CN105256063A - Tumor marker DMBX1 and application thereof - Google Patents

Tumor marker DMBX1 and application thereof Download PDF

Info

Publication number
CN105256063A
CN105256063A CN201510861260.2A CN201510861260A CN105256063A CN 105256063 A CN105256063 A CN 105256063A CN 201510861260 A CN201510861260 A CN 201510861260A CN 105256063 A CN105256063 A CN 105256063A
Authority
CN
China
Prior art keywords
dmbx1
preparation
gene
seqidno
intracranial
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201510861260.2A
Other languages
Chinese (zh)
Other versions
CN105256063B (en
Inventor
边洋
杨承刚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qingdao Yangshen Biomedical Co Ltd
Original Assignee
Beijing Medintell Bioinformatic Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Medintell Bioinformatic Technology Co Ltd filed Critical Beijing Medintell Bioinformatic Technology Co Ltd
Priority to CN201510861260.2A priority Critical patent/CN105256063B/en
Publication of CN105256063A publication Critical patent/CN105256063A/en
Application granted granted Critical
Publication of CN105256063B publication Critical patent/CN105256063B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Genetics & Genomics (AREA)
  • Oncology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Hospice & Palliative Care (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a tumor marker DMBX1 and application thereof, in particular to a tumor marker DMBX1 gene and application of an expression product of the tumor marker DMBX1 gene in diagnosing and treating intracranial aneurysm. Arterial aneurysm wall tissue of an intracranial aneurysm patient is detected through RT-PCR, it shows that DMBX1 mRNA has high expression in a patient group, and further, multiple groups of siRNA are designed to interfere with DMBX1 gene expression to affect the activity of EPCs. A potential diagnosis and treatment new target spot for intracranial aneurysm is provided, and the tumor marker DMBX1 has the important clinic application value.

