CN105254744B - The heterogenous expression of polypeptide XZZ-5 and its enhancing CIK cell kill the application in tumor activity - Google Patents
The heterogenous expression of polypeptide XZZ-5 and its enhancing CIK cell kill the application in tumor activity Download PDFInfo
- Publication number
- CN105254744B CN105254744B CN201510724586.0A CN201510724586A CN105254744B CN 105254744 B CN105254744 B CN 105254744B CN 201510724586 A CN201510724586 A CN 201510724586A CN 105254744 B CN105254744 B CN 105254744B
- Authority
- CN
- China
- Prior art keywords
- xzz
- cell
- cik
- polypeptide
- cik cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0636—T lymphocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0639—Dendritic cells, e.g. Langherhans cells in the epidermis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/11—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from blood or immune system cells
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Hematology (AREA)
- General Engineering & Computer Science (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of application of polypeptide XZZ-5 in induction enhancing CIK cell antitumor activity, studies have shown that inducing CIK or DC-CIK cell using polypeptide XZZ-5, it can effectively reinforce its proliferation and differentiation, it improves it and kills tumor activity, be expected to be developed into a kind of completely new biological therapy means.
Description
Technical field:
The invention belongs to bio-pharmaceuticals and biological therapy field, it is related to a kind of polypeptide in enhancing CIK cell antitumor activity
Application.
Background technique:
Malignant tumour has become first of the current cause of death in China, seriously threatens people's health and life,
The quality of life for how improving malignant tumor patient has become the hot spot of research.Currently, the conventional therapy means of tumour are mainly wrapped
Include chemotherapy, radiotherapy and operative treatment etc..
Biological therapy is a kind of tumor treatment model emerging, with significant curative effect, and clinical application belongs to autoimmunity
The anti-cancer treatments of cell are included in the three types of technology for allowing clinical application by national health State Family Planning Commission.Biotherapy includes
Cytokine therapy, immune cell therapy, gene therapy, molecular targeted therapy and antibody-targeted therapy etc..Wherein, CIK/DC-
CIK cell treatment technology is most common biological therapy technology, and core technology is tumor patient autologous peripheral blood CIK/DC-
CIK cell in vitro culture and its feedback technology.
Self CIK cell refers to, induces autologous patient peripheral blood mononuclear cells by cytokine profiles in vitro
(PBMC) the foreign cell group generated.There is different degrees of undermined, CD3+, CD8 in the immunity function of malignant tumor patient
+, CD56+ cell quantity reduce.CIK cell after proliferation is with the powerful anti-tumor activity of T cell and non-principal group of NK cell
Knit histocmpatibility (MHC) restricted the characteristics of killing tumor.Compared with PBMC, CD3+, CD8+, CD56+ cell ratio in CIK cell
Example is significantly raised, and CIK cell has very strong lethality to tumour cell, and CIK cell is more, and it is better to kill tumor effect.
Autologous peripheral blood DC-CIK cell is the foreign cell group generated after self DC cell and CIK cell co-incubation,
After DC and CIK is co-cultured for 24 hours, the secretory volume of IL12 is 6.93 times that CIK cell is individually cultivated；Can high expression CD3+, CD4+,
CD3+CD8+, CD3+CD56+ cell, low expression CD4+CD25+Treg cell.Although it is thin that DC cell does not have direct killing tumour
Born of the same parents' effect, but DC cell can stimulate the proliferation of CIK cell, and secretion kinds of tumors kills cell factor, such as TNF α and interferon
Deng.Autologous peripheral blood DC-CIK cell anti-tumor effect is usually better than CIK cell, but preparation cost is high.Itself DC cell with from
After body tumour antigen costimulation, anti-tumor immune response can be enhanced, be usually used in the clinical prevention of tumor cell vaccine at present.
CIK cell is mainly a variety of antitumor by cytotoxicity kill tumour cell, inducing apoptosis of tumour cell, secretion
Cell factor works with four kinds of approach such as body immune system are activated.
