CN105238784A - Long non-coding RNA and application thereof in regulating and controlling proliferation and differentiation of neural stem cells - Google Patents
Long non-coding RNA and application thereof in regulating and controlling proliferation and differentiation of neural stem cells Download PDFInfo
- Publication number
- CN105238784A CN105238784A CN201510673123.6A CN201510673123A CN105238784A CN 105238784 A CN105238784 A CN 105238784A CN 201510673123 A CN201510673123 A CN 201510673123A CN 105238784 A CN105238784 A CN 105238784A
- Authority
- CN
- China
- Prior art keywords
- sox2ot
- neural stem
- coding rna
- long non
- stem cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the fields of physiological medicine and biological medicine, and relates to long non-coding RNA and application thereof in regulating and controlling proliferation and differentiation of neural stem cells. From a technical perspective, the invention discovers long non-coding RNASox2ot for regulating and controlling development of neural stem cells and confirms the effect of the long non-coding RNASox2ot on promoting the generation of neurons for the first time. The discovery is beneficial for people to directly change the expression of the long non-coding RNASox2ot in level in vivo, so that the development of the neural stem cells is affected; from a clinical perspective, exploration of the effect of the non-coding RNASox2ot in the neural stem cells is helpful for people to further develop clinical diagnosis reagents which are used for detecting genes having influence on the early development of brain so as to prevent the occurrence of microcephaly; and furthermore, since the non-coding RNA can be easily synthesized in vitro and the expression level of the non-coding RNA is intervened, people can directly regulate and control the proliferation and the differentiation of the neural stem cells by virtue of the non-coding RNA; therefore, a novel therapeutic method and a novel technical means are provided for the clinical development and application of the neural stem cells for treating human nervous system diseases.
Description
Technical field
The invention belongs to physiology and biomedical sector, relate to a kind of long non-coding RNA and as regulation and control cell proliferation of nerve cord and differentiation in application.
Background technology
The normal development of the mankind and Cerebral Cortex, depends on the accurate propagation of neural stem cell (neuralstemcell, NSC) and neural progenitor cell (neuralprogenitor), differentiation, and neuronic generation.The accurate molecular regulation of this process need.The propagation of neural stem cell, break up the normal development of brain most important, sad relevant to the function of brain.H and E factor can cause transgenation, causes brain development deformity.Such as, polymicrogyria disease (polymicrogyria) is caused by many little gyrus (gyri).Patient generally has epilepsy, amentia and dyskinesia.With the sudden change of neural progenitor cell split coil method correlation gene, the such as sudden change of orphanGprotein-coupledreceptor56 (GPCR56), is proved to be relevant with polymicrogyria disease.And for example, the notable feature of cerebellum disease (microcephaly) is that infant brain size obviously reduces.Patient is generally of short and small stature, has amentia and aphasis.It is the major cause causing cerebellum disease that the gene of control neural stem cell, progenitor cells amplification is undergone mutation.The such as sudden change of ASPM (abnormalspindleprotein-like, microcephalyassociated) is detected.As can be seen here, the molecular mechanism of explaination neural stem cell, progenitor cell proliferation, survival, differentiation, will contribute to disclosing corticocerebral normal development mechanism, and seek the cause of disease of brain development deformity.
So what molecular mechanism may regulate and control neural stem cell, progenitor cell increment and differentiation which? for a long time, the research object of people is protein coding gene (proteincodinggenes) always.Newest research results display in recent years, non-coding RNAs (noncodingRNAs) plays a part very important equally, especially long non-coding RNA (longnoncodingRNA, lncRNA).The general length of long non-coding RNA is greater than 200 Nucleotide, and the expression of protein coding gene is not obviously distinguished, and does not just have the ability of synthetic protein.Current research display, long non-coding RNA can in nucleus and tenuigenin functionating, at special cells, participate in the transcriptional control of gene.But people are to the mechanism of action of long non-coding RNA, still unclear.
