingredient is lipid, outside surface has hemagglutinin and neuraminidase two kinds of glycoprotein projections, these glycoprotein projections are main components of influenza antigen structure, adventitia internal surface is the protein of one deck as matrix, the core of virus contains the genetic material of storage Virus Info and copies the necessary enzyme of these information, and the genetic material of influenza A virus is sub-thread strand RNA.Its RNA is made up of 8 sections, the 1st, 2,3 segment encodes be the many aggregation enzymes of RNA, the 4th sections is responsible for encode hemagglutinin; 5th sections is responsible for encoding nuclear proteins, the 6th segment encodes be neuraminidase; 7th segment encodes stromatin, the 8th segment encodes be a kind of Nonstructural Protein that can play splicing RNA function.
Grippal clinical symptom is easily obscured mutually with common cold, particularly occur that acute, strong Highly Pathogenic Avian Influenza Virus (HPAIV) (HPAIV) infects the event of people in recent years, not only provisions fowl industrial belt carrys out huge financial loss, but also be the one of the main reasons causing human death, diagnostic method is significant quickly and accurately therefore to set up one.In the means of laboratory diagnosis influenza virus, generally take inoculated into chick embryo or dog kidney passage cell (MDCK) to carry out virus isolation and Identification, but disengaging time is longer, is unfavorable for taking counter-measure fast to epidemic situation.Although ELISA, Radioactive colloidal gold detection method are simple to operate and consuming time short, poor in the performance such as specificity, sensitivity, be thus restricted in actual applications.PCR detection technique rapid sensitive, but due to the hypotype of influenza virus numerous, add transgenation, restructuring and rearrangement, its variation is exceedingly fast, cause existing a lot of PCR nucleic acid detection method to there is certain defect and flase drop, accuracy is bad.Therefore need that a kind of accuracy is high badly, hypotype covers wide, virus variation to the influenza A virus method for quick of detected result without impact.
Summary of the invention
The object of this invention is to provide a kind of influenza A virus fluorescent quantificationally PCR detecting kit, to solve the problem of the existing influenza A virus detection method poor accuracy described in background technology.
In order to solve the problems of the technologies described above, the invention provides following technical scheme:
The invention provides a kind of influenza A virus fluorescent quantificationally PCR detecting kit, described detection kit comprises the probe for detecting oligonucleotide and the upstream and downstream primer for the oligonucleotide that increases; The described probe for detecting oligonucleotide has the base-pair sequence of SEQIDNO:7 or SEQIDNO:8.
Preferably, the described upstream and downstream primer for the oligonucleotide that increases has the base-pair sequence of SEQIDNO:1, SEQIDNO:2, SEQIDNO:3 and/or SEQIDNO:4.
Preferably, described detection kit also comprises interior mark, is designated as the lentiviral particle containing RNA sequence in described, and the cDNA corresponding to described interior mark has the base-pair sequence of SEQIDNO:10.
Preferably, described detection kit also comprises for detecting interior target probe, and in described detection, target probe has the base-pair sequence of SEQIDNO:9.
Preferably, described detection kit also comprises the upstream and downstream primer for amplification interior label; Described upstream and downstream primer has the base-pair sequence of SEQIDNO:5 and SEQIDNO:6.
Preferably, described detection kit also comprises PCR damping fluid, archaeal dna polymerase, dNTPs, metallic cation.
Preferably, described PCR damping fluid is 5 × PCR damping fluid, and described 5 × PCR damping fluid comprises pH and is 8.2 and concentration is the N of 0.25mol/L, N-bicine N-/potassium hydroxide; Concentration is the potassium acetate of 575mmol/L and volume ratio is the glycerine of 40%.
Preferably, described archaeal dna polymerase comprises TthDNA polysaccharase and H-TaqDNA polysaccharase.
Preferably, the Mn (OAc) of described metallic cation to be concentration be 150mmol/L
2.