CIK cell can be largely proliferated by external evoked, and general preparation method is will to separate the single core of peripheral blood
Cell is induced with CD3mAb, IL-1A and IL-2, finally obtains a certain amount of CIK cell.However such cultural method may cause
The proliferation and cytotoxicity of CIK cell are not ideal enough.
Histone is basonuclin, and chromosome fibre nucleosomal structure can be formed in eucaryote.In recent years, group
Albumen is gradually resolved the special role of chromosome template, especially in terms of cell development regulation.In brief, if group
Protein on cells is out of hand, it will leads to the generation of tumour cell.Wherein, H2A is a kind of critically important core histones.?
The H2AX of report is identified as the skeuomorph of core histones H2A, and main signal transmission is played in DNA double chain fracture restoration and is made
With.Research confirms that H2AX phosphorylation is inhibiting cell Proliferation and accelerating to play key effect in Apoptosis.
Accordingly, in this experimental study, according to histone H2A in Genbank (accession number: NP-003508) amino acid sequence
Column, according to codon preference, design has synthesized the expressing gene of histone H2A, has been named as XZZ-5.Then, polypeptide is constructed
XZZ-5 expression system obtains single polypeptide XZZ-5.Finally, using polypeptide XZZ-5 as inducer, to induce generation high activity
CIK or DC-CIK cell improves it to the recognition capability of tumour cell and kills tumor activity.Experimental result shows that polypeptide XZZ-5 is lured
The raw XZZ-5-CIK or XZZ-5-DC-CIK cell of artificial delivery kills tumor activity with very strong.Polypeptide XZZ-5 of the present invention is lured
That leads enhancing CIK or DC-CIK cell kills tumor activity, still belongs to the first time, so far there is not yet relevant report both domestic and external.
Summary of the invention:
The present invention provides the heterologous expression system of polypeptide XZZ-5 a kind of, the expression system by polypeptide XZZ-5 gene, take
The monoclonal cell strain of recombinant plasmid with polypeptide XZZ-5 gene and heterogenous expression polypeptide XZZ-5 are constituted.
The polypeptide XZZ-5 gene is DNA sequence dna shown in SEQIDNo:1.
The amino acid sequence of the polypeptide XZZ-5 is amino acid sequence shown in SEQIDNo:2.
The recombinant plasmid is made of polypeptide XZZ-5 gene and expression vector.
The expression vector is pET-21 (b), pET-28a, pET-30 (a), pET-23 (b), pET-41 (a), pET-
41ah、pe-41aHNT、pET-41am、pGEX-4T-1、pACYCDuet、pCDFduet、pETDuet、pRSFDuet、pPIC9K、
One of pPIC3.5K and pWB980；Preferably pET-28a.
The monoclonal cell strain is obtained and recombinant plasmid is transferred in expressive host.
The expressive host is E.coliBL21, Pichia pastoris, one of bacillus subtilis (WB600)；It is preferred that
For E.coliBL21.
It is including following it is a further object of the invention to provide a kind of method for constructing polypeptide XZZ-5 heterologous expression system
Step:
(1) amplification obtains polypeptide XZZ-5 gene order；
(2) recombinant plasmid of the building DNA sequence dna comprising polypeptide XZZ-5 gene and expression vector；
(3) recombinant plasmid is transferred to expressive host, fermented and cultured.
Polypeptide XZZ-5 gene described in step (1) is DNA sequence dna shown in SEQIDNo:1；
The amino acid sequence of polypeptide XZZ-5 gene expression is amino acid sequence shown in SEQIDNo:2；
Expression vector described in step (2) is pET-21 (b), pET-28a, pET-30 (a), pET-23 (b), pET-41
(a)、pET-41ah、pe-41aHNT、pET-41am、pGEX-4T-1、pACYCDuet、pCDFduet、pETDuet、
One of pRSFDuet, pPIC9K, pPIC3.5K and pWB980；Preferably pET-28a；
Expressive host described in step (3) is E.coliBL21, Pichia pastoris, in bacillus subtilis (WB600)
One kind；Preferably E.coliBL21.