Summary of the invention
For defect of the prior art, the object of this invention is to provide a kind of long non-coding RNA and as regulation and control cell proliferation of nerve cord and differentiation in application.The molecular mechanism of research Neural Differentiation, can become specific neurone by inducing differentiation of neural stem cells, be used for the treatment of nervous system disorders.We have screened the long non-coding RNA of expressing in Neural Stem Cells From Embryonic Mice: Sox2ot (Sox2overlappingtranscript).We Late Cambrian Sox2ot promotes the differentiation of neural stem cell, produces more multi-neuron.The application finds, long non-coding RNA plays a significant role to neural stem cell increment and differentiation.We find that long non-coding RNA is expressed in neural stem cell.When process LAN long non-coding RNA, neural stem cell, neural progenitor cell can be caused to rise in value and to reduce, cause neural stem cell differentiating, produce more multi-neuron.These researchs show, the same with protein coding gene, and long non-coding RNA plays an important role in nerve occurs, and may be used for inducing neural differentiation.Therefore, Sox2ot can as the new tool of inducing neural differentiation.
The object of the invention is to be achieved through the following technical solutions:
First aspect, the invention provides a kind of long non-coding RNA Sox2ot, its genome sequence is as shown in SEQIDNo.2.
The Sox2 gene order of described long non-coding RNA Sox2ot in mouse genome and shown in SEQIDNo.1 is overlapping: Sox2 gene is the gene of high expression level in embryonic stem cell, neural stem cell.Sox2 can promote stem cell proliferation, keeps stem cell to be in splitting status.Meaningfully, long non-coding RNA Sox2ot and Sox2 expresses higher (Fig. 1) at mice embryonic pallium.In addition, long non-coding RNA Sox2ot is overlapping with Sox2 in genome, and transcribes (Fig. 2) by same direction.This illustrates that Sox2ot probably regulates and controls the expression of Sox2, and participates in the regulation and control of stem cell proliferation and differentiation.
Second aspect, the invention provides a kind of described long non-coding RNA Sox2ot in the developmental application of regulation and control neural stem cell.
The third aspect, the invention provides a kind of method regulating and controlling neural stem cell growth with described long non-coding RNA Sox2ot, described method comprises: the method for in situ hybridization (insituhybridization) is in order to verify the position that Sox2ot expresses in pallium and cell.
For determining that whether the same with Sox2 also the growth neural stem cell of Sox2ot is worked, we adopt the method for in situ hybridization to have detected the expression status of Sox2ot and Sox2 in mice embryonic 13.5 and 15.5 days brains.We find that Sox2 is expressed in concentrated cortex ventricles of the brain district (ventricularzone, VZ) (Fig. 3) of neural stem cell.Similar with Sox2, Sox2ot also expresses in cortex ventricles of the brain district.Our result shows that Sox2ot and Sox2 may have close function, and same regulation and control neural stem cell is grown.
Fourth aspect, the invention provides the application of a kind of described long non-coding RNA Sox2ot in induced nerve stem cells differentiation.
5th aspect, the invention provides a kind of method with described long non-coding RNA Sox2ot induced nerve stem cells differentiation, described method comprises: the method that mice embryonic electricity turns.Namely at the intracerebral ventricle injection DNA of embryonic-period mice, by the method for electric shock, Sox2ot foreign DNA is expressed in corticocerebral neural stem cell.
We explore the function of Sox2ot in brain development further.By the method that mice embryonic electricity turns, we are process LAN Sox2ot in embryo's 13.5 days pallium, then observes the growth of neural stem cell in embryo's 14.5 days pallium.We find, when being in neural stem cell, the neural progenitor cell of splitting status with BrdU mark, in the Cerebral Cortex of process LAN Sox2ot, BrdU positive cell number obviously reduces.Further, the neural stem cell number of Sox2 mark, also obviously reduces (Fig. 4) because of process LAN Sox2ot.Our result shows: contrary with the effect of Sox2, and the function of Sox2ot is that promotion is neural stem cell differentiating.
6th aspect, the invention provides the application of a kind of described long non-coding RNA Sox2ot in promoting neurone to generate.
7th aspect, the invention provides a kind of described long non-coding RNA Sox2ot and promote the method that neurone generates, described method comprises: the method that mice embryonic electricity turns.Namely at the intracerebral ventricle injection DNA of embryonic-period mice, by the method for electric shock, Sox2ot foreign DNA is expressed in corticocerebral neural stem cell.Afterwards, neural stem cell is allowed to continue growth in vivo 4 days, the generation of labeled neurons.
By the method that mice embryonic electricity turns, we are process LAN Sox2ot in embryo's 13.5 days pallium, then detects neuronic generation (Fig. 5 A) in embryo's 17.5 days pallium.We find, the newborn neuron quantity of Tbr1 and Satb2 mark all significantly raises (Fig. 5).Our result shows: the function of Sox2ot promotes that neurone generates.
Eighth aspect, the invention provides a kind of described long non-coding RNA Sox2ot affects the reagent for clinical diagnosis of brain early development gene to prevent the application in the generation of cerebellum disease in exploitation detection.
This patent will have realistic meaning to fundamental research and further clinical application.The cause of disease of mankind's cerebellum disease is the minimizing due to cerebral nerve stem cell, neural progenitor cell number, the reduction that newborn neuron generates.Induced nerve stem cells increases, and promotes that neurone generates the effective means that will be treatment cerebellum disease.Compared with prior art, the present invention has following beneficial effect:
From technological layer, the application has found the long non-coding RNA Sox2ot that neural stem cell is grown, and to confirm its promoter action in neurone generates first.These find to contribute to we directly to change long non-coding RNA Sox2ot expression from level in body, with the development of stem cells that affects the nerves.From Point of View of Clinical, by exploring the effect of non-coding RNA Sox2ot in neural stem cell, contributing to us and developing the reagent for clinical diagnosis detecting and affect the gene of brain early development further, occurring to prevent cerebellum disease.Further, because non-coding RNA is easy to the expression level synthesizing and intervene it in vitro, we directly can utilize propagation and the differentiation of genetic regulation by non-coding RNAs neural stem cell.This will be the treatment of Application and Development neural stem cell clinically human neurologic disease, provide new therapy and technique means.
Accompanying drawing explanation
By reading the detailed description done non-limiting example with reference to the following drawings, other features, objects and advantages of the present invention will become more obvious:
Fig. 1, Sox2 and long non-coding RNA Sox2ot expression amount in embryonic-period mice pallium is higher.
Fig. 2, long non-coding RNA Sox2ot in mouse genome and Sox2 overlapping, and transcriptional orientation is consistent;
Fig. 3, in situ hybridization result show, Sox2 and Sox2ot expresses in mice embryonic 13.5 and 15.5 days pallium ventricles of the brain districts, the region that neural stem cell is concentrated;
Fig. 4, in Cerebral Cortex process LAN Sox2ot (Sox2ot-OE), induced nerve stem cells breaks up, the minimizing of the cell count that causes BrdU and Sox2 mark;
Fig. 5, in Cerebral Cortex process LAN Sox2ot (Sox2ot-OE), the cell count causing Tbr1 and Satb2 to mark raise, Induction of neuronal generate.
Embodiment
Below in conjunction with specific embodiment, the present invention is described in detail.Following examples will contribute to those skilled in the art and understand the present invention further, but not limit the present invention in any form.It should be pointed out that to those skilled in the art, without departing from the inventive concept of the premise, some distortion and improvement can also be made.These all belong to protection scope of the present invention.
embodiment 1
The Sox2 gene order of long non-coding RNA Sox2ot described in the application in mouse genome and shown in SEQIDNo.1 is overlapping: first, we are by dissecting, have collected 12.5 days BL6 mice embryonic phases, 15.5 days, and the brain cortical tissue [1] of being born latter 0 day and growing up.We are extracted RNA to utilize Trizol, have carried out RNA reverse transcription PCR and have analyzed (RT-PCR) [1].We devise the PCR primer of amplification Sox2ot and Sox2 gene.Their sequence is as follows:
Sox2ot：F:5’-TGCTACAAGACAACACCCTGA-3’(SEQIDNo.3)，
R:5’-GTTGCCTGGCTTCTCTTTTG-3’(SEQIDNo.4)；
Sox2：F:5’-TACAGCATGTCCTACTCGCA-3’(SEQIDNo.5)，
R:5’-TGGAGTGGGAGGAAGAGGTA-3’(SEQIDNo.6)。
By the expression level of RNA reverse transcription PCR analyses and comparison Sox2ot and Sox2 at different development stage, we detect transcription factor Sox2 and non-coding RNA Sox2ot 12.5 days mice embryonic phases and 15.5 brain cortical tissue in present comparatively high expression level (Fig. 1).Compared with high expression level, these two genes illustrate that they may regulate and control the growth of neural stem cell and neural progenitor cell brephic.