Description

Tumor markers DMBX1 and application thereof
Technical field
The present invention relates to tumor markers, be specifically related to tumor markers DMBX1 and application thereof, relate to tumor markers DMBX1 gene and the application of expression product in diagnosis and treatment intracranial aneurysm thereof more specifically.
Background technology
Intracranial aneurysm (intracranialaneurysm, IA) be the encephalic angioma sample projection that the expansion of ductus arteriosus wall pathologic limitation produces, it breaks is the first reason (accounting for 79%-89%) causing human spontaneous subarachnoid hemorrhage, account for intracranial hemorrhage 25%, its case fatality rate and disability rate high, drastically influence the health and lives of people.Along with the development of image technology and the raising of the health of people level of understanding, the discovery rate of Unruptured aneurysm also increases to some extent, intracranial aneurysm oneself through being one of common and multiple cerebro-vascular diseases.By the Researching and practicing of over one hundred year, the generation of intracranial aneurysm, growth, precise mechanism that is moulding, that break still are not understood.It has been generally acknowledged that the formation of IA, develop and break and to be caused by heredity, smoking, age, environment, atherosclerosis, hypertension and the multiple factors such as hyperlipidemia and hemodynamic responses.Along with deepening continuously of studying it, people oneself through recognizing that IA mostly occurs at willis arterial ring and entocranial artery vascular bifurcation place or vascular bending position usually gradually, blood flow forms the complicated flow patterns such as impingement flow and makes vascular endothelial cell and connect impaired through herein time, inflammatory cell and Inflammatory substances etc. more easily enter interior subcutaneous, the vessel wall inflammation caused and vessel wall reconstruct imbalance, the blood stream rheology that research display continues can cause the pathology of blood vessel to reconstruct, comprise the degraded of interior elastic layer, the disappearance of smooth muscle cell and endotheliocyte, cell proliferation minimizing etc.The formation of IA may be the unbalance result of encephalic related arteries endothelial tissue injury and recovery, but specifically which gene is participated the announcement that still requires study.
Contriver analyzes 5 routine intracranial aneurysm wall tissues and 3 examples based on high-flux sequence, the candidate gene DMBX1 of remarkable high expression level is picked out in difference expression gene, now there are some researches show that DMBX1 regulates and controls propagation and the differentiation of granulocyte and scavenger cell, but do not study the relation disclosing itself and intracranial aneurysm, inventors performed RT-PCR checking and cell checking, confirm DMBX1 high expression level in intracranial aneurysm group, the expression of interference DMBX1 gene can affect the activity of EPCs.The invention provides a kind of diagnosis and treatment target spot of intracranial aneurysm, there is important clinical value.
Summary of the invention
The object of the present invention is to provide a kind of diagnosis of intracranial aneurysms preparation, described diagnosis of intracranial aneurysms preparation detects the expression amount of DMBX1 gene and/or DMBX1 gene expression product.
Further, described diagnosis of intracranial aneurysms preparation adopts PCR kit for fluorescence quantitative, gene chip, immunization method to detect the expression of DMBX1 gene in intracranial aneurysm tissue, preferably, the primer containing a pair specific amplification DMBX1 gene in described PCR kit for fluorescence quantitative; Described gene chip comprises the probe with the nucleic acid array hybridizing of DMBX1 gene, preferred, upstream primer containing specific detection DMBX1 gene in PCR kit for fluorescence quantitative and downstream primer, upstream primer sequence is SEQIDNO.10, and downstream primer sequence is SEQIDNO.11.
Further, the expression product of DMBX1 gene and/or gene in peripheral blood and/or tissue is detected.
Further, the diagnostic preparation of described intracranial aneurysm adopts immunization method to detect the expression product of DMBX1 gene in intracranial aneurysm peripheral blood and/or tissue, and preferably, described immunization method is that ELISA detects and/or Radioactive colloidal gold detects.
Further, the ELISA method of described detection DMBX1 expression product is for using ELISA detection kit.Antibody in described test kit can adopt commercially available DMBX1 monoclonal antibody.Further, described test kit comprises: wrap by the solid phase carrier of DMBX1 monoclonal antibody, enzyme labelled antibody, the substrate of enzyme, protein standard substance, negative controls, diluent, washings, enzyme reaction stop buffer etc.
Further, the colloidal gold method of described detection DMBX1 albumen is for using detection kit, and described antibody can adopt commercially available DMBX1 monoclonal antibody.Further, described gold-immunochromatographyreagent reagent for assay box adopts colloidal gold immunochromatographimethod technology or Radioactive colloidal gold percolation process.Further, detection zone (T) specking on described gold-immunochromatographyreagent reagent for assay box nitrocellulose filter has anti-DMBX1 monoclonal antibody, quality control region (C) specking has immunoglobulin IgG.
The object of the present invention is to provide the application of above-mentioned diagnosis of intracranial aneurysms preparation in preparation diagnosis of intracranial aneurysms instrument.
The object of the present invention is to provide a kind of preparation for the treatment of intracranial aneurysm, containing the reagent of transcribing or expressing or the compound that suppress DMBX1 gene in described preparation.Preferably, pharmaceutics acceptable carrier is contained in preparation.
Further, in the preparation of described treatment intracranial aneurysm containing activate DMBX1 suppressor gene, activate suppress DMBX1 to express albumen, import suppress DMBX1 to transcribe or express siRNA, activate promote DMBX1mRNA degraded microRNA, import the molecule promoting DMBX1 proteolytic degradation, the expression suppressing the factor and the albumen promoting that DMBX1 expresses.
Preferably, the preparation of described treatment intracranial aneurysm contains the siRNA transcribing or express suppressing DMBX1 gene.Preferably, for SEQIDNO.1 and/or SEQIDNO.4 and/or the SEQIDNO.7 site design siRNA of DMBX1 gene.Preferred, suppress the siRNA transcribing or express of DMBX1 gene be selected from following in one group or several groups of siRNA:SEQIDNO.2 and SEQIDNO.3, SEQIDNO.5 and SEQIDNO.6, SEQIDNO.8 and SEQIDNO.9.Preferred, it is SEQIDNO.2 and SEQIDNO.3 that the preparation of described treatment intracranial aneurysm contains siRNA sequence.
The preparation of above-mentioned treatment intracranial aneurysm is the object of the present invention is to provide to prepare the application in treatment of intracranial aneurysm medicine or reagent.
The preparation of above-mentioned treatment intracranial aneurysm is the object of the present invention is to provide to strengthen the application in EPCs active ingredient in preparation.
For achieving the above object, first the present invention screens candidate gene DMBX1 gene by high-flux sequence in conjunction with bioinformatics method, and then pass through the molecular cytobiology method validation relation of DMBX1 gene and intracranial aneurysm: DMBX1 gene high expression level in intracranial aneurysm tissue, with intracranial aneurysm, there is good dependency, can be used for preparation intracranial aneurysm auxiliary diagnosis preparation, there is important clinical value.
The expression that those skilled in the art know suppressor gene and expression product thereof can adopt the one in following method and/or several usually: by the albumen of the suppressor gene of activating genes of interest, the inhibition of gene expression of activating genes of interest, adopt RNA perturbation technique to suppress destination gene expression, activate promote goal gene mRNA degraded microRNA, import promote the degraded of goal gene proteins encoded molecule, suppress to promote the factor of destination gene expression and the expression of albumen.
RNA interference (RNAi) refers to that exogenous and endogenous double-stranded RNA induces the mRNA selective degradation of homology target gene in vivo, cause the phenomenon of PTGS, it is a kind of expression using little double-stranded RNA to block body certain specific gene interior efficiently, specifically, impel mRNA to degrade, make cells show go out the technology of specific gene disappearance phenotype.Can adopt direct synthesis technique after siRNA has designed or build SiRNA expression vector, the siRNA prepared can by approach transfectional cells such as mechanical process, lipofectamine reagent method such as calcium phosphate precipitation, electroporation, DEAE-dextran and polybrene method, microinjection or particle guns.
Fluorescence quantitative PCR method is by fluorescence dye or fluorescently-labeled specific probe, and carry out mark to PCR primer and follow the tracks of, real time and on line monitoring reaction process, can analyze product in conjunction with corresponding software, calculates the starting point concentration of testing sample template.The appearance of quantitative fluorescent PCR, greatly simplifies the process of detection by quantitative, and really achieves absolute quantitation.The appearance of multiple detection system, makes the selectivity of experiment stronger.Automated operation improves working efficiency, reacts quick, reproducible, highly sensitive, high specificity, result be clear.
Gene chip is also called DNA microarray (DNAmicroarray), three kinds of main Types can be divided into: 1) be fixed on polymer matrix film (nylon membrane, nitrocellulose membrane etc.) nucleic acid probe on surface or cDNA fragment, usually be hybrid with it with isotope-labeled target gene, detected by radiography technology.2) fixing DNA probe array on a glass by point sample method, detecting by hybridizing with fluorescently-labeled target gene.3) oligonucleotide probe array of directly synthesis on the hard surfaces such as glass, hybridizes with fluorescently-labeled target gene and detects.Gene chip is as a kind of advanced person, extensive, high throughput testing technology, and be applied to the diagnosis of disease, its advantage has the following aspects: one is susceptibility highly and accuracy; Two is fast and convenient; Three is can detect various diseases simultaneously.
The object of the present invention is to provide a kind of gene detecting kit detecting intracranial aneurysm, described test kit detects gene DMBX1, and adopt special upstream primer and downstream primer, upstream primer sequence is SEQIDNO.10, and downstream primer sequence is SEQIDNO.11.
Further, this PCR kit is suitable for all types fluorescence quantitative gene extender deposited at present commercially, highly sensitive, quantitatively quick and precisely, good stability, has a good application prospect.
Further, above-mentioned PCR kit for fluorescence quantitative component comprises: Auele Specific Primer, internal reference primer, fluorescence quantitative PCR reaction solution.Described internal reference is GAPDH.
Described test kit also comprises RNA extraction agent.
The object of the invention there is provided a kind of intracranial aneurysm protein detection kit, and described detection kit detects DMBX1 albumen.Further, described test kit also comprises other detection reagent.
The object of the invention there is provided a kind of gene chip detecting intracranial aneurysm, and described gene chip comprises the probe with the nucleic acid array hybridizing of DMBX1 gene.
In pharmaceutics of the present invention, acceptable carrier is the carrier usually utilized when preparation, this carrier comprises lactose (lactose), dextrose (dextrose), sucrose (sucrose), sorbyl alcohol (sorbitol), N.F,USP MANNITOL (mannitol), starch, gum Arabic, calcium phosphate, alginate (alginate), gel (gelatin), Calucium Silicate powder, Microcrystalline Cellulose, polyvinylpyrrolidone (polyvinylpyrrolidone), Mierocrystalline cellulose (cellulose), water, syrup, methylcellulose gum (methylcellulose), methyl hydroxybenzoate (methylhydroxybenzoate), propyl hydroxy propyl benzoate (propylhydroxybenzoate), talcum, Magnesium Stearate (stearicacidmagnesium) and mineral oil (mineraloil) etc., but it is not limited thereto.
Pharmaceutics acceptable carrier of the present invention can also comprise lubricant, wetting agent, sweeting agent, flavouring agent, emulsifying agent, suspension agent, sanitas etc. except mentioned component.The carrier be applicable to that pharmaceutics is permitted and preparation are recorded in Lei Mingdengshi pharmacy pandect in detail.
Pharmaceutical composition of the present invention by oral or parenterally carry out administration, during as non-oral administration, by intravenous injection, intranasal injection, local injection, intracerebral ventricle injection, spinal cavity is injected, subcutaneous injection, abdominal injection, the modes such as percutaneous dosing carry out administration.
The dosage be applicable to of pharmaceutical composition of the present invention can carry out multiple prescription according to the factor of age of preparation ways, administering mode, patient, body weight, sex, morbid state, food, administration time, route of administration, drainage rate and being quick on the draw property and so on, usually, skilled doctor can easily determine and prescription to desired treatment or prevent effective dosage.
The method that pharmaceutical composition of the present invention can easily be implemented according to general technical staff of the technical field of the invention, to utilize in pharmaceutics receptible carrier and/or vehicle formulation to carry out, thus can with the preparation of unit dose form or in be contained in multicapacity container and prepare.Now, formulation is solution, suspension or emulsion form in oiliness or aqueous medium, or also can be extractum, powder agent, granule, tablet or capsule form, can also comprise dispersion agent or stablizer.
Accompanying drawing explanation
Fig. 1 intracranial aneurysm patients group and control group DMBX1mRNA relative expression situation
Fig. 2 disturbs rear each group of DMBX1mRNA relative expression quantity; B group in figure: the endothelial progenitor cells that intracranial aneurysm patients group is separated; C1 group: B group+transfection liposome; C2 group: the nonspecific siRNA of B group+transfection; S1 group: B group+transfection specific DMBX1-siRNA1, S2 group: B group+transfection specific DMBX1-siRNA2, S3 group: the specific DMBX1-siRNA3 of B group+transfection.
Embodiment
Below in conjunction with specific embodiment, setting forth the present invention further, only for explaining the present invention, and can not limitation of the present invention be interpreted as.Those having ordinary skill in the art will appreciate that: can carry out multiple change, amendment, replacement and modification to these embodiments when not departing from principle of the present invention and aim, scope of the present invention is by claim and equivalents thereof.The experimental technique of unreceipted actual conditions in the following example, the usually conveniently conditioned disjunction condition examinations of advising according to manufacturer.
The collection of embodiment 1 case
All tissue samples are the intracranial aneurysm patients made a definite diagnosis through DSA year May in October, 2012 to 2014, and carry out micrurgy open cranium treatment.The aneurysm wall tissue wherein excised in aneurysma tissue samples system micrurgy, the normal brain activity blood vessel sample tissue system contemporaneity of contrast, cerebral tumor opens superficial temporal artery (STA) and/or the arteria meningea media (MMA) of craniopathy people.For reducing difference between sample, all arteries tumor tissue sample standard deviation system saccular aneurysm chosen as far as possible.The sample tissue obtained is placed in liquid nitrogen container immediately.
Embodiment 2 high-flux sequence and analysis
Extract agarose gel electrophoresis after RNA, from electrophoresis result can the RNA sample extracted of preliminary judgement whether up-to-standard, whether may be used for the order-checking of further transcript profile.And then detected the extraction situation of RNA sample by NanoDrop1000 spectrophotometer, the sample requirement of RNA-seq order-checking: OD260/OD280 is 1.8-2.2.Be sent to order-checking company after sample passes to check order, order-checking platform is the HiSeq2500 high-flux sequence platform of Illumina company, carry out the order-checking of the high-throughput transcript profile degree of depth, order-checking company provides the result of data analysis, and in conjunction with document, we have screened difference expression gene DMBX1.
Embodiment 4 intracranial aneurysm patients group and control group DMBX1 expression conditions
One, material
Choose 23 routine intracranial aneurysm patients aneurysm wall tissues and 11 example contrast cerebrovascular sample tissue, it is divided into groups and numbers.Sample collection standard is shown in embodiment 1.
Two, method
The extraction of 2.1RNA
1) aneurysma (normal control blood vessel) tissue fritter is placed in culture dish, adds 1mlTrizol, after shredding, moves to homogenate in homogenizer with eye scissors;
2) after homogenate completes, take out homogenate be placed in EP pipe, be settled to lml, can frozen with-70 DEG C;
3) place 5min for 15-30 DEG C, add 200 μ l chloroforms, place 10min for concuss 15sec, 15-30 DEG C;
4) 2-8 DEG C, lower than the centrifugal l0min of 12000g/min, abandons supernatant, adds lml75% ethanol, lower than the centrifugal 5min of 7500g/min, after abandoning supernatant, put from;
5) drying to be precipitated (be translucent shape, without complete drying, otherwise can reduce stability), with RNase-freewater55-60 DEG C of dissolving, frozen in-70 DEG C.
2.2 reverse transcription synthesis cDNA
Adopt iIIReverseTranscriptase (invitrogen, article No. 18080-044) carries out cDNA reverse transcription, and experimental implementation is undertaken by product description, and concrete operations are as follows:
Use Reverse Transcriptase kit, with RT Buffer, converse record synthesis cDNA is carried out to l μ g total serum IgE.Adopt 25 μ l reaction systems, each sample gets 1 μ g total serum IgE as template ribonucleic acid.It is for subsequent use that-20 DEG C of refrigerators are put in the cDNA preservation obtained.
2.3Real-TimePCR
2.3.1 instrument and analytical procedure
With ABI7500 type quantitative real time PCR Instrument, 2-△ △ CT method is adopted to carry out the relative quantitative assay of data.
2.3.2 design of primers
Adopt online primer-design software, gene order is with reference to NCBI:NM_172225.1 (DMBX1), and interior participation in the election GAPDH, is synthesized by invitrogen company after design of primers.Concrete primer sequence is as follows:
DMBX1 gene amplification primer:
Upstream primer: 5 '-GTGTTGGTATCATCAGTTC-3 ' (SEQIDNO.10)
Downstream primer: 5 '-GGAATAGAAGGAGAGCAA-3 ' (SEQIDNO.11)
Amplification length 99bp.
Reference gene amplimer:
Upstream primer: 5 '-CGCCTGGAGAAAGCTGCTA-3 ' (SEQIDNO.12)
Downstream primer: 5 '-ACGACCTGGTCCTCGGTGTA-3 ' (SEQIDNO.13)
Amplification length 104bp.
Operating process is as follows:
(1) reaction system: use greenPCRMasterMix (invitrogen, article No. 4367659) increases: 2 × mix10 μ l; The upstream primer of 10uM and each 0.5 μ l of downstream primer; Template 2 μ l, adds sterile purified water and fills to 25 μ l.
Amplification program is: 95 DEG C of 5min, (95 DEG C of 15sec, 55 DEG C of 45sec) × 35 circulations.
(2) primer screening
After each sample cDNA is mixed, 5 times of gradient dilutions are carried out as template, after dilution, sample is respectively got 2 μ l and is made template, increase with goal gene primer and reference gene primer respectively, carry out melt curve analysis analysis at 60-95 DEG C simultaneously, carry out primer screening according to amplification efficiency height and the unimodal principle of solubility curve.
(3) sample RealTimePCR detects
Get 2 μ l after doubly being diluted by each sample cDNA10 and make template, increase with goal gene primer and reference gene primer respectively.Carry out solubility curve analysis at 60-95 DEG C simultaneously.
Three, result
Real-time quantitative PCR amplification curve flex point is clear, and the overall collimation of amplification curve is good, shows that the amplification efficiency of each reaction tubes is close, and the limit is flat and without raising up now, exponent phase slope is comparatively large, illustrates that amplification efficiency is higher; Sample amplified production solubility curve is all unimodal, illustrates that amplified production only has one, is specific amplification; Relative quantification formula according to qRT-PCR: 2-Δ Ct × 100%, compares the expression level of DMBX1 gene in intracranial aneurysm group and control group.Result shows: qRT-PCR stable amplification result, wherein the expression level of DMBX1 gene in intracranial aneurysm group is about 2.6 times of control group, see Fig. 1, the result of confluence analysis DMBX1 gene high expression level in intracranial aneurysm patients of above result verification high-throughput transcript profile expression data.
The vitro culture of embodiment 4 circulating EPCs
One, material
Intracranial aneurysm group and control group respectively select 5 examples, and venous blood samples is about 20mL.The structure of entocranial artery is different from the outer artery of cranium, and the adventitia 3-tier architecture that during its inner membrance be made up of endotheliocyte, smooth muscle cell are formed, film and collegen filament are formed forms.Endothelium amendment after circulating endothelial progenitor cells (EPCs) can participate in being born after revascularization and endothelial injury, plays a very important role in the generation and evolution of intracranial aneurysm.
Two, method
The in-vitro separation of 2.1 human endothelial progenitor cells from peripheral bloods and cultivation
Ficoll density gradient centrifugation separating peripheral blood mononuclear cells:
(1) human lymphocyte parting liquid 6mL is got, 4 DEG C of 600rpm, centrifugal 10min, for subsequent use;
(2) the anticoagulation 20mL gathered and 0.01M phosphoric acid salt (1 × PBS) damping fluid 2mL is mixed according to 1:1.
(3) mixing liquid of step 2 is slowly joined in the human lymphocyte parting liquid that step 1 obtains (the two volume ratio is 2:3, blood sample and lymphocyte separation medium layering); Room temperature, 1500rpm, centrifugal 20min;
(4) centrifugal rear sample layering obviously (divides four layers), and tunica albuginea layer (mononuclearcell layer) in the middle of drawing with sampling gun, is placed in centrifuge tube, adds 2mLl × PBS damping fluid; In room temperature with the centrifugal 10min of 1500rpm, carry out first time washing;
(6) abandon supernatant, add 2mL1 × PBS damping fluid, beat with sampling gun featheriness, fully mix, at 20 DEG C with the centrifugal 10min of 1200rpm, carry out second time washing;
(7) abandon supernatant, add endothelial progenitor cells nutrient solution (EGM), piping and druming is even, re-suspended cell, cell counting, Trypan Blue identification of cell vigor (every hole 1.5-2mL);
(8) cell density is adjusted, according to 1 × 10 6/ cm 2, inoculating into wrapping in advance by the 6 porocyte culture plates of FN, being placed in 37 DEG C of 5%CO 2cultivate in incubator.
2.2 cell viabilities detect
After final centrifugation, abandon supernatant, add EGM substratum, re-suspended cell.Get a cell suspension to mix with a 0.2% trypan blue dye liquor, on blood counting chamber, count the total cellular score in four block plaid.Dead cell can be dyed to blueness, and viable cell is not painted.Count 200 monocytes, calculate the percentage (viable cell percentage=viable count/total cell count × 100%) of viable cell.
The cultivation of 2.3 endothelial progenitor cells and observation
When being cultured to the 4th day, changing liquid and remove non-attached cell.Within every 3 days later, change liquid once, the cell of adherent growth continues to be cultured to 14 days.Every day is the change of observation of cell growth morphology under inverted microscope.
The qualification of 2.4 endothelium group cells
EPCs has picked-up acLDL and the characteristic in conjunction with UEA-1, and we carry out this step experiment with through cultivating the cell after 7 days, by this step experiment, can identify the endothelial properties of the EPCs of cultivation further.Specific as follows:
(1) attached cell and Dil-acLDL (2.4 μ g/ml) 37 DEG C hatch 1 hour to detect the picked-up of EPCs to acLDL;
After (2) 2% paraformaldehyde room temperatures fix 10 minutes, PBS cleans;
(3) FITC-UEA-1 (10 μ g/ml) is added above-mentioned sample 37 DEG C and hatch 1 hour;
(4) positive rate and the quantity of the two staining positive cells of acLDL and UEA-1 identified by fluorescent microscope.
Three, experimental result
Peripheral blood through density gradient centrifugation be separated after, can clear view to the mononuclearcell layer between parting liquid and PBS liquid level, in white cloud.Density gradient centrifugation obtain mononuclearcell after Trypan Blue viable cell percentage 95.29 ± 3.08%.Mononuclearcell is trained Fusoid cells after 7 days and is comparatively before increased in the culture dish of fibronectin bag quilt, forms cell mass, visible part Colony forming.Cultivate the positive rate >89% of the two staining positive cells of fluorescent microscope qualification acLDL and UEA-1 after 7 days simultaneously.
Embodiment 6RNAi disturbs the impact of DMBX1 expression and endothelial progenitor cell
One, material
The endothelium group cell that embodiment 5 is cultivated.
SiRNA Design and synthesis, according to Photographing On-line software, according to gene order with reference to NCBI:NM_172225.1 (DMBX1), designs corresponding siRNA, under concrete sequence is shown in.Be sent to Synesis Company's synthesis after design, and fluorescent mark is carried out to the siRNA of synthesis.Contrast siRNAnc is provided by Synesis Company.
DMBX1-siRNA1：
targetsequence：GAGATATAAATATAAATATATAA(SEQIDNO.1)
guidesequence：AUAUAUUUAUAUUUAUAUCUC(SEQIDNO.2)
passengersequence：GAUAUAAAUAUAAAUAUAUAA(SEQIDNO.3)
DMBX1-siRNA2：
targetsequence：CTGGTTTTGGTTTTAGTAATTTT(SEQIDNO.4)
guidesequence：AAUUACUAAAACCAAAACCAG(SEQIDNO.5)
passengersequence：GGUUUUGGUUUUAGUAAUUUU(SEQIDNO.6)
DMBX1-siRNA3：
targetsequence：TCCTTTCTATGCCCAATAGAAGC(SEQIDNO.7)
guidesequence：UUCUAUUGGGCAUAGAAAGGA(SEQIDNO.8)
passengersequence：CUUUCUAUGCCCAAUAGAAGC(SEQIDNO.9)
Two, experimental technique
(1) expression of RNA AF panel endothelial progenitor cells DMBX1 gene
1. cell grouping
A group: the endothelial progenitor cells that control group is separated; B group: the endothelial progenitor cells that intracranial aneurysm patients group is separated; C1 group: B group+transfection liposome; C2 group: the nonspecific siRNA of B group+transfection; S1 group: B group+transfection specific DMBX1-siRNA1, S2 group: B group+transfection specific DMBX1-siRNA2, S3 group: the specific DMBX1-siRNA3 of B group+transfection.
2. transfection
According to Lipofectamine tMthe step that 2000TransfectionReagent provides is carried out.
(1) endothelial progenitor cells synchronization: day before transfection, gets endothelial progenitor cells and tests, and makes all endothelial progenitor cells be in synchronous regime, reduces test interference;
(2) 5 × 10 4cell is seeded on 6 orifice plates, and these are for the cell quantity of initial vaccination, should be able to cell confluency be made to reach 70% in 24 hours;
(3) siRNA-Lipofectamine is prepared tM2000 mixtures:
A. 5ulLipofectamine is diluted with 250u1Opti-MEM tM2000, mix gently, incubated at room temperature 5 minutes.
B. test each group to get 7.5u1siRNA respectively and add in 250u1EGM and dilute, and shake gently and mixed;
C. after hatching 5 minutes, by siRNA and Lipofectamine of dilution tM20 minutes are at room temperature hatched after 2000 mixing.
(4) cell, substratum and siRNA-Lipofectamine is added in each hole in culture plate tM2000 mixtures.Then wave and culture plate gently, makes them fully mix;
(5) 37 DEG C are placed on, CO 2hatch 24 hours in incubator, observation of cell transfection quantity under fluorescent microscope, detect transfection efficiency;
(6) transfection efficiency is the ratio of the cell quantity in fluoroscope and the light microscopic visual field, and the transfection efficiency of cell all reaches more than 90%, and side can carry out follow-up experiment.Calculation formula is as follows:
Cell quantity × 100% under the quantity/same field of view of the transfection efficiency=cell that fluoresces
3. apply the change that Real-timePCR method detects DMBX1 genetic expression before and after transfection
(1) structure of typical curve: be chosen at the normal endothelial progenitor cells 1 bottle cultivated in 50ml culturing bottle, extract RNA, measure RNA concentration and purity, carry out reverse transcription reaction, by the DNA profiling ten times dilution that reaction generates, obtain being equivalent to 10 4-10 0the DNA profiling of copies/ul, adds DMBX1 gene primer and internal reference primer respectively, and preparation 25u1 reaction system, uses Real-timePCR amplification instrument, carry out pcr amplification reaction.Obtain the typical curve of DMBX1 and internal reference.
(2) change of DMBX1 genetic expression after Real-timePCR method detection transfection: the RNA extracting each group of cell, measure RNA concentration and purity, carry out reverse transcription reaction, often organize the Real-timePCR reaction that DNA profiling enters DMBX1 and internal reference simultaneously, experiment in triplicate.
(3) agarose gel electrophoresis is carried out to PCR primer.
(2) endothelium group cell migration ability measures
The polycarbonate membrane diameter used is 6.5mm, 8.0 μm, aperture.Experiment Transwell carries out EPC transfer ability mensuration, is collected in by cell suspension in centrifuge tube, with the centrifugal 5min of 800rpm, abandons supernatant, washes 2 times with PBS, resuspended with the serum free medium containing 0.05%BSA, and counting, is modulated into 2 × 10 4ePCs/50 μ l suspension, 0.05%BSA act as maintenance osmotic pressure.Respectively the cell suspension that 50 μ l modulate is injected in the upper room of Transwell culture dish, VEGF (50ng/ml) is joined containing serum free culture system liquid, respectively 200 μ l mixed solutions are joined the lower room of Transwell culture dish.At 37 DEG C of 5%CO 2cell culture incubator cultivates 24h, discard room liquid, room in careful taking-up, wet cotton swab wipe away above filter membrane not through theca cell, with Hoechst33258 resume combustion nucleus, microscopy under fluorescent microscope, each cell Stochastic choice 5 field of microscope (× 200) countings move to the cell of low layer.
Three, experimental result
Observe each group of siRNA transfecting endothelial progenitor respectively, result is presented in a large amount of endothelial progenitor cells and finds green fluorescence, prove the transfection having obtained siRNA in endothelial progenitor cells, then in fluoroscope and light Microscopic observation endothelial progenitor cells quantity, carry out the detection of transfection efficiency, result display transfection efficiency all reaches more than 90%.
Real-timePCR result shows, the C1 group of transfection liposome and transfer the possession of nonspecific siRNA C2 group endothelial progenitor cell in DMBX1 genetic expression without obvious restraining effect, with B group control group no difference of science of statistics, 3 DMBX1 gene siRNA groups of transfection all in endothelial progenitor cell DMBX1 genetic expression play certain restraining effect, wherein DMBX1-siRNA1 inhibition is the most obvious, inhibiting rate reaches 61%, specifically sees Fig. 2.
Transwell tests display, endothelial progenitor cells (the A group be separated with control group, every 200 × visual field, 35.8 ± 3.6) endothelial progenitor cells (the B group that intracranial aneurysm patients group is separated is compared, every 200 × visual field, 19.7 ± 3.2) transfer ability obviously declines, and after interference, transfer ability is improved, and wherein S1 group (RNA interfering is DMBX1-siRNA1) transfer ability improves nearly 19%.

Claims (10)

1. a diagnosis of intracranial aneurysms preparation, is characterized in that, diagnosis of intracranial aneurysms preparation detects the expression amount of DMBX1 gene and/or gene expression product.
2. diagnosis of intracranial aneurysms preparation according to claim 1, is characterized in that, described diagnosis of intracranial aneurysms preparation adopts PCR kit for fluorescence quantitative, gene chip, immunization method to detect the expression of DMBX1 gene in intracranial aneurysm tissue.
3. diagnosis of intracranial aneurysms preparation according to claim 2, it is characterized in that, upstream primer containing specific detection DMBX1 gene in PCR kit for fluorescence quantitative and downstream primer, upstream primer sequence is SEQIDNO.10, and downstream primer sequence is SEQIDNO.11.
4. the application of the diagnosis of intracranial aneurysms preparation described in claim 1-3 any one in preparation diagnosis of intracranial aneurysms instrument.
5. treat a preparation for intracranial aneurysm, it is characterized in that, containing the reagent of transcribing or expressing or the compound that suppress DMBX1 gene in preparation, preferably, containing pharmaceutics acceptable carrier in preparation.
6. the preparation for the treatment of intracranial aneurysm according to claim 5, it is characterized in that, in the preparation of described treatment intracranial aneurysm containing activate DMBX1 suppressor gene, activate suppress DMBX1 to express albumen, import suppress DMBX1 to transcribe or express siRNA, activate promote DMBX1mRNA degraded microRNA, import the molecule promoting DMBX1 proteolytic degradation, the expression suppressing the factor and the albumen promoting that DMBX1 expresses.
7. the preparation for the treatment of intracranial aneurysm according to claim 6, is characterized in that, suppresses the DMBX1 siRNA that transcribes or express for SEQIDNO.1 and/or SEQIDNO.4 of DMBX1 gene and/or SEQIDNO.7 site.
8. the preparation for the treatment of intracranial aneurysm according to claim 5, it is characterized in that, treatment intracranial aneurysm preparation contain following in one group or several groups of siRNA:SEQIDNO.1 and SEQIDNO.2, SEQIDNO.3 and SEQIDNO.4, SEQIDNO.5 and SEQIDNO.6.
9. the application in treatment of intracranial aneurysm medicine or reagent prepared by the preparation of the treatment intracranial aneurysm described in claim 5-8 any one.
10. the preparation of the treatment intracranial aneurysm described in claim 5-8 any one strengthens the application in EPCs active ingredient in preparation.
CN201510861260.2A 2015-12-01 2015-12-01 Tumor markers DMBX1 and its application Active CN105256063B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510861260.2A CN105256063B (en) 2015-12-01 2015-12-01 Tumor markers DMBX1 and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510861260.2A CN105256063B (en) 2015-12-01 2015-12-01 Tumor markers DMBX1 and its application

Publications (2)

Publication Number Publication Date
CN105256063A true CN105256063A (en) 2016-01-20
CN105256063B CN105256063B (en) 2019-03-01

Family

ID=55095988

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510861260.2A Active CN105256063B (en) 2015-12-01 2015-12-01 Tumor markers DMBX1 and its application

Country Status (1)

Country Link
CN (1) CN105256063B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105400888A (en) * 2015-12-18 2016-03-16 四川省人民医院 Molecular marker for diagnosis and treatment of intracranial aneurysm
CN110819631A (en) * 2019-11-26 2020-02-21 西安市第三医院 Application of human DMBX1 gene and related product

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015117204A1 (en) * 2014-02-06 2015-08-13 Immunexpress Pty Ltd Biomarker signature method, and apparatus and kits therefor
CN105400888A (en) * 2015-12-18 2016-03-16 四川省人民医院 Molecular marker for diagnosis and treatment of intracranial aneurysm

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015117204A1 (en) * 2014-02-06 2015-08-13 Immunexpress Pty Ltd Biomarker signature method, and apparatus and kits therefor
CN105400888A (en) * 2015-12-18 2016-03-16 四川省人民医院 Molecular marker for diagnosis and treatment of intracranial aneurysm

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
AKIHIRA OHTOSHI，ET AL: "Dmbx1, a novel evolutionarily conserved paired-like homeobox gene expressed in the brain of mouse embryos", 《MECHANISMS OF DEVELOPMENT》 *
ROBINDRA N. GOGOI，ET AL: "The paired-type homeobox gene Dmbx1 marks the midbrain and pretectum", 《MECHANISMS OF DEVELOPMENT》 *
SHEN-HSI YANG，ET AL: "A Genome-Wide RNAi Screen Reveals MAP Kinase Phosphatases as Key ERK Pathway Regulators during Embryonic Stem Cell Differentiation", 《PLOS》 *
ZHILI LI，ET AL: "Construction of transcriptional regulatory network in the intracranial aneurysms", 《INT J CLIN EXP MED》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105400888A (en) * 2015-12-18 2016-03-16 四川省人民医院 Molecular marker for diagnosis and treatment of intracranial aneurysm
CN105400888B (en) * 2015-12-18 2019-04-19 四川省人民医院 A kind of molecular marker of diagnosis and treatment intracranial aneurysm
CN110819631A (en) * 2019-11-26 2020-02-21 西安市第三医院 Application of human DMBX1 gene and related product
CN110819631B (en) * 2019-11-26 2024-03-26 西安市第三医院 Application of human DMBX1 gene and related products

Also Published As

Publication number Publication date
CN105256063B (en) 2019-03-01

Similar Documents

Publication Publication Date Title
Goveia et al. An integrated gene expression landscape profiling approach to identify lung tumor endothelial cell heterogeneity and angiogenic candidates
AU2019204178B2 (en) Renal cell populations and uses thereof
Coras et al. Clinico-pathological subtypes of hippocampal sclerosis in temporal lobe epilepsy and their differential impact on memory impairment
CN105349642A (en) Acute myocardial infarction marker and application thereof
CN106834486A (en) Osteosarcoma molecule diagnosis and treatment mark and its application
Yang et al. Uveal melanoma metastasis models
CN105349641A (en) Acute myocardial infarction related gene SERPINB13 and application thereof
CN105368975B (en) Entocranial artery tumor markers ODAM and its application
Jie et al. Downregulated ribosomal protein L39 inhibits trophoblast cell migration and invasion by targeting E‐cadherin in the placenta of patients with preeclampsia
CN105256063A (en) Tumor marker DMBX1 and application thereof
Han et al. Dermal mesenchymal stem cells promoted adhesion and migration of endothelial cells by integrin in psoriasis
WO2012061073A1 (en) Wound healing metakaryotic stem cells and methods of use thereof
CN105177171B (en) AKR1B10 is preparing the application in acute myocardial infarction AMI diagnosis and treatment preparation
CN105256064A (en) CSF2 gene and new application of expression product of CSF2 gene
CN105420369A (en) Target spot for diagnosing and treating intracranial aneurysm and application of target spot
CN105233290A (en) C22orf26 gene and application of expression product of C22orf26 gene to preparing Parkinson diagnosis and treatment preparation
US20160274118A1 (en) Biomarker of liver cancer and uses thereof
CN105664163A (en) Application of mir-5010 and mature miRNA (micro ribonucleic acid) of mir-5010 in preparation of OSA (osteosarcoma) diagnosis and treatment preparation
CN115624616B (en) Application of adaptor protein PINCH in diagnosis of vascular dysplasia-related diseases
Zalivina et al. Inhibition of miR-199a-3p in a murine hypertrophic cardiomyopathy (HCM) model attenuates fibrotic remodeling
CN105420366B (en) The application of ADAMTS-2 genes and its expression product in diagnosis and treatment gastric cancer
Barnes Influence of matrix and fluid microenvironments on cancer cell migration, survival, and metastasis
Cheng et al. Wall Shear Stress Reduction Activates Angiotensin II to Facilitate Aneurysmal Subarachnoid Hemorrhage in Intracranial Aneurysms Through MicroRNA-29/The Growth Factor-Beta Receptor Type II/Smad3 Axis
Azar et al. Uterine fluid microRNAs in repeated implantation failure
Huang The role of vascular endothelial cadherin and the therapeutic potential of intravitreally administrated mesenchymal stem cells in retinal vasoregression

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20191210

Address after: Room 2503, Qianshan building, building D2, Qingdao International Innovation Park Phase II, No. 1, Keyuan Weiyi Road, Laoshan District, Qingdao, Shandong Province

Patentee after: Qingdao Yangshen biomedical Co., Ltd

Address before: 100080 Beijing city Haidian District Shanyuan Street No. 1 cubic court building room 3103

Patentee before: Beijing Yang Shen biology information technology company limited