Influenza A virus fluorescent quantificationally PCR detecting kit provided by the present invention, described detection kit comprises the probe for detecting oligonucleotide and the upstream and downstream primer for the oligonucleotide that increases; The described probe for detecting oligonucleotide has the base-pair sequence of SEQIDNO:7 or SEQIDNO:8.Influenza A virus fluorescent quantificationally PCR detecting kit provided by the present invention is no cross reaction when detecting other pathogenic infection samples, thus have good specificity, in increasing in reaction system, mark can effectively prevent from detecting in false negative simultaneously.Influenza A virus fluorescent quantificationally PCR detecting kit provided by the present invention by having good consistence compared with other test kits, and accuracy is high, operation quick, method is easy.
Accompanying drawing explanation
In order to be illustrated more clearly in the technical scheme in the embodiment of the present invention, below the accompanying drawing used required in describing embodiment is briefly described, apparently, for those of ordinary skills, under the prerequisite not paying creative work, other accompanying drawing can also be obtained according to these accompanying drawings.
Fig. 1 is the amplification curve diagram of the influenza A virus fluorescent quantificationally PCR detecting kit sensitivity technique that the embodiment of the present invention provides;
Fig. 2 is the pcr amplification graphic representation that influenza A virus fluorescent quantificationally PCR detecting kit that the embodiment of the present invention provides detects other pathogenic agent;
Fig. 3 is the amplification curve diagram of influenza A virus fluorescent quantificationally PCR detecting kit inhibition/chaff interference measure of merit that the embodiment of the present invention provides.
Embodiment
The influenza A virus fluorescent quantificationally PCR detecting kit that the embodiment of the present invention provides, solves the problem of existing influenza A virus detection method poor accuracy.
Technical scheme in the embodiment of the present invention is understood better in order to make those skilled in the art person, and enable the above-mentioned purpose of the embodiment of the present invention, feature and advantage become apparent more, below in conjunction with accompanying drawing, the technical scheme in the embodiment of the present invention is described in further detail.
The influenza A virus fluorescent quantificationally PCR detecting kit that the embodiment of the present invention provides comprises the probe for detecting oligonucleotide and the upstream and downstream primer for the oligonucleotide that increases; The described probe for detecting oligonucleotide has the base-pair sequence of SEQIDNO:7 or SEQIDNO:8.
Wherein, the base-pair sequence of SEQIDNO:7 is CGAGGACTGCAGCGTAGACGCTTTATC; The base-pair sequence of SEQIDNO:8 is CCACTCCTGGTCCTTATGGCCCAGT.The two ends of oligonucleotide probe SEQIDNO:7 and SEQIDNO:8 have fluorescent mark FAM and BHQ1 respectively, and after the oligonucleotide probe specific position that can determine at oligonucleotide probe and the influenza A virus target nucleic acid sequence complementarity specific position that determine or interior mark Quality Control nucleic acid array complementation is hybridized with amplified production, by high-strength light source excitation, to start energy trasfer, produce FRET signal.What have the base-pair sequence of SEQIDNO:7 or SEQIDNO:8 is two overlap independently probe for detecting the probe of oligonucleotide, and when for detecting influenza A virus, above-mentioned two cover oligonucleotide probes can be used alone.Preferably, in this test kit, the probe of above-mentioned detection oligonucleotide uses simultaneously.
Further, the upstream and downstream primer for the oligonucleotide that increases in this enzyme linked detecting kit has the base-pair sequence of SEQIDNO:1, SEQIDNO:2, SEQIDNO:3 and/or SEQIDNO:4.Upstream and downstream primer for the oligonucleotide that increases is capable of being combined to be used, and wherein, SEQIDNO:1 and SEQIDNO:2 combines, SEQIDNO:3 and SEQIDNO:4 combines; Meanwhile, any one in SEQIDNO:1-SEQIDNO:4 also can combinationally use with other Oligonucleolide primers.Above-mentioned upstream and downstream primer is the oligonucleotide that can be used as influenza A nucleic acid sequence amplifying nucleic acid synthesis starting point, and increases to the nucleic acid-templated fragment of object under the effect of archaeal dna polymerase.Base-pair sequence for upstream and downstream primer SEQIDNO:1, SEQIDNO:2, SEQIDNO:3 and/or SEQIDNO:4 of the oligonucleotide that increases is as follows:
SEQIDNO：1：CTAAAGACAAGACCAATTCTGTCA；
SEQIDNO：2：GGTCCCCATTCCCATTTA；
SEQIDNO：3：GCGGATGCCTTTTGTTGATT；
SEQIDNO：4：ATTGCTTCAAATGAGAATGTGG。
The influenza A virus fluorescent quantificationally PCR detecting kit that the embodiment of the present invention provides comprises interior mark, this interior lentiviral particle be designated as containing RNA sequence, and the cDNA corresponding to described interior mark has the base-pair sequence of SEQIDNO:10.Interior mark participates in process and the PCR testing process of sample, and eliminating false-negative generation, is that whole experimentation is more accurate.The base-pair sequence of SEQIDNO:10 is: TAGATAGACCGACGAGCCGAACCACAGCGTCACAACATTTGTGTTGTAAGTGTAAT AATCAACTTCAGCTAGTAGTAGAAACCTCGCAAGACGGATTGCGAGCCTTACAGCA GCTGTTTATGGACACACTATCCTTTGTGTGTCCGTGGTGTGTTT.
Further, also comprise in the enzyme linked detecting kit that the embodiment of the present invention provides for detecting interior target probe, in described detection, target probe has the base-pair sequence of SEQIDNO:9.In detecting, target probe SEQIDNO:9 two ends are labeled as HEX and BHQ1 respectively, and in detecting, the base-pair sequence of mark probe SEQIDNO:9 is: CAAGACGGATTGCGAGCCTTACAGC.
Further, the upstream and downstream primer for amplification interior label is also comprised in the enzyme linked detecting kit that the embodiment of the present invention provides; Described upstream and downstream primer has the base-pair sequence of SEQIDNO:5 and SEQIDNO:6.The base-pair sequence of this upstream and downstream primer SEQIDNO:5 and SEQIDNO:6 is:
SEQIDNO：5：CCGACGAGCCGAACCACA；
SEQIDNO：6：CACACCACGGACACACAAAGGA。
Also PCR damping fluid, archaeal dna polymerase, dNTPs, metallic cation is comprised in the enzyme linked detecting kit that the embodiment of the present invention provides.
Wherein, PCR damping fluid is 5 × PCR damping fluid, and described 5 × PCR damping fluid comprises pH and is 8.2 and concentration is the N of 0.25mol/L, N-bicine N-/potassium hydroxide; Concentration is the potassium acetate of 575mmol/L and volume ratio is the glycerine of 40%.
Archaeal dna polymerase comprises TthDNA polysaccharase (TthDNApolymerase, i.e. hot resistant DNA polymerase) and H-TaqDNA polysaccharase (Thermusaquaticus, i.e. H-hot resistant DNA polymerase).
The Mn (OAc) of metallic cation to be concentration be 150mmol/L
2(Manganousacetate, i.e. manganous acetate).
Two covers are used independently in the influenza A virus fluorescent quantificationally PCR detecting kit that the embodiment of the present invention provides, but the oligonucleotide probe that fluorescent mark is identical, detect the special conserved sequence section of coding nucleocapsid protein (NP) and stromatin (M) gene simultaneously, than the simple method detected gene fragment at present more accurately and reliably, meanwhile, the sensitivity of detection is also improved.Simultaneously, to adopt in the present invention and a kind ofly to be wrapped up by protein enclosure, containing the lentiviral particle of specific RNA sequence as interior mark Quality Control, interior mark Quality Control can participate in extraction and the PCR reaction of influenza A nucleic acid, monitoring experiment operating process and PCR reaction, avoid occurring false negative, add the confidence level of detected result.
Primer in the influenza A virus fluorescent quantificationally PCR detecting kit that the embodiment of the present invention provides and/or the working concentration of probe can be 0.05 μM-5 μMs not etc.This detection kit adopts as the preferred version in table 1 in actual use:
Table 1: the preferred version of the embodiment of the present invention
| Component | Volume/concentration in each reaction |
| 5 × PCR damping fluid | 10μl |
| dNTPs(100mM) | 1.5μl |
| Tth enzyme (5U/ μ l) | 1.0μl |
| H-Taq enzyme (5U/ μ l) | 1.0μl |
| Mn(OAc) 2(150mM) | 1.0μl |
| SEQ ID NO:1 | 0.5μM |
| SEQ ID NO:2 | 0.5μM |
| SEQ ID NO:3 | 0.5μM |
| SEQ ID NO:4 | 0.5μM |
| SEQ ID NO:5 | 0.25μM |
| SEQ ID NO:6 | 0.25μM |
| SEQ ID NO:7 | 0.25μM |
| SEQ ID NO:8 | 0.25μM |
| SEQ ID NO:9 | 0.1μM |
| Sterilizing purified water | Up to 40μl |
Further, testing sample is placed on fluorescent quantitative PCR instrument and tests, general PCR reaction process is: 1) heat denatured, the condition of sex change heating depends on length and the Nucleotide composition of damping fluid salt ionic concentration and denaturing nucleic acid, but general scope is about 90 DEG C-105 DEG C, the time of sex change depends on response feature and length nucleic acid, but generally carries out about 30 seconds-4 minutes.2) anneal, make each primer annealing on the target sequence of influenza A virus or interior mark Quality Control nucleic acid.The temperature of annealing is generally 35 DEG C-65 DEG C, and the time of annealing can be 10 seconds to 1 minute.3) extend, be namely enough to extend by annealing primer the temperature produced with the product of template nucleic acid complementation, but at such a temperature, extension products and complementary template unchangeability, elongating temperature is generally 40 DEG C-80 DEG C, the extension time can be about 10 seconds to 5 minutes not etc.
The optimum condition of the quantitative fluorescent PCR reaction that the embodiment of the present invention provides is as shown in table 2.
Table 2: the optimum condition of quantitative fluorescent PCR reaction
Interpretation of result
After reaction terminates, the automatic saving result of instrument, the software that instrument can be utilized to carry carries out automatic analysis (also can the starting value of manual regulation baseline, end value and threshold line value analyze), then records sample Ct value and result.The intersection point of amplification curve and threshold line, is called Ct (i.e. cyclethreshold, the cycling numerical value experienced when the fluorescent signal referring in PCR reaction tubes reaches the threshold value of setting); Instrument software, according to each sample Ct value size, can judge detected result.
1, sensitivity experiment
The influenza A virus of the detection kit that the embodiment of the present invention provides to the blue or green sheep in Sichuan carries out fluorescent PCR detection, and measured result as shown in Figure 1.6.5TCID can be low to moderate in influenza A virus concentration from accompanying drawing 1
50during/ml, the amplification curve of fluorescent PCR is obvious, and this shows that the detection sensitivity of the influenza A virus fluorescent quantificationally PCR detecting kit that the embodiment of the present invention provides can be low to moderate 6.5TCID
50/ ml.
2, specificity experiments
The detection kit that the embodiment of the present invention provides is to adenovirus type III, adenovirus type VII, enterovirns type 71, Chlamydia pneumoniae, mycoplasma pneumoniae, human Parainfluenza virus type 2, 1A type rhinovirus, mumps virus, bordetella pertussis, mycobacterium tuberculosis, hemophilus influenzae, legionella pneumophilia, the hot rickettsia of Q, streptococcus pneumoniae, the pathogenic infection samples such as streptococcus-salivarius detect, please refer to accompanying drawing 2, the pcr amplification graphic representation that the influenza A virus fluorescent quantificationally PCR detecting kit that Figure 2 illustrating the embodiment of the present invention provides detects other pathogenic agent.
Can find out from accompanying drawing 2, pcr amplification curve is there is not in this detection kit when detecting above-mentioned pathogenic infection sample, and no cross reaction each other, this influenza A virus fluorescent quantificationally PCR detecting kit illustrating that the embodiment of the present invention provides can not detect other viruses except influenza A virus when detecting pathogen infection sample, thus this detection kit has good specificity.
3, inhibition/chaff interference measure of merit
Oxymetazoline, beclometasone, sulphur, mentha camphor, zanamivir, purifying Saliva Orthana, human blood or a certain proportion of medicine is added in the influenza A virus fluorescent quantificationally PCR detecting kit that the embodiment of the present invention provides, as common anti-cold medicine, glucocorticosteroid, microbiotic etc., and carry out fluorescent PCR test, test result is as shown in accompanying drawing 3 and table 3.
Table 3: inhibition/chaff interference measure of merit Ct Data-Statistics result
Can find out from table 3 and accompanying drawing 3, this detection kit still has amplification curve when carrying out fluorescent PCR test, and the consistence of amplification curve is fine, it can be said that in the bright influenza A virus fluorescent quantificationally PCR detecting kit provided in the embodiment of the present invention and add the Detection results that said medicine can not affect this detection kit.
4, accuracy test
(1) test kit
Test group: influenza A virus fluorescent quantificationally PCR detecting kit provided by the invention
Control group: a kind ofly permit through CFDA and issue the similar test kit of medicine equipment license licensed licenser licence
(2) test sample
Test group and control group all detect sample to 625 examples and detect.
(3) test-results
The detected result of test group is influenza A virus positive group 248 example, negative group 377 example.The positive consistence per-cent of influenza A virus of test group and control group is 98.39% (95%CI:95.9% ~ 99.6%), negative consistence per-cent is 97.88% (95%CI:95.9% ~ 99.1%), and total consistence per-cent is 98.08% (95%CI:96.7% ~ 99.0%).The analysis of Kappa check consistency is carried out to the above results, result Kappa=0.960, show to treat that the result that examining method and contrast method detect has good consistence.Be accredited as negative oropharynx swab sample research by being accredited as the positive and 10 examples to 30 examples through Viral isolation through Viral isolation, the diagnosis of result explanation to influenza A virus, treats that examining method Positive rate is higher than Viral isolation method.625 routine samples are from the distribution at age, and the sample of 0 ~ 6 one full year of life has 217 examples, account for 34.7% of total number of cases; Treat that examining method detected the highest age structure level of positive rate at 18 ~ 40 years old, these ages have sample 69 example, and positive rate is 76.8%; Treat that examining method detected the minimum age structure level of positive rate at 0 ~ 6 years old, these ages have sample 217 example, and positive rate is 33.6%.Treat that examining method and the inconsistent sample of contrast method detected result have 10 examples, check through order-checking and show, have 7 routine samples treat examining method and sequencing result completely the same, show to wait to check and rate and deemed-to-satisfy4ly can be better than contrast method.
Two covers are used independently in the influenza A virus fluorescent quantificationally PCR detecting kit that the embodiment of the present invention provides, but the oligonucleotide probe that fluorescent mark is identical, detect the special conserved sequence section of coding nucleocapsid protein (NP) and stromatin (M) gene simultaneously, than the simple method detected gene fragment at present more accurately and reliably, meanwhile, the sensitivity of detection is also improved.Simultaneously, to adopt in the present invention and a kind ofly to be wrapped up by protein enclosure, containing the lentiviral particle of specific RNA sequence as interior mark Quality Control, interior mark Quality Control can participate in extraction and the PCR reaction of influenza A nucleic acid, monitoring experiment operating process and PCR reaction, thus avoid occurring false negative, increase the confidence level of detected result.
Above-described embodiment of the present invention, does not form limiting the scope of the present invention.Any amendment done within the spirit and principles in the present invention, equivalent to replace, improve and the reverse complemental etc. of sequence, all should be included within protection scope of the present invention.
Claims (9)
1. an influenza A virus fluorescent quantificationally PCR detecting kit, is characterized in that, described detection kit comprises the probe for detecting oligonucleotide and the upstream and downstream primer for the oligonucleotide that increases; The described probe for detecting oligonucleotide has the base-pair sequence of SEQIDNO:7 or SEQIDNO:8.
2. influenza A virus fluorescent quantificationally PCR detecting kit according to claim 1, it is characterized in that, the described upstream and downstream primer for the oligonucleotide that increases has the base-pair sequence of SEQIDNO:1, SEQIDNO:2, SEQIDNO:3 and/or SEQIDNO:4.
3. influenza A virus fluorescent quantificationally PCR detecting kit according to claim 2, it is characterized in that, described detection kit also comprises interior mark, is designated as the lentiviral particle containing RNA sequence in described, and the cDNA corresponding to described interior mark has the base-pair sequence of SEQIDNO:10.
4. according to influenza A virus fluorescent quantificationally PCR detecting kit according to claim 3, it is characterized in that, described detection kit also comprises for detecting interior target probe, and in described detection, target probe has the base-pair sequence of SEQIDNO:9.
5. according to influenza A virus fluorescent quantificationally PCR detecting kit according to claim 4, it is characterized in that, described detection kit also comprises the upstream and downstream primer for amplification interior label; Described upstream and downstream primer has the base-pair sequence of SEQIDNO:5 and SEQIDNO:6.
6. according to the influenza A virus fluorescent quantificationally PCR detecting kit in claim 1-5 described in any one, it is characterized in that, described detection kit also comprises PCR damping fluid, archaeal dna polymerase, dNTPs and metallic cation.
7. according to influenza A virus fluorescent quantificationally PCR detecting kit according to claim 6, it is characterized in that, described PCR damping fluid is 5 × PCR damping fluid, and described 5 × PCR damping fluid comprises pH and is 8.2 and concentration is the N of 0.25mol/L, N-bicine N-/potassium hydroxide; Concentration is the potassium acetate of 575mmol/L and volume ratio is the glycerine of 40%.
8. according to influenza A virus fluorescent quantificationally PCR detecting kit according to claim 6, it is characterized in that, described archaeal dna polymerase comprises TthDNA polysaccharase and H-TaqDNA polysaccharase.
9. according to influenza A virus fluorescent quantificationally PCR detecting kit according to claim 6, it is characterized in that, the Mn (OAc) of described metallic cation to be concentration be 150mmol/L
2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510848069.4A CN105256077A (en) | 2015-11-27 | 2015-11-27 | Influenza virus a fluorogenic quantitative PCR detection reagent kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510848069.4A CN105256077A (en) | 2015-11-27 | 2015-11-27 | Influenza virus a fluorogenic quantitative PCR detection reagent kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105256077A true CN105256077A (en) | 2016-01-20 |
Family
ID=55096002
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510848069.4A Pending CN105256077A (en) | 2015-11-27 | 2015-11-27 | Influenza virus a fluorogenic quantitative PCR detection reagent kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105256077A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107893130A (en) * | 2017-12-26 | 2018-04-10 | 湖南圣湘生物科技有限公司 | The application method of the primer and probe of influenza virus parting detection, kit and kit |
| CN110951918A (en) * | 2019-12-19 | 2020-04-03 | 武汉中帜生物科技股份有限公司 | Kit for jointly detecting influenza A virus and influenza B virus based on RNA isothermal amplification-gold probe chromatography technology and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286639A (en) * | 2011-08-05 | 2011-12-21 | 江苏硕世生物科技有限公司 | Type A H1N1/influenza A virus nucleic acid dual fluorescent polymerase chain reaction (PCR) detection kit |
| CN103215387A (en) * | 2013-05-07 | 2013-07-24 | 杭州电子科技大学 | Method for detecting H1N1 influenza A virus variant by multiple target point gene and kit |
| CN103820571A (en) * | 2013-12-25 | 2014-05-28 | 扬州大学 | Primer, probe and kit for detection method of influenza A virus one-step reverse transcription quantitive PCR |
-
2015
- 2015-11-27 CN CN201510848069.4A patent/CN105256077A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286639A (en) * | 2011-08-05 | 2011-12-21 | 江苏硕世生物科技有限公司 | Type A H1N1/influenza A virus nucleic acid dual fluorescent polymerase chain reaction (PCR) detection kit |
| CN103215387A (en) * | 2013-05-07 | 2013-07-24 | 杭州电子科技大学 | Method for detecting H1N1 influenza A virus variant by multiple target point gene and kit |
| CN103820571A (en) * | 2013-12-25 | 2014-05-28 | 扬州大学 | Primer, probe and kit for detection method of influenza A virus one-step reverse transcription quantitive PCR |
Non-Patent Citations (2)
| Title |
|---|
| 戴玉柱等: "五重荧光定量RT-PCR法检测甲型流感病毒", 《临床检验杂志》 * |
| 李稀罕等: "甲型流感病毒流行毒株检测和分型基因芯片的研制", 《微生物学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107893130A (en) * | 2017-12-26 | 2018-04-10 | 湖南圣湘生物科技有限公司 | The application method of the primer and probe of influenza virus parting detection, kit and kit |
| CN110951918A (en) * | 2019-12-19 | 2020-04-03 | 武汉中帜生物科技股份有限公司 | Kit for jointly detecting influenza A virus and influenza B virus based on RNA isothermal amplification-gold probe chromatography technology and application thereof |
| CN110951918B (en) * | 2019-12-19 | 2023-09-05 | 武汉中帜生物科技股份有限公司 | Kit for combined detection of influenza A and B viruses based on RNA isothermal amplification-gold probe chromatography technology and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN110257562A (en) | Primer and probe combination for RAA-LFD detection of avian infectious laryngotracheitis virus and application thereof | |
| CN108192996B (en) | Multiple RT-RPA primer combination for detecting influenza A virus and parting H1 and H3 and application thereof | |
| CN104862425B (en) | 1 type of duck hepatitis A virus and the warm formula RT-PCR detection kit of 3 types double two | |
| CN111748649A (en) | Fluorescent quantitative detection kit for simultaneously detecting human influenza virus and novel coronavirus | |
| WO2020034317A1 (en) | Dual real-time fluorescent quantitative pcr detection reagent and reagent kit for seneca virus a and foot-and-mouth disease virus | |
| JP2022547023A (en) | Systems, methods, and compositions for rapid early detection of host RNA biomarkers of infection and early identification of COVID-19 coronavirus infection in humans. | |
| CN104878124A (en) | Multiple PCR (Polymerase Chain Reaction) detection kit for duck hepatitis A virus 1 and 3 as well as MDPV (Muscovy Duck Parvovirus) | |
| Wang et al. | Recombinase-aided amplification–lateral flow dipstick assay—a specific and sensitive method for visual detection of avian infectious laryngotracheitis virus | |
| CN103290144A (en) | Primer for detecting H7N9 subtype avian influenza virus infected by humans though RT-LAMP (reverse transcription loop-mediated isothermal amplification) and application of primer | |
| Ma et al. | Rapid detection of avian influenza A virus (H7N9) by lateral flow dipstick recombinase polymerase amplification | |
| CN110343784B (en) | Composition and kit for quadruple influenza virus nucleic acid detection based on melting curve | |
| CN104498629A (en) | Duplex real-time fluorescence quantitative PCR (polymerase chain reaction) detection kit for H3N2 subtype avian influenza virus (AIV) | |
| WO2019001187A1 (en) | Multi-liquid phase gene chip detection primer, kit and method for rapidly distinguishing five pathogens in mouse respiratory tracts | |
| Graaf-Rau et al. | Emergence of swine influenza A virus, porcine respirovirus 1 and swine orthopneumovirus in porcine respiratory disease in Germany | |
| CN112391483A (en) | Nucleic acid sequence, kit and method for detecting plague bacillus by isothermal amplification and application | |
| Li et al. | Rapid detection of Klebsiella pneumoniae carrying virulence gene rmpA2 by recombinase polymerase amplification combined with lateral flow strips | |
| CN105256077A (en) | Influenza virus a fluorogenic quantitative PCR detection reagent kit | |
| CN112410465A (en) | Novel coronavirus SARS-CoV-2ORF1ab and N gene constant temperature amplification primer group and kit | |
| Luo et al. | Simultaneous differentiation of the N1 to N9 neuraminidase subtypes of avian influenza virus by a GeXP analyzer-based multiplex reverse transcription PCR assay | |
| CN102676697A (en) | Primers and probe for detecting peste des petits ruminants virus and kit | |
| CN113215329A (en) | Primer, probe and kit for multiplex PCR detection of 7 respiratory subtype influenza viruses | |
| CN102851395B (en) | Liquid-phase chip method used for detecting infectious laryngotracheitis virus | |
| Tao et al. | Detection and differentiation of four poultry diseases using asymmetric reverse transcription polymerase chain reaction in combination with oligonucleotide microarrays | |
| CN104278106A (en) | Duplex fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit for duck tembusu virus and egg drop syndrome virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160120 |
|
| RJ01 | Rejection of invention patent application after publication |