It is a further object of the invention to provide a kind of methods of polypeptide XZZ-5 induction CIK or DC-CIK cell, through this
XZZ-5-CIK the or XZZ-5-DC-CIK cell of method preparation, which kills CIK the or DC-CIK cell that tumor activity more routinely induces, to be had significantly
It improves.
The technical solution of the polypeptide XZZ-5 induction CIK or DC-CIK cell is, to CIK or DC-CIK cell culture
Polypeptide XZZ-5, induction CIK or DC-CIK cell Proliferation and differentiation are added in liquid, are made with improving the tumor of killing of CIK or DC-CIK cell
With.
It is described that polypeptide XZZ-5 induction CIK or DC-CIK cell Proliferation and differentiation are added into CIK or DC-CIK culture solution,
The specific steps of which are as follows:
(1) peripheral blood acquires: aseptic aspiration blood of cancer patients 75ml, and liver receives plain anticoagulant and mixes well；
(2) tumour antigen obtains: under room temperature, centrifugation of peripheral blood, 1000rpm, 10min；Then collect the upper layer 10ml
The blood plasma of collection is added in XZZ-5-CIK or XZZ-5-DC-CIK induced medium blood plasma, and gained cell precipitation is for separating
Mononuclearcell；
(3) mononuclearcell separates: gained cell precipitation adds to 50ml with physiological saline and washs, 1000rpm centrifugation
10min；Supernatant is abandoned, is washed again；Lymphocyte separation medium surface is gently added to, 1300rpm is centrifuged 20min；With the shifting of sterilizing
Liquid pipe collects lymphocyte separation medium cells of superficial layer, moves in 50ml disposable plastic centrifuge tube, addition physiological saline to 50ml,
It mixes；Centrifuge washing again；
(4) XZZ-5-CIK or XZZ-5-DC-CIK cell culture: abandoning supernatant after centrifugation, precipitates luring with the XZZ-5 containing polypeptide
Lead culture medium resuspension, and counted with diluted, respectively into 4 disposable Tissue Culture Flasks of 75cm2, be put into 30 DEG C,
It is cultivated in the incubator of 5%CO2 (v/v) saturated humidity, liquid and amplification is changed according to cell growth status in due course during culture, until
Cell number reaches needed for feedback.
Preferably, polypeptide XZZ-5 concentration is 0.1ug/ml~1mg/ml in induced medium described in step (4).
Invention advantage:
1. the protein yield of polypeptide XZZ-5 heterologous expression system is high in the present invention, 10mg/L can achieve；
2. polypeptide XZZ-5 of the invention can effectively enhance the quantity of DC-CIK cell, flow cytomery discovery, warp
In DC-CIK cell after induced medium induction, the ratio without the restricted NKT cell of MHC of CD3+, CD56+ for playing a crucial role
Example up to 88% or more, is higher than domestic and foreign literature and reports；
3. the XZZ-5-DC-CIK cell in the present invention after polypeptide XZZ-5 induction, experiment in vitro show that it kills tumor activity
Higher than the DC-CIK cell of routine culture, ratio of outflow is killed up to 99.3%；
4. the XZZ-5-DC-CIK cell therapy C26 colon cancer tumor-bearing mice in the present invention after polypeptide XZZ-5 induction,
Tumor load can obviously reduce or disappear, elongated strap tumor life cycle.
Detailed description of the invention:
Fig. 1 is the structure figures of polypeptide XZZ-5 expression vector
Fig. 2 is the XZZ-5-DC-CIK cell of polypeptide XZZ-5 induction and the proliferation results of DC-CIK cell
Wherein: abscissa is sample time, respectively on day 3, be sampled within the 5th day and the 7th day；
Ordinate is the OD570 value that mtt assay detects immunocyte number；
XZZ-5-DC-CIK is the DC-CIK cell after polypeptide XZZ-5 induction；
DC-CIK is the DC-CIK cell after routinely inducing
Fig. 3 is the poison of the XZZ-5-DC-CIK cell of polypeptide XZZ-5 induction and the cell of DC-CIK cells against tumor cells
Property result
Wherein: abscissa be 4 plants for cytotoxicity detection tumour cells, respectively MCF7, A549, HCT116 and
HepG2；
Ordinate cell concentration required when being XZZ-5-DC-CIK and DC-CIK cell-induced tumor Apoptosis 50%；
XZZ-5-DC-CIK is the DC-CIK cell after polypeptide XZZ-5 induction；
DC-CIK is the DC-CIK cell after routinely inducing
The XZZ-5-DC-CIK cell and DC-CIK cell that Fig. 4 is polypeptide XZZ-5 induction are to colon cancer C26 transplanted tumor in nude mice
Antitumor activity detection
Wherein: abscissa is the cell (XZZ-5-DC-CIK and DC-CIK cell) of experimental mice internal injection；Control
The physiological saline of group mouse internal injection；
Ordinate is the knurl weight slip to colon cancer, i.e. tumour inhibiting rate；
XZZ-5-DC-CIK is the DC-CIK cell after polypeptide XZZ-5 induction；
DC-CIK is the DC-CIK cell after routinely inducing
Specific embodiment:
Following embodiment is only to help those skilled in the art to be best understood from the present invention, but do not limit this in any way
Invention.
Embodiment 1
The amplification of polypeptide XZZ-5 sequence
According to histone H2A in Genbank (accession number: NP-003508) amino acid sequence, according to codon preference,
The encoding gene of design synthesis histone H2A, is named as XZZ-5.According to XZZ-5 sequence design amplimer XZZ-5-sense
And XZZ-5-anti.
Primer sequence is as follows:
XZZ-5-sense:GGGAATTCCATATGATGTCTGGTCGTGGTAAACAAGGT
XZZ-5-anti:CCCAAGCTTTCATTTAGATTTCGCTTTGTGAGAT
PCR amplification system are as follows: 2 × PCRmix10 μ l, ddH2O8 μ l, 1 μ l (about 50ng-200ng) of template DNA, upstream and downstream
Each 0.5 μ l of primer (concentration is 20 μM).PCR reaction condition are as follows: 96 DEG C, 2min initial denaturation；96 DEG C, 1min denaturation, 56 DEG C, 30s
Annealing, 72 DEG C of extension 40s (30 circulations)；Last 72 DEG C of extensions 5min is saved at 4 DEG C.
Embodiment 2
Express the building of XZZ-5 polypeptide recombinant plasmid
After PCR amplification, electrophoresis first is carried out using 1% Ago-Gel, voltage is 120 volts, after rubber tapping, is returned with glue
Receive the target DNA fragment of kit (Beijing CoWin Bioscience Co., Ltd.) recycling 390bp or so, then with NdeI and
HindIII carries out double digestion, DNA fragmentation obtained is connected to (precious bioengineering Co., Ltd) with carrier pET-28a, later
Link product is transformed into escherichia coli DH5a competent cell (Beijing Quanshijin Biotechnology Co., Ltd), mould containing that is blocked
It is screened on the LB plate of plain antibiotic.
Recon carries out double digestion verifying with restriction enzyme NdeI and HindIII.Digestion products carry out voltage herein
For 120 volts of agarose gel electrophoresis, verifying clip size is respectively the segment of 390bp or so and the carrier of 5300bp or so.
The building for expressing XZZ-5 polypeptide recombinant plasmid is as shown in Figure 1.
Embodiment 3
Express the acquisition of polypeptide XZZ-5 monoclonal cell strain
Recon plasmid is extracted with plasmid extraction kit (Beijing CoWin Bioscience Co., Ltd.), then by normal
Rule method is transformed into expressive host E.coliBL21 (Beijing Quanshijin Biotechnology Co., Ltd), i.e. acquisition polypeptide XZZ-5 base
The colibacillus engineering of cause.
Embodiment 4
The purifying and enrichment of polypeptide XZZ-5
The colibacillus engineering of building is inoculated in LB culture medium, 37 DEG C of shaking tables are incubated overnight, and are turned with 4% inoculum concentration
It is connected in LB culture medium, 37 DEG C of culture 5h, when OD600 is 0.5, is added IPTG (1M), makes its final concentration of 1mM, 18 DEG C lure
Lead expression 18h.Fermentation liquid is centrifuged 40min through 4000rpm, removes supernatant, thallus is resuspended with 50mMTris-HCl (PH8.0), through height
After pressing the broken instrument of homogeneous broken, 12000rpm is centrifuged 40min, obtains the supernatant containing enzyme.Then, it is obtained by Ni column purification single
One hydantoin enzyme, and its content is measured.
Embodiment 5
The separation of XZZ-5-DC-CIK cell, Fiber differentiation
(1) patient's selection and preparation: according to the indication and contraindication of XZZ-5-DC-CIK cell therapy, selection is suitble to should
The tumor patient for the treatment of informs relevant information and points for attention, obtains patient and family members understand and cooperation, sign informed consent
Book, and advise patient to acquire evening before that day and do not feed that meat or fish is greasy, and diet is based on inventory vegetarian diet；
(2) Mobilization: GM-CSF150ug is subcutaneously injected in first 24 hours of blood sampling；
(3) peripheral blood acquisition: the acquisition same day anxious routine of having a blood test, after determining normally, aseptic aspiration blood of cancer patients
50ml, heparin sodium is anticoagulant and mixes well；
(4) tumour antigen obtains: under room temperature, centrifugation of peripheral blood, 1000rpm, 10min；Then collect the upper layer 10ml
The blood plasma of collection is added in XZZ-5-CIK or XZZ-5-DC-CIK induced medium blood plasma, and gained cell precipitation is for separating
Mononuclearcell；
(5) mononuclearcell separates: gained cell precipitation adds to 50ml with physiological saline and washs, 1000rpm centrifugation
10min；Supernatant is abandoned, is washed again；Lymphocyte separation medium surface is gently added to, 1300rpm is centrifuged 20min；With the shifting of sterilizing
Liquid pipe collects lymphocyte separation medium cells of superficial layer, moves in 50ml disposable plastic centrifuge tube, addition physiological saline to 50ml,
It mixes；Centrifuge washing again；
(6) XZZ-5-CIK or XZZ-5-DC-CIK cell culture: abandoning supernatant after centrifugation, precipitates luring with the XZZ-5 containing polypeptide
Lead culture medium resuspension, and with diluted technology, respectively into 4 disposable Tissue Culture Flasks of 75cm2, be put into 30 DEG C,
It is cultivated in the incubator of 5%CO2 (v/v) saturated humidity, liquid and amplification is changed according to cell growth status in due course during culture, until
Cell number reaches needed for feedback.
Embodiment 6
The feedback of XZZ-5-DC-CIK cell
(1) expected cell sum, which reaches, feeds back number first three days, and sampling carries out microbiologic inhibition tests, cell sign analyte detection
(CD3, CD4, CD8 and CD16/56)；
(2) every qualification rear of detecting is ready for being fed back, and otherwise re-starts induction；
(3) 8~14 days about after blood sampling are fed back, total number of cells are up to 4 × 109It is fed back after a, is returned every time for the first time
Defeated primary, 4~5 feedbacks of each course for the treatment of point finish；
(4) vein can be used in returning step or the approach of part two carries out；
A: suspension is made with physiological saline in XZZ-5-DC-CIK cell, carries out intravenous drip with blood transfusion apparatus.It is instiling
In the process, infusion bag is shaked gently within every 5~10 minutes until dripping off, and cell settlement is avoided to accumulate.Before and after cell infusion, it is both needed to use
Physiological saline washing pipe.Cell feedback should be completed in 2 hours after laboratory treatment；
B: locally injecting: injection site selects successively are as follows: knurl has the splanchnocoel of metastases and has the leaching of metastases
Around fawning on；
(5) the various response situations that patient should be paid close attention in returning step carry out the emergency that various adverse reactions occur
Handle prediction scheme.
Embodiment 7
The multiplication characteristic of the XZZ-5-DC-CIK and DC-CIK of polypeptide XZZ-5 induction
(1) conventional separating peripheral blood mononuclear cells are 1 × 10 with RPMI-1640 tune cell concentration5/ ml, is inoculated with respectively
In 96 porocyte culture plates, every hole 100ul, every 16 hole of plate, totally three plate；
(2) the XZZ-5-DC-CIK cell of 2 × concentration and the DC-CIK culture of 2 × concentration routinely induced are separately added into
150ul is added in liquid, every hole, and preceding 8 hole is experimental group, and rear 8 hole is control group；
(3) 37 DEG C are placed in, is cultivated in the carbon dioxide incubator of the saturated humidity of 5%CO2 (V/V)；
(4) it was sampled respectively at different time sections 3 days, 5 days, 7 days, detects its OD570 with mtt assay.
The XZZ-5-DC-CIK cell of polypeptide XZZ-5 induction and the DC-CIK Cell proliferation results such as Fig. 2 institute routinely induced
Show.Show that polypeptide XZZ-5 can significantly improve the proliferation of DC-CIK cell at 5-7 days.
Embodiment 8
The cytotoxicity of XZZ-5-DC-CIK cell and DC-CIK cells against tumor cells in different time periods detects
Collect the XZZ-5-DC-CIK cell and DC-CIK cell of induction 7 days.It (is purchased from using MTT detection kit
Promega company) cytotoxicity to several plants of tumour cells such as MCF7, A549, HCT116, HepG2 is detected respectively.Experiment side
Method: by tumor cell line, subculture, collection logarithmic growth phase cell are inoculated in containing 10% fetal calf serum according to a conventional method
In the culture medium of DMEM, adherent growth for 24 hours after, be separately added into the XZZ-5-DC-CIK cell and DC-CIK cell of various concentration,
Handle above-mentioned cell 48 hours, each hole sets three multiple holes, and the normal saline solution for setting respective concentration does control and cell tune
Zero hole is operated according to Promega company kit specification, measures XZZ-5-DC-CIK cell to above-mentioned tumour cell
IC50 value.The result shows that the DC-CIK cell induced through XZZ-5, enhances the toxicity of tumour cell, as shown in Figure 3.
Embodiment 9
The XZZ-5-DC-CIK cell of polypeptide XZZ-5 induction and the DC-CIK cell routinely induced are to colon cancer C26 nude mice
The tumor killing effect of transplantable tumor
Experimental animal: BALB/C mice is purchased from Shanghai Si Laike experimental animal responsibility Co., Ltd；Colon cancer C26 tumor is thin
Born of the same parents' suspension is originated from institute of Materia Medica,Chinese Academy of Medical Sciences.
Experimental method: healthy BALB/C mice is chosen, armpit inoculates tumor cell suspension 0.2ml on the right side of it, periodically
Situations such as observing mouse spirit, diet and defecation.Laid one's hand on to right side of mice oxter and lump, at the same occur diet, amount of drinking water decline,
When the symptoms such as weight loss, scared withered and activity reduction, indicate that cachexia model has been established.
Grouping administration: modeling success mouse is randomly divided into 3 groups, every group 10: XZZ-5-DC- according to table of random number
CIK cell treatment group；DC-CIK cell therapy group；Blank control group.Drug concentration is as follows: daily intraperitoneal injection induces 7 days
XZZ-5-DC-CIK cell and DC-CIK cell, continuous injection 5 days, every mouse per injection 1 × 106A/0.5ml；Blank
Control group injecting normal saline 0.5ml.
Experiment process and interpretation of result: after being administered terminate 5 days for the last time, tumor mass is taken out, knurl weight is measured, finally calculates
Average tumour inhibiting rate.The result shows that XZZ-5-DC-CIK cell therapy group tumour inhibiting rate is improved, as shown in Figure 4.
Claims (2)
1. a kind of polypeptide XZZ-5 induces the method for preparing CIK/DC-CIK cell, the specific steps are as follows:
1) peripheral blood acquires: aseptic aspiration tumor disease peripheral blood in patients 75ml, and liver receives plain anticoagulant and mixes well；
2) tumour antigen obtains: under room temperature, centrifugation of peripheral blood, 1000rpm, 10min；10ml upper plasma is then collected,
The blood plasma of collection is added into XZZ-5CIK/DC-CIK induced medium, gained cell precipitation is for separating mononuclearcell；
3) mononuclearcell separates: gained cell precipitation adds to 50ml with physiological saline and washs, and 1000rpm is centrifuged 10min；In abandoning
Clearly, it washs again；Lymphocyte separation medium surface is gently added to, 1300rpm is centrifuged 20min；Leaching is collected with the pipette of sterilizing
Bar cell separating liquid cells of superficial layer, moves in 50ml disposable plastic centrifuge tube, and physiological saline is added to 50ml, mixes；Again
Centrifuge washing；
4) XZZ-5-CIK or XZZ-5-DC-CIK cell culture: abandoning supernatant after centrifugation, precipitating is trained with the induction of the XZZ-5 containing polypeptide
It is outstanding to support base weight, and is counted with diluted, respectively into 4 disposable Tissue Culture Flasks of 75cm, is put into 30 DEG C, 5%
CO2It is cultivated in the incubator of v/v saturated humidity, liquid and amplification is changed according to cell growth status in due course during culture, until cell
Number reaches needed for feedback；
The amino acid sequence of the polypeptide XZZ-5 is as shown in SEQ ID No:2.
2. according to the method described in claim 1, wherein in induced medium described in step 2), polypeptide XZZ-5 concentration is
0.1ug/ml~1mg/ml.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510724586.0A CN105254744B (en) | 2015-10-29 | 2015-10-29 | The heterogenous expression of polypeptide XZZ-5 and its enhancing CIK cell kill the application in tumor activity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510724586.0A CN105254744B (en) | 2015-10-29 | 2015-10-29 | The heterogenous expression of polypeptide XZZ-5 and its enhancing CIK cell kill the application in tumor activity |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105254744A CN105254744A (en) | 2016-01-20 |
| CN105254744B true CN105254744B (en) | 2019-01-01 |
Family
ID=55094721
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510724586.0A Active CN105254744B (en) | 2015-10-29 | 2015-10-29 | The heterogenous expression of polypeptide XZZ-5 and its enhancing CIK cell kill the application in tumor activity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105254744B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106244540A (en) * | 2016-09-13 | 2016-12-21 | 青海七彩花生物科技有限公司 | A kind of cell culture processes improving the CIK cell rate of increase and lethality |
| CN106801036B (en) * | 2017-03-04 | 2019-01-08 | 青岛瑞思德生物科技有限公司 | A kind of biologically active peptide and the method with its external efficient amplification CIK cell |
| CN110078812A (en) * | 2018-01-25 | 2019-08-02 | 中国医学科学院医药生物技术研究所 | The heterogenous expression of polypeptide IMB-M2 and its enhancing NK cell kill the application in tumor activity |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103497253A (en) * | 2013-09-26 | 2014-01-08 | 东南大学 | Nanometer antibody, encoding sequence and application of H2A.Z variant |
| CN104328166A (en) * | 2014-08-13 | 2015-02-04 | 曹劲松 | Cytokine-induced killer cell activity-associated protein and application thereof |
| CN104357394A (en) * | 2014-10-24 | 2015-02-18 | 杭州阿德莱诺泰制药技术有限公司 | Culture method of autologous peripheral blood lymphocyte DC-CIK (Dendritic Cell- Cytokine-induced Killer) |
| CN104491853A (en) * | 2014-12-29 | 2015-04-08 | 深圳市赛欧细胞生物科技有限公司 | Preparation method of human dendritic cell tumour vaccine |
| CN104994875A (en) * | 2013-02-15 | 2015-10-21 | 免疫医疗公司 | Chimeric and humanized anti-histone antibodies |
-
2015
- 2015-10-29 CN CN201510724586.0A patent/CN105254744B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104994875A (en) * | 2013-02-15 | 2015-10-21 | 免疫医疗公司 | Chimeric and humanized anti-histone antibodies |
| CN103497253A (en) * | 2013-09-26 | 2014-01-08 | 东南大学 | Nanometer antibody, encoding sequence and application of H2A.Z variant |
| CN104328166A (en) * | 2014-08-13 | 2015-02-04 | 曹劲松 | Cytokine-induced killer cell activity-associated protein and application thereof |
| CN104357394A (en) * | 2014-10-24 | 2015-02-18 | 杭州阿德莱诺泰制药技术有限公司 | Culture method of autologous peripheral blood lymphocyte DC-CIK (Dendritic Cell- Cytokine-induced Killer) |
| CN104491853A (en) * | 2014-12-29 | 2015-04-08 | 深圳市赛欧细胞生物科技有限公司 | Preparation method of human dendritic cell tumour vaccine |
Non-Patent Citations (3)
| Title |
|---|
| ACCESSION：NP_003508，histone H2A type 2-C [Homo sapiens];Sadakierska-Chudy A et al.;《Genbank》;20150812;Features和Origin * |
| Expression and functionality of histone H2A variants in cancer;Fátima Liliana Monteiro et al.;《Oncotarget》;20140526;第5卷(第11期);3428-3443 * |
| 组蛋白去乙酰化酶抑制剂在胰腺癌细胞免疫治疗中的意义;胡鹏等;《第三军医大学学报》;20141215;第36卷(第23期);2389-2394 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105254744A (en) | 2016-01-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105008521B (en) | The method for adjusting the immunoregulation effect of stem cell | |
| CN103232973B (en) | A kind of K562 cell amplification activates the method for NK cell | |
| Clark | Skin-resident T cells: the ups and downs of on site immunity | |
| CN101918544B (en) | Method for increasing immunoreactivity | |
| KR20090127973A (en) | A method for cultivating self activated lymphocyte | |
| CN105254744B (en) | The heterogenous expression of polypeptide XZZ-5 and its enhancing CIK cell kill the application in tumor activity | |
| CN102827808B (en) | Method for preparing cytokine-induced killer cells | |
| CN105886469B (en) | CIK cell and its cultural method and application | |
| CN107557337A (en) | A kind of immunocyte of safety-type Chimeric antigen receptor modifications of anti-ROR1 and its application | |
| CN110016465A (en) | A kind of immunocyte drug comprising B cell and the double identity T cells of tumour | |
| KR20100083838A (en) | Pharmaceutical composition and method for production of pharmaceutical composition | |
| CN105018427A (en) | Culture method of DC cell for enhancing CTL immune response | |
| CN111733129A (en) | Method for efficient DC-CIK (dendritic cell-cytokine induced killer) cells induced by polyinosinic cells | |
| CN103243072B (en) | The method of CD8 α-interleukin-22 1 fragment-CD137 mixture amplification activated lymphocyte | |
| CN102212505A (en) | Immune killer cell, preparation method thereof, medicinal composition containing immune killer cell and set | |
| CN105132372B (en) | A kind of application of the compound in tumour cell immunization therapy inducing DC-CIK cell | |
| CN105238755A (en) | Gingseng extract product FQR1 and application thereof in tumour immunotherapy | |
| CN103710308B (en) | Muramyl dipeptide is utilized to induce the method for DC-CIK | |
| CN101701218A (en) | Immune regulatory oligodeoxynucleotide for inhibiting differentiation of Th1 and Th17 and application thereof | |
| JP5301994B2 (en) | Method for proliferating LAK cells | |
| CN111733154B (en) | Magnetic field treated immune cells and uses thereof | |
| CN111072763A (en) | Tumor-associated gene GNAS mutation-associated antigen short peptide and application thereof | |
| CN106119192B (en) | Composition and its application in CIK cell culture | |
| CN106138098B (en) | Application of natural killer cell combined with antidepressant in improvement of depression symptoms | |
| CN111171136A (en) | tumor-associated gene PDGFR α mutation-associated antigen short peptide and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |