CN105255917A - Moderate-temperature alkaline lipase as well as preparation method and application thereof - Google Patents

Abstract

The invention belongs to the field of genetic engineering and relates to a moderate-temperature alkaline lipase as well as a preparation method and application thereof. The moderate-temperature alkaline lipase est424 serves as the sequence expressed by the basic group in SEQ ID No.1; the protein of the moderate-temperature alkaline lipase genetic code serves as the sequence expressed by the amino acid in SEQ ID No.2; the gene est424 has the length of 924bp and is coded with 307 amino acids; a pET 28 system is utilized to construct an esterase recombinant expression vector; in order to prevent the forming of an inclusion body, the molecular chaperone protein dnak-dnaJ-grpE and the esterase recombinant expression vector are subjected to co-transformation and inducible expression in escherichia coli BL21(DE3), so that the soluble 35kDa recombinant lipase protein is acquired; a Ni<+> affinity chromatography system is utilized to separate and purify the recombinant lipase est424. The optimal reaction temperature of the lipase is at 35 DEG C, the optimal reaction pH value is 8.0 and the enzyme activity unit is 171.03 U/mg.

Description

Warm basic lipases and preparation method thereof and application in one

Technical field

The invention belongs to genetically engineered field, relate to a kind of there is new gene sequence middle temperature alkaline esterase, its preparation method and application.

Background technology

Esterase, refers to that the formation for ester bond plays the class of enzymes of katalysis with hydrolysis, is extensively present in plant, animal and microorganism.The reaction of synthesizing or being hydrolyzed can be there is with a lot of substrate in esterase in catalytic process, in this reaction process, do not need other cofactor to participate in the carrying out of reaction, catalyzed reaction can keep higher reaction stability in the reaction environment of organic phase, in addition, the catalyzed reaction that esterase occurs has extremely strong regiospecificity and stereospecificity, possesses the advantage required by industrial enzymes.Therefore esterase is widely used in industrial numerous areas, also occupies very large ratio in zymin market in the world.Study and develop the novel esterases with premium properties and be not only conducive to reducing corresponding industrial production cost, also to raising food safety, reduce the chemical industries such as grease and pollute energy consumption, reduce environmental pollution and maintain Sustainable development, improve the aspects such as the safety in utilization of pharmaceutical preparation, all significant.

Ocean environment has high diversity, and the diversity that cold current, hydrothermal vent, deep-sea plain, trench, seamount, submarine volcano, the deep-sea whale bones of the body etc. are marine microorganism together with different pressure, salinity, temperature, trophic component and illumination condition creates condition.But, only there is the marine microorganism of about 0.1% separated pure culture to utilize at present.Be separated the problem of pure culture aspect for marine microorganism, utilize technique of metagenome development of new functional gene and there is the zymoprotein of special purpose, have boundless prospect current exploitation in infant industry enzyme.

Summary of the invention

First object of the present invention is to provide a kind of new esterase gene est424.

Second object of the present invention is to provide a kind of Recombinant esterase est424 encoded by described esterase gene est424.

3rd object of the present invention is to provide the preparation method of a kind of described esterase est424.

For achieving the above object, the present invention adopts technical scheme to be:

The sequence of esterase gene est424 is as follows:

The aminoacid sequence of the esterase est424 that described esterase gene est424 encodes is as follows:

The preparation method of described solubility esterase est424 comprises the following steps:

1) esterase gene est424 is cloned;

2) esterase gene est424 is inserted expression vector, build the recombinant expression vector carrying described esterase gene est424;

3) by recombinant expression vector and chaperone plasmid pKJE7 cotransformation in competence e. coli bl21 (DE3) cell;

4) choose the positive colony transformed in rear e. coli bl21 (DE3) and carry out fermentation culture in substratum;

5) e. coli bl21 (DE3) cell after collected after centrifugation fermentation, and be resuspended in lysis buffer and carry out cracking;

6) by step 5) in the suspension of cracking centrifugal, collect supernatant liquor, carry out affinity purification with nickel ion resin, re-use desalting column desalination, obtain described solubility esterase est424.

In step 2) in, described expression vector is pET28.

In step 4) described in substratum be LB substratum containing 100 μ g/mL kantlex and 20 μ g/mL paraxin, described fermentation condition is: temperature 37 DEG C, shaking table is cultured to OD ₆₀₀for 0.4-0.6, adding isopropylthio-β-D-galactoside (IPTG) to final concentration is 0.5mmol/L, cultivates 24 hours under 16 DEG C of conditions.

In step 6) in, described centrifugal be 12000g, centrifugal 30min, 4 DEG C.

An application for middle temperature basic lipases gene, the application of described middle temperature basic lipases gene in the hydrolysis reaction of catalysis ester class and derivative substrates.

This esterase optimal reactive temperature is 35 DEG C, and optimal reaction pH value is 8.0, Mei Huo unit is 171.03U/mg.

A kind of recombinant expression vector, this expression vector includes the function fragment of nucleotide sequence as shown in SEQIDNO.1.

A kind of reconstitution cell, this Host Strains includes the albumen of the middle temperature basic lipases genes encoding of SEQIDNO.2.

The advantage that the present invention has:

1) the present invention obtains the DNA sequence dna of a new esterase from the grand genomic library of South Sea abyssal sediment, it is studied its function by genetic engineering technique, find recombinant expression vector and chaperone plasmid pKJE7 cotransformation e. coli bl21 (DE3) cell, efficient soluble-expression can be obtained, through protein purification and SDS-PAGE electrophoresis, obtain a single protein band, molecular weight is 35kDa.

2) in the present invention, the zymologic property of esterase is as follows:

Optimal reactive temperature is 35 DEG C, and optimal reaction pH value is 8.0, and this esterase is warm alkaline esterase in, and its Mei Huo unit is 171.03U/mg.It is stable at 20 DEG C, Fe ²⁺and Mn ²⁺effectively can improve the activity of enzyme, the Tween80 and 20 of 1% also can improve the activity of esterase.

Accompanying drawing explanation

Esterase est424SDS-PAGE electrophoresis result after the purifying that Fig. 1 provides for the embodiment of the present invention.

Fig. 2 for the embodiment of the present invention provide under pH value is the condition of 8.0, temperature is to the effect diagram of esterase activity.

Fig. 3 for the embodiment of the present invention provide under temperature is the condition of 35 DEG C, pH is to the effect diagram of esterase est424 activity.

The positively charged ion that Fig. 4 provides for the embodiment of the present invention is to the effect diagram of esterase activity.

The organic solvent that Fig. 5 provides for the embodiment of the present invention is on the impact of esterase activity.

The washing agent that Fig. 6 provides for the embodiment of the present invention is to the effect diagram of esterase activity.

The thermostability figure of the esterase est424 that Fig. 7 provides for the embodiment of the present invention.

The pH stability diagram of the esterase est424 that Fig. 8 provides for the embodiment of the present invention.

Embodiment

Embodiment 1

The preparation method of described esterase est424 comprises the following steps:

1, pcr amplification esterase gene fragment

(1) increase esterase gene from first genome

According to the sequence of the uncultured microorganisms mesopelagic esterase gene announced in NCBI, with the conserved regions design pair of primers of software Primer5 in gene order:

Lipo-F:5’-GGAATTCCATATGGCCAGCCAGCCAGCACCTTC-3’

Lipo-R:5’-CCCAAGCTTTTAGGCTGCCTGCCGCCTCCGGGA-3’

In forward primer, there is a NdeI restriction enzyme site, in reverse primer, have a HindIII restriction enzyme site.

Primer designed by utilization, increases to the sample of South Sea abyssal sediment.PCR reaction system (20 μ L): 2 × GCBuffer, 10 μ L; Water, 6.4 μ L; Lipo-F (20 μMs), 1 μ L; Lipo-R (20 μMs), 1 μ L; Template DNA, 1 μ L; Taq enzyme (2.5U/ μ L), 0.2 μ L.PCR response procedures: 94 DEG C of denaturation 5min is 35 circulations afterwards, 94 DEG C of sex change 50s, 63 DEG C of annealing 50s, and 72 DEG C extend 1min; Last 72 DEG C extend 10min.Finally in a sample, find possible band.

(2) agarose gel electrophoresis fragment reclaims

Reclaim test kit (sky root, Beijing) with plain agar sugar gel DNA and reclaim object fragment.

(3) fragment connects

Object fragment and pMD18-T carrier (TaKaRa, Dalian) are carried out connection 16h at 16 DEG C, obtains the plasmid pMD18-Lipo being connected to object fragment.

(4) transformed competence colibacillus cell

With the plasmid pMD18-Lipo transformation of E. coli Top-10 competent cell being connected to object fragment, with the LB solid medium having added kantlex (final concentration is 100 μ g/mL), transformant is screened.

(5) bacterium liquid PCR detects

Picking mono-clonal to enter to be added with in the 1mL LB liquid medium of penbritin (final concentration is 100 μ g/mL) 37 DEG C, 200rpm shaking culture 6h, get 1 μ L and do template, use carrier universal primer M13-47 (CGCCAGGGTTTTCCCAGTCACGAC) and RV-M (GAGCGGATAACAATTTCACACAGG) to carry out bacterium liquid PCR and detect.The positive colony getting detection checks order.

(6) extraction of plasmid is detected

The glycerine kind of positive colony be inoculated in the test tube of the LB liquid medium (containing kantlex final concentration in LB liquid medium is 100 μ g/mL) that 5mL is housed, 37 DEG C of shaking culture are spent the night.Extract plasmid with the little extraction reagent kit of plasmid (sky root, Beijing), be pMD18-Lipo.

2, the structure of esterase gene recombinant plasmid

(1) enzyme of plasmid is cut

Follow the concentration judging to extract plasmid according to gel imaging result, and carry out the double digestion of plasmid, above-mentioned acquisition pMD18-Lipo and pET28 plasmid are carried out double digestion (37 DEG C, spend the night) with NdeI and HindIII respectively.

Then cut glue to the small segment of pMD18-Lipo plasmid enzyme restriction and the large fragment of pET28 plasmid enzyme restriction, and reclaim with plain agar sugar gel DNA recovery test kit (sky root, Beijing), the product of the water elution of pH8.0 is stored in-20 DEG C.

(2) connection of endonuclease bamhi and plasmid

Judge the content of DNA according to electrophoresis result, the small segment after being reclaimed by the digestion products glue of above-mentioned gained and large fragment T4DNA ligase enzyme (TaKaRa, Dalian) connect.The content carrying out the small segment connected is 3-10 times of large fragment.Linked system connects 16 DEG C of constant temperature connections on instrument at constant temperature and spends the night.

By connection product conversion E. coli competent strain cell BL21 (DE3) of gained, carry out recombinant expressed, with the solid medium being added with kantlex (final concentration is 50 μ g/mL), transformant is screened.The several mono-clonal of picking the flat board of bacterium colony is had to screen in the EP pipe of liquid LB (being 100 μ g/mL containing kantlex final concentration) that 1mL is housed from long after plate incubated overnight, then acutely about 6h is shaken with shaking table, treat that in EP pipe, liquid occurs muddy, carries out PCR detection with the universal primer T7/T7Ter of carrier pET28.Select positive monoclonal wherein, be inoculated in 5mL LB liquid medium (be 100 μ g/mL containing kantlex final concentration), 37 DEG C of shaking culture are spent the night, extract plasmid, be pET28-Lipo, electrophoresis detection, and order-checking is verified, obtains base sequence shown in SEQIDNo.1.Meanwhile, positive colony is carried out conservation, conservation use final concentration be 20% glycerine, be placed in-80 DEG C of preservations.

3, the cotransformation of esterase gene and chaperone plasmid and the abduction delivering of solubility esterase

(1) preparation of esterase gene recombinant plasmid

To the Top10 glycerine kind of recombinant plasmid pET28-Lipo be had to be inoculated in be equipped with in the test tube of 5mL LB liquid medium (be 100 μ g/mL containing kantlex final concentration), 37 DEG C of shaking culture be spent the night.Extract esterase gene recombinant plasmid pET28-Lipo and carry out electrophoresis detection.

(2) cotransformation of chaperone plasmid

By chaperone plasmid pKJE7 and above-mentioned acquisition esterase gene recombinant plasmid pET28-Lipo cotransformation competence e. coli bl21 (DE3) cell, with the LB solid medium adding kantlex (final concentration 100 μ g/mL) and paraxin (final concentration 20 μ g/mL), transformant is screened, overnight incubation.

(3) the protein induced expression of cotransformation bacterial strain

The several mono-clonal of picking is had the flat board of bacterium colony in the EP pipe of liquid LB that 1mL is housed from long, kantlex (final concentration 100 μ g/mL) is added again in LB liquid medium, paraxin (final concentration 20 μ g/mL) screens, then acutely about 6h is shaken with shaking table, treat that in EP pipe, the muddy positive colony bacterial strain pKJE7-Lipo that will obtain appears in liquid, respectively conservation deposit in-80 DEG C and be inoculated in 5mL test tube LB liquid medium (substratum containing kantlex final concentration be 100 μ g/mL, paraxin final concentration is 20 μ g/mL) in, 37 DEG C of shaking culture are spent the night.

Carry out pKJE7-Lipo (pKJE7 afterwards, pET28-Lipo) coexpression: in 50mL LB liquid medium, adding paraxin final concentration is 20 μ g/mL, kantlex final concentration is 50 μ g/mL, L-Arabinose final concentration is 0.5mg/mL, then in 1% ratio inoculating strain pKJE7-Lipo (comprising plasmid pKJE7 and pET28-Lipo), 37 DEG C of shaking culture.Be cultured to OD ₆₀₀during for 0.4-0.6, place 30 minutes in 16 DEG C.It is two parts that 50mL nutrient solution is divided equally, every bottle of about 25mL, adds IPTG in one bottle wherein respectively, makes its final concentration be 0.5mmol/L, and then all nutrient solutions are all 16 DEG C of shaking culture 24 hours.After cultivation terminates, nutrient solution is in 50mL centrifuge tube, and 8000rpm is in 4 DEG C of centrifugal 15min, and supernatant discarded, precipitation 10mLPBS damping fluid (pH7.4) carries out resuspended, in cell crushing instrument, carry out cytoclasis.After fragmentation, get 500 μ L suspensions and be placed in EP pipe and be labeled as " T ", 4 DEG C save backup; Remain broken liquid, 8000rpm is in 4 DEG C of centrifugal 15min, and supernatant is placed in new centrifuge tube and is labeled as " S ", and precipitation is labeled as " P ".SDS-PAGE electrophoresis is carried out to sample, confirms expression amount and the solvability of object product.

(4) protein purification of cotransformation bacterial strain

Because the chaperone used is not containing His-tag, therefore can use ni-sepharose purification esterase protein; Be specially: (kantlex final concentration is 100 μ g/mL bacterial strain pKJE7-Lipo to be cultured to LB liquid medium, paraxin final concentration is 20 μ g/mL) fermentation culture obtains fermented liquid (fermentation condition is with pKJE7-Lipo coexpression condition), then get and 1L fermented liquid is placed in centrifuge tube, refrigerated centrifuge 8000rpm is in 4 DEG C of centrifugal 30min.Then by ice-cold 60mLPBS damping fluid (pH7.4) Eddy diffusion of thalline, with ultrasonic disruption cell 30 (800W under condition of ice bath, working hour 10s, interval time 60s), cell pyrolysis liquid after fragmentation is in 4 DEG C, and the centrifugal 30min of 12000g obtains broken rear supernatant liquor.Use nickel ion resin to carry out affinity purification to albumen, re-use desalting column, desalination damping fluid carries out desalination to albumen, desalination damping fluid is: 20mmol/LPB+50mmol/LNaCl+50mmol/LKCl (pH7.4).

Protein purification, also after desalination, uses the protein concentration after BCA protein quantification test kit detection purifying to be 147.576 μ g/mL, contains aminoacid sequence shown in SEQIDNo.2 simultaneously in albumen.

Embodiment 2

The zymologic property of described esterase est424 measures:

Esterase enzyme activity determination method adopts p-NP colorimetry.The solution that 10mmol/L is substrate with p-nitrophenyl butyric ester is made into Virahol, phosphoric acid buffer 3.8mL and the 0.1mL substrate solution of pH7.5 is added in control tube and sample hose, 30 DEG C of water bath heat preservation 5min, and then in control tube, add the enzyme liquid 0.1mL of deactivation, enzyme liquid 0.1mL is added in sample hose, mix timing immediately, in a water bath after accurate response 15min, under the spectrophotometric measurement of 410nm, measure the absorption value obtaining the p-nitrophenol (p-NP) of esterase catalyzed generation.Test is independent to be repeated 3 times, and statistics, the Mei Huo unit calculating esterase est424 is 171.03U/mg.

1, the optimal reactive temperature of esterase est424

Phosphoric acid buffer 3.8mL and 0.1mL p-nitrophenyl butyric ester solution (substrate solution) of pH7.5 is added in sample hose and control tube, respectively at 25 DEG C, 30 DEG C, 35 DEG C, 40 DEG C, 45 DEG C, 50 DEG C, water bath heat preservation 5min, and then inside control tube, add the esterase liquid 0.1mL of deactivation, the enzyme liquid 0.1mL after purifying is added in sample hose, add well and mixed at once and timing, continue accurate response 15min in bath temperature before after, the absorption value of the p-nitrophenol (p-NP) that esterase produces in catalytic process is measured under 410nm spectrophotometer measurement.Test is independent to be repeated 3 times, and statistics is also according to formulae discovery enzymic activity.As shown in Figure 2, show that this esterase is 35 DEG C time, enzymic activity is the highest, and be middle warm nature esterase, its optimal reactive temperature is 35 DEG C for experimental result.

2, the optimal reaction pH value of esterase est424

Damping fluid 3.8mL and 0.1mL p-nitrophenyl butyric ester solution (substrate solution) that pH value is respectively 5.0,5.6,6.2,6.8,7.4,8.0,8.6 and 9.2 is added in sample hose and control tube, at 35 DEG C of Water Under bath insulation 5min, and then inside control tube, add the enzyme liquid 0.1mL of deactivation, enzyme liquid 0.1mL is added in sample hose, mixed timing at once, under 35 DEG C of water bath condition after accurate response 15min, 410nm uses spectrophotometer by absorbance value, i.e. the p-nitrophenol (p-NP) of esterase catalyzed generation measures out.Test is independent to be repeated 3 times, and statistics is also according to formulae discovery enzymic activity.As shown in Figure 3, show that this esterase is when pH8.0, enzymic activity is the highest for experimental result, is easy to play its esterase character under weakly alkaline environment, and esterase activity reduces even inactivation under peracid (pH≤5.0) or mistake alkali (pH >=9.0) environment

Damping fluid is respectively: 1. pH5.0-pH6.5: citrate buffer agent;

2. pH6.5-pH7.5: phosphate buffered saline buffer;

3. pH7.5-pH9.0:Tris-HCl damping fluid;

4. pH9.0-pH9.2:CHES damping fluid.

3, positively charged ion is on the impact of esterase est424 activity

In control tube and sample hose, add phosphoric acid buffer 3.8mL and 0.1mL p-nitrophenyl butyric ester solution (substrate solution) of pH6.8,35 DEG C of water bath heat preservation 5min, add the metal ion solution (Mn of 10mM in sample hose ²⁺, Mg ²⁺, Zn ²⁺, Cu ²⁺, Ca ²⁺, Fe ²⁺, Co ²⁺, Na ⁺, K ⁺, Ni ⁺), control tube adds the pH6.8 phosphoric acid buffer of equivalent, enzyme liquid 0.1mL is added in sample hose and control tube, then timing is mixed immediately, in a water bath after accurate response 15min, under 410nm spectrophotometer, measure the absorption value of the p-nitrophenol (p-NP) of esterase catalyzed generation.Test is independent to be repeated 3 times, and statistics is also according to formulae discovery enzymic activity.Experimental result is not to add the control group of metal ion as 100%, and test results compares with it and obtains Fig. 4, shows that this esterase is at Mn ²⁺, Fe ²⁺the reactive behavior adding rear enzyme improves, and at Mg ²⁺, Zn ²⁺, Cu ²⁺, Ca ²⁺, Co ²⁺, Na ⁺, K ⁺, Ni ⁺add the reduction alive of rear enzyme.

4, organic solvent is on the impact of esterase est424 activity

Phosphoric acid buffer 3.8mL and 0.1mL p-nitrophenyl butyric ester solution (substrate solution) of pH8.0 is added in control tube and sample hose, 35 DEG C of water bath heat preservation 5min, organic solvent (the methyl alcohol that final concentration is 15% is added in sample hose, ethanol, Virahol, acetone, DMSO, DMF), control tube adds the pH8.0 phosphoric acid buffer of equivalent, enzyme liquid 0.1mL is added in sample hose and control tube, then timing is mixed immediately, in a water bath after accurate response 15min, the absorption value of the p-nitrophenol (p-NP) of esterase catalyzed generation is measured under 410nm spectrophotometer.Experimental result is not to add the control group of organic solvent as 100%, test results compares with it and obtains Fig. 5, show the reduction all had in various degree alive of this esterase enzyme after organic solvent adds, this esterase is suitable for reacting in water-soluble solution, and DMF, methyl alcohol (methanol), DMSO are maximum to its active reduction degree.

5, washing agent is on the impact of esterase est424 activity

Phosphoric acid buffer 3.8mL and 0.1mL p-nitrophenyl butyric ester solution (substrate solution) of pH8.0 is added in control tube and sample hose, 35 DEG C of water bath heat preservation 5min, washing agent (the Tween20 that final concentration is 1% is added in sample hose, Tween80, TritonX-100, SDS, CTAB), control tube adds the pH8.0 phosphoric acid buffer of equivalent, enzyme liquid 0.1mL is added in sample hose and control tube, then timing is mixed immediately, in a water bath after accurate response 15min, the absorption value of the p-nitrophenol (p-NP) of esterase catalyzed generation is measured under 410nm spectrophotometer.Experimental result is not to add the control group of washing agent as 100%, test results compares with it and obtains Fig. 6, show that this esterase enzyme after Tween20, Tween80 add is lived to improve, and enzyme reduction alive after TritonX-100, SDS, CTAB add, wherein TritonX-100, SDS are larger to the reduction amplitude that enzyme is alive.

6, the thermostability of esterase est424

Equivalent esterase is placed in respectively-20 DEG C, 0 DEG C, 10 DEG C, 20 DEG C, 30 DEG C, 40 DEG C, 50 DEG C, 60 DEG C insulation 30min.Phosphoric acid buffer 3.8mL and 0.1mL p-nitrophenyl butyric ester solution (substrate solution) of pH8.0 is added in sample hose, 35 DEG C of water bath heat preservation 5min, then in sample hose, add the enzyme liquid 0.1mL of all temps insulation 30min, mix timing immediately, in a water bath after accurate response 15min, under 410nm spectrophotometer, measure the absorption value of the p-nitrophenol (p-NP) of remnant enzyme activity.As shown in Figure 7, show that esterase est424 is the most stable when being kept at-20 DEG C, storage temperature this esterase between-20 DEG C to 20 DEG C is all more stable for experimental result, and continue to raise its thermostability with temperature and reduce gradually, 50 DEG C time, relative thermal stabilities levels off to zero.

7, the pH stability of esterase est424

The phosphoric acid buffer and the esterase that pH value are respectively 5.0,5.6,6.2,6.8,7.4,8.0,8.6,9.2 spend the night 4 DEG C of placements with the volume ratio of 1:1.Phosphoric acid buffer 3.8mL and 0.1mL p-nitrophenyl butyric ester solution (substrate solution) of pH8.0 is added in sample hose, 35 DEG C of water bath heat preservation 5min, then in sample hose, add various pH value place the enzyme liquid 0.1mL spent the night, mix timing immediately, in a water bath after accurate response 15min, under 410nm spectrophotometer, measure the absorption value of the p-nitrophenol (p-NP) of remnant enzyme activity.Result as shown in Figure 8, shows that this esterase is the most stable under being kept at the condition of pH7.4, enzyme work equal decrease to some degree when pH meta-acid or meta-alkali, peracid (pH≤5.0) or excessively alkali (pH >=9.2) enzyme extremely low even inactivation alive.

Claims (9)

1. a warm basic lipases gene in, is characterized in that: middle temperature basic lipases est424 is sequence shown in base in SEQIDNo.1.

2., by middle temperature basic lipases gene according to claim 1, it is characterized in that: the albumen of described middle temperature basic lipases genes encoding is sequence shown in amino acid in SEQIDNo.2.

3. a construction process for middle temperature basic lipases gene according to claim 1, is characterized in that:

1) esterase gene est424 is cloned;

2) esterase gene est424 is inserted expression vector, build the recombinant expression vector carrying described esterase gene est424;

3) by step 2) obtain recombinant expression vector and chaperone plasmid pKJE7 cotransformation in competence e. coli bl21 (DE3) cell;

4) choose the positive colony transformed in rear e. coli bl21 (DE3) and carry out fermentation culture in substratum;

5) e. coli bl21 (DE3) cell after collected after centrifugation fermentation, and be resuspended in lysis buffer and carry out cracking;

6) by step 5) in the suspension of cracking centrifugal, collect supernatant liquor, carry out affinity purification with nickel ion resin, re-use desalting column desalination, obtain the solubility esterase est424 containing sequence shown in base in SEQIDNo.1.

4. press the construction process of warm basic lipases gene in described in claim 3, it is characterized in that: described step 2) in, described expression vector is pET28.

5., by the construction process of warm basic lipases gene in described in claim 3, it is characterized in that: described step 4) in substratum be LB substratum containing 100 μ g/mL kantlex and 20 μ g/mL paraxin; Described fermentation condition is: temperature 37 DEG C, shaking table is cultured to OD ₆₀₀for 0.4-0.6, adding isopropylthio-β-D-galactoside (IPTG) to final concentration is 0.5mmol/L, cultivates 24 hours under 16 DEG C of conditions.

6. as claimed in claim 4 in the construction process of warm basic lipases gene, it is characterized in that: described step 6) in centrifugal be 12000g, centrifugal 30min, 4 DEG C.

7. an application for middle temperature basic lipases gene according to claim 1, is characterized in that: the application of described middle temperature basic lipases gene in the hydrolysis reaction of catalysis ester class and derivative substrates.

8. a recombinant expression vector, is characterized in that: expression vector includes the function fragment of nucleotide sequence as shown in SEQIDNO.1.

9. a reconstitution cell, is characterized in that: Host Strains includes the albumen of the middle temperature basic lipases genes encoding of SEQIDNO.2.