Further by the comparison [2] of gene annotation and gene order, we find that long non-coding RNA Sox2ot and transcription factor Sox2 is positioned on mouse genome No. 3 karyomit(e).Sox2ot gene is made up of 5 exons, and transcription product is about 3000bp.Sox2 gene is made up of an exon, and transcription product is about 2500bp.Sox2 gene is arranged in the intron of Sox2ot in genome, and Sox2ot is overlapping, and transcribes (Fig. 2) by same direction.Due to Sox2 gene high expression level in embryonic stem cell, neural stem cell, and can promote stem cell proliferation, this illustrates that Sox2ot probably regulates and controls the expression of Sox2, also participates in the regulation process of stem cell proliferation and differentiation.
embodiment 2
We find that Sox2ot expresses in Neural Stem Cells From Embryonic Mice: for determining that whether the same with Sox2 also the growth neural stem cell of Sox2ot is worked, we adopt the method for in situ hybridization (insituhybridization) to have detected the expression status [3] of Sox2ot and Sox2 in mice embryonic 13.5 and 15.5 days brains.By the mode of the external synthesis of RNA, we have synthesized probe (probe) (Fig. 2) [2] of Sox2ot and Sox2 of DIG-mark respectively.
The sequence of Sox2ot probe is as follows:
5’cagcaaatggaaaatgaggtctttcttagttgcacaagagatgtctgaactctcagaccaaagccatcaaccagattctcttaagcggatcttgaggaaagtacaatttctaggttcgatctcggagttgagagctttcttctgtaatatgtctgttgcctggcttctcttttgcgtgtaccagctgcagagattttccgatttgggactacaggcttggacccgcggcgaccatgccagatcagggtgttgtcttgtagcagtttgattggcaggtaaaaagcactgaacgtgaaggctccggagcctctcgtcagcccaagctggatcactcctcaccggacagaacgagttgaaggagctcgcacttcccccctctttctccatccaaagcacggagaatccatttaggcttttcttcgaccagtctctcccatcagcgtcctgccttccgcgcaccaccttacaccagcctccaagacctagtctagctttgcctctgcaatccctggaatagaaagaggctttcactcatcccatggatggccactgttctggagaaatctgtcaggtttgcttctcggtactgcccagagctcttgggggtgaggcctgtcccagcagacaagtcctgggaccttccccatcagaggatcaaggttgggtgcgagggtgtggccgtgcacctgaggacaggagccagctaagtgtggacagagagagccagcaggagagtgtcccctgccacagtcagccctgagcagg-3’(SEQIDNo.7)
The sequence of Sox2 probe is as follows:
5’-gagcccagcgccataccgggggtgccctgctgcgagtaggacatgctgtaggtgggcgagccgttcatgtaggtctgcgagctggtcatggagttgtactgcagggcgctgacgtcgtagcggtgcatcggttgcatctgtgccgcgccgtgagcgttgaggcccgggtgctgcgggtagcccagctgctcctgcatcatgctgtagctgccgttgctccagccgttcatgtgcgcgtagctgtccatgcgctggttcacgcccgcacccaggccggcgcccaccccaaccccgctcgccatgctgttcccgccgggggccagcaagcctccgggaagcgtgtacttatccttcttcatgagcgtcttggttttccgccgcggccggtatttataatccgggtgctccttcatgtgcagagcgcgcagccgcttggcctcgtcgatgaacggccgcttctcggtctcggacaaaagtttccactccgcgcccaggcgcttgctgatctccgagttgtgcatcttggggttctcctgggccatcttacgccgctgcccccgggaccataccatgaaggcgttcatgggcctcttgacgcggtccgggctgttcttctggttgccgccggtcgccgccgccgtggcgttgcctcctccgccgccgccccccgaagcttgctgcgggcccggcggcttcagctccgtctccatcatgttatacatