CN105238787A - Application of anther epidermal layer specific promoter induced by drought - Google Patents

Abstract

The invention belongs to the technical field of molecular biology and genetic engineering, and particularly relates to an anther epidermal layer specific promoter pOsDIL induced by a drought. The promoter is a section of DNA sequence which has the size about 562bp and is cloned from the upstream of initiation codon of a rice OsDIL gene, and the nucleotide sequence of the promoter is shown as SEQ ID NO.1. The invention further discloses an engineering carrier which is established by means of the promoter and used for transgene, application of the promoter serving as the anther epidermal layer specific promoter in the genetic engineering and application of the promoter serving as a drought induced promoter in early anther of stamen development. The invention provides the promoter which is expressed in anther epidermal layer driving genes and enables the activity to be increased under drought stress, and a tool achieving directional expression of genes is provided for genetic engineering breeding of rice or other food crops.

Description

A kind of application by drought-induced flower pesticide epidermal area specificity promoter

Technical field

The invention belongs to molecular biology and gene engineering technology field, be specifically related to a paddy rice lipid transfer proteins osDILthe clone of gene promoter and activation analysis, the activity due to this promotor has very strong tissue specificity and drought stress induced activity, can be applicable in transgenic plant genetic engineering technology.

Background technology

Paddy rice is one of global most important food crop, is again the model animals in plant research field simultaneously.China's population more than 2/3 take paddy rice as staple food grain, and the Ministry of Agriculture clear and definite transgenic technology is the gordian technique of the resistance of following transformation food crop and quality, increase food crop output, and therefore genetic engineering technique will obtain larger development in China.The output of food crop realizes eventually through the process of blossoming and bearing fruit, the reproductive development process of crop under adverse circumstance is improved by genetic engineering means, particularly improve male or female fertility under adverse circumstance, have extremely important and direct meaning for the output improving crop.By promoters driven, gene right place in male gynoecium of some male megagamete maintenance fertility under being conducive to adverse circumstance is expressed, and for the resistance transforming crop accurately, improves output and has huge application prospect.The precondition realizing this technology is, excavate a collection of controlling element having activity specific in flower pesticide or gynoecium, namely expression characteristic has tissue-specific promotor, as candidate's element of transgenic engineering vector construction.At present, composition promotor, by external source or endogenous molecule induction promotor discovery and apply more, all may there is ectopic expression in the gene of these promoters driven, namely express in non-target tissues.Research find, the ectopic expression of gene may have an impact to growing of plant, therefore research and cloned tissue specificity promoter extremely important.Tissue-specific promoter, only drives genetic expression in some particular organization, has broad application prospects in genetic engineering technique.

Flower pesticide is the male reproductive organ of plant, relates to pollen mother cell generation, the growth of sporule and the maturation of pollen granule and loose powder process.From structure, mainly comprise the sporule in the middle of anther wall and flower pesticide.Pollen wall is made up of epidermis, endothecium, middle level and tapetum, and every one layer of cells is all respective or collaborative has played important function, to guarantee the normal development of sporule.Current more research concentrates on tapetum and sporule developmentally, the technology such as application in situ hybridization, investigators have found the gene of a collection of tapetum and sporule specifically expressing, but then report seldom at the gene that other cellular layer of flower pesticide is expressed, therefore need more research and excavate the special controlling element of each confluent monolayer cells of flower pesticide, and understand the cis-acting factors that environment to external world has response in depth, to reach the object of the spatial and temporal expression of accurately regulatory gene.

Lipid transfer protein (lipidtransferproteins, LTPs) is the protein that a class can transport lipid and lipid derivant in vitro, and its function may be relevant to the process such as degeneration-resistant, reproductive development, signal transmission.This proteinoid often has signal peptide structure, can be secreted into outside cytolemma.Relate in the present invention osDILgene belongs to the member in lipid transfer protein gene family, and our early-stage Study finds that this gene of process LAN can strengthen the drought-resistant ability of paddy rice in paddy rice, improves output.In the present invention, we have been separated the promotor of this gene, find that it has the tissue specificity of height, reporter gene can be driven specific expressed in pollen outer wall, and other position is not expressed, under drought stress, the activity of this promotor in flower pesticide can strengthen.The specific cells layer tool activated feature of this promotor in flower pesticide makes it may have very large application prospect on genetic engineering breeding.

Summary of the invention

The object of the present invention is to provide a kind of by drought-induced flower pesticide epidermal area specificity promoter and application thereof.

Provided by the invention by drought-induced flower pesticide epidermal area specificity promoter, from paddy rice osDILthe DNA sequence dna of one section of about 562bp size that gene (Os10g0148000) upstream from start codon is cloned into, its nucleotides sequence is classified as shown in SEQIDNO.1, is designated as pOsDIL.

The present invention have studied the function of this promotor: this promoter sequence is building up to PCAMBIA1300 expression vector, drives reporter gene by it β-the expression of glycuronidase (GUS), then being proceeded in paddy rice by transgenic approach by this recombinant vectors spends in 11, GUS tissue staining result shows, this promotor can drive foreign gene specific expressed in flower pesticide, find further combined with after semithin section microscopic examination, reporter gene is mainly expressed in the flower pesticide epidermal area of stamen development middle and later periods.Analyze for flower development different times drought stress quantitative expression data, find that this promotor can be induced by drought stress in flower pesticide, GUS coloration result has also confirmed this point.

The present invention also comprises, utilize SEQIDNO.1 sequential build for genetically modified engineered vector.

The present invention also comprises, and utilizes SEQIDNO.1 order as the application of flower pesticide epidermal area specificity promoter in genetically engineered, expresses specifically in the pollen outer wall that namely this promotor can drive goal gene to start in stamen development 10 phase.

Specifically, this promotor is structured in containing reporter gene gUS( β-glucuronidase, encodes glucose aldehydic acid enzyme) carrier in (Fig. 1), obtained the transgenic positive plant of this carrier by agriculture bacillus mediated Transgenic Rice technology.The each tissue detection GUS of water intaking rice is active, finds what it drove gUSreporter gene is only grown at Rice Panicle in the flower pesticide of middle and later periods and is expressed, and does not express (Fig. 2) in other tissue.

Apply the activity that half thin resin slicer observes GUS in flower pesticide, only show in the epidermal area of flower pesticide as seen blue (Fig. 3), illustrate that GUS only expresses in flower pesticide epidermal area.Utilize pOsDILgoal gene is driven to be expressed in feature in flower pesticide epidermal area specifically, can be by pOsDILinitiator sequence is cloned into engineering carrier, utilizes it to drive the specific gene in downstream to express in flower pesticide epidermal area.

The present invention also provides the application utilizing SEQIDNO.1 order as drought-inducible promoter in the early stage flower pesticide of stamen development, namely utilizes this promoters driven goal gene to shift to an earlier date and Enhanced expressing in the flower pesticide under drought stress conditions.

Utilize quantitative PCR detection osDILgene finds at the different times expression level of paddy rice flower development, and the expression level of this gene has considerable change, expresses very low before the 10th phase, and it is the highest that 10 phases and 11 phases express arrival; Arid makes before the expression of this gene advances to reduction division, just have obvious expression (Fig. 4) before the 8th phase.

Osmotic treatment is carried out for the transgenic paddy rice being in different development stage, the GUS detected in flower pesticide in corresponding period is active, result shows, relative to the flower pesticide of the paddy rice be grown under normal condition, under drought stress, in flower pesticide, GUS is active obviously strengthens, and the time advance (Fig. 5) that blue signal occurs, illustrate that this promotor is the promotor of a drought stress response, can be used in and spend under improving drought stress in the genetically engineered experiment of fertility.

Present invention comprises the clone of promoter sequence, activation analysis that the structure of plant transgene carrier, promotor drive genetic expression in different tissues, and this promotor is to the response analysis of drought stress.This promotor belongs to a kind of tissue-specific promoter, and response drought stress, therefore in technical field of plant transgene and paddy rice drought resisting in generative phase research field, there is important value.

Accompanying drawing explanation

Fig. 1 osDILthe vector construction schematic diagram of gene promoter.

Fig. 2 turns pOsDIL::GUSgUS activation analysis in plant different tissues.Bar=1mm。

Resin slicer result after Fig. 3 is in the flower pesticide GUS active coloring of flower development the 12nd phase shows, pOsDILactivity is mainly present in flower pesticide epidermal area.

Under Fig. 4 normal growth and Osmotic treatment condition different development stage spend in osDILexpression level compares.

The flower pesticide GUS expression activitiy of flower development different times under Fig. 5 normal growth and Osmotic treatment condition.bar=0.4mm。

Embodiment

The present invention is illustrated further below in conjunction with specific embodiment.These embodiments should be understood only be not used in for illustration of the present invention and limit the scope of the invention.The experimental technique of unreceipted actual conditions usually conveniently condition in embodiment below, i.e. in " molecular cloning " laboratory manual of the work such as Sambrook the condition that describes, or according to the condition that manufacturer advises.

embodiment 1, transgene carrier builds

Extract oryza sativa genomic dna, increased by round pcr pOsDILpromotor, primer sites used is as shown in underscore order in SEQIDNO.1, and upstream primer introduces HindIII restriction enzyme site, and BamHI restriction enzyme site is introduced in downstream.By amplification to product be connected into PCR-Blunt intermediate carrier, check order errorless after be connected in the whole carrier pCAMBIA1300 of transformed transgenosis, transformation Agrobacterium EHA105, confirms the existence of promoter fragment in positive colony by bacterium colony PCR.

embodiment 2, Rice Cropping and Osmotic treatment

With in spend 11 for background transgenosis, obtain transgenic positive strain, T1 plants in glasshouse for plant.Osmotic treatment mode: wild-type and transfer-gen plant paddy rice grow to the different reproductive development phase under normal operation, cut off the water supply, and are down to after 15-20% until soil relative water content, keeps one week, and sampling is respectively used to expression analysis and the GUS dyeing of gene.

embodiment 3, qRT-PCR detects

Get the paddy rice sample being in flower development different times, the reagent provided by RNA extraction test kit and method (RNAisoplus, TaKaRa) extract RNA, carry out reverse transcription (PrimeScriptRTregentKitWithgDNAEraser, TaKaRa).Quantitative analysis primer sequence is as shown in SEQIDNO.2 and SEQIDNO.3.PCR reaction system:

2XSRBRPremixExTaq5μl

Primer-F0.25μl

Primer-R0.25μl

RT reaction solution 2 μ l

ddH ₂O2.5μl

PCR response procedures:

(1) 95 DEG C of denaturation 30s;

(2) 95 DEG C of sex change 5s, 60 DEG C of annealing extend 30s, circulate 40 times;

embodiment 4, rice transformation

A. evoked callus

Choose the seed of mature and plump, remove interior coetonium, with 70% alcohol immersion 2min, then in containing the chlorine bleach liquor of 2% available chlorine, soak 30min, with sterilizing washing 7-8 time, thieving paper dries up, is placed on N6D substratum, 28 DEG C, 16h light is cultivated about 30 days, gets the callus subculture that is scattered 10 days.

B. the cultivation of Agrobacterium EHA105

The Agrobacterium bacterium liquid containing correct plasmid obtained in testing last point is coated on the anti-flat board of YEB tri-(Streptomycin sulphate, Rifampin and kalamycin resistance), 28 DEG C of light culture about 36 hours, collect bacterium colony in liquid Dual culture base, regulate its OD to be about 0.2.

C. infect and Dual culture

Collect the callus of subculture in ready Dual culture bacterium liquid, leave standstill 30min.Outwell bacterium liquid, callus blots on thieving paper, is connected on Dual culture substratum, 20 DEG C of light culture 2-3 days.

D. screen

Callus be transferred in screening culture medium (N6D+50mg/L hygromycin B+250mg/L cephamycin), 28 DEG C of light are cultivated.Within every 15 ~ 20 days, can change a subculture, screening time must not be less than 45 days.

E. break up

Be transferred to division culture medium (MS+2mg/L6-BA+0.2mg/LNAA+2mg/LKT+0.2mg/LIAA+50mg/L Totomycin+250mg/L cephamycin) by through the new longer callus of screening, 28 DEG C 16 little time cultivates.Before carrying out differentiation culture, can first by callus light culture several days using as pre-differentiation.Periodic replacement substratum.

F. take root

By differentiation transgenic seedling (>1cm is high) out, divest unnecessary callus, and cut off root (staying about 0.5cm), move in 1/2MS substratum and take root.28 DEG C of light cultivate 16 hours.

G. hardening and transplanting

Take root after terminating, after can root media being removed, seedling is steeped a few days in water and carry out hardening, then transplant middle growth of burying.

embodiment 5, GUS tissue staining

Get the different tissues of T1 for positive transgenic paddy rice, be dipped in GUS dye liquor [0.2mol/LNa ₂hPO ₄/ NaH ₂pO ₄, 0.1mol/LK ₃fe (CN) ₆/ K ₄fe (CN) ₆, 0.1%X-Gluc, 0.1%TritonX-100] in, in 37 DEG C of dyeing 6 hours after bleeding, dehydrated alcohol desolventing technology two days, period changes liquid for several times, finally preserves by 70% alcohol immersion.Observe under stereoscopic microscope (LeicaS8APO) and take pictures.

semithin section after embodiment 6, GUS tissue staining and microscopic examination

The fixing 24h of flower pesticide FAA stationary liquid (dehydrated alcohol: Glacial acetic acid: formaldehyde: water=10:1:2:7) after GUS is dyeed, ethanol dehydration (70%, 85%, 95% each 30min, 100%2h, 100%2h).Embed by resin embedding agent Technovit7100 specification sheets (HeraeusKulzer), LeicaRM2265 (LeicaMicrosystems) type half-thickness microtome is cut into slices, slice thickness 5um, examines under a microscope after film-making and takes pictures.

sequence table

SEQIDNO.1

(i) sequence signature: long 562bp, linear kernel thuja acid

(ii) molecule type: nucleic acid

(iii) adding black ATG is osDILgene start codon, the primer sites of underscore used by this sequence of clone

1 cgttggacgaaaacctggtcaaaaggagccacgtaggcaccacctcagcc50

51aaaaccgaagacagtaccgccgaaggaccttatttaaacggttttgttaa100

101gttgggggacccatcgtacccggttttgcgaccggggacgaaaatcggac150

151taggtgataaatagagggacccaaagtgaacttataccaatgcaatttca200

201tatcaaacagtcacggatgggctttaggaaagcagaactgggcccggccc250

251agtagatcacatagcccaacaagatctaaaccgcatgctctcgtttcaac300

301aaattatcacaccgattgcatttgcatctgctgcacaggctaaatcaaac350

351acgtagccatgaaccattcacctcacaagtcacaagcattgcatttctat400

401ggttaccagtgcaggacgaaatgctcaactagcccaagcaagaatggagc450

451atgacaacctcaggcaccaaaagctctataaatatttgcattgcacaaat500

501caaaagtttccaagttttaatcagagaagttcaagatatca gaaagaaca550

551 acacataccagg atg

SEQIDNO.2

Upstream primer Primer-F:TCCATGAAGGGCGTCAAC;

SEQIDNO.3

Downstream primer Primer-R:CACACTGCTTGGTGACATAGA.

<110> Fudan University

<120> mono-kind is by the application of drought-induced flower pesticide epidermal area specificity promoter

<130>001

<160>3

<170>PatentInversion3.3

<210>1

<211>565

<212>DNA

<213>

<400>1

cgttggacgaaaacctggtcaaaaggagccacgtaggcaccacctcagccaaaaccgaag60

acagtaccgccgaaggaccttatttaaacggttttgttaagttgggggacccatcgtacc120

cggttttgcgaccggggacgaaaatcggactaggtgataaatagagggacccaaagtgaa180

cttataccaatgcaatttcatatcaaacagtcacggatgggctttaggaaagcagaactg240

ggcccggcccagtagatcacatagcccaacaagatctaaaccgcatgctctcgtttcaac300

aaattatcacaccgattgcatttgcatctgctgcacaggctaaatcaaacacgtagccat360

gaaccattcacctcacaagtcacaagcattgcatttctatggttaccagtgcaggacgaa420

atgctcaactagcccaagcaagaatggagcatgacaacctcaggcaccaaaagctctata480

aatatttgcattgcacaaatcaaaagtttccaagttttaatcagagaagttcaagatatc540

agaaagaacaacacataccaggatg565

<210>2

<211>18

<212>DNA

<213>

<400>2

tccatgaagggcgtcaac18

<210>3

<211>21

<212>DNA

<213>

<400>3

cacactgcttggtgacataga21

Claims (4)

1., by a drought-induced flower pesticide epidermal area specificity promoter, it is characterized in that for from paddy rice osDILthe DNA sequence dna of one section of about 562bp size that gene start codon upstream is cloned into, its nucleotide sequence is as shown in SEQIDNO.1.

2. utilize SEQIDNO.1 sequential build for genetically modified engineered vector.

3. utilize SEQIDNO.1 order as the application of flower pesticide epidermal area specificity promoter in genetically engineered, express specifically in the flower pesticide epidermal area that this promotor can drive goal gene to start in stamen development 10 phase.

4. utilize SEQIDNO.1 order as the application of drought-inducible promoter in the early stage flower pesticide of stamen development, this promotor can drive in the early stage flower pesticide of goal gene under drought stress conditions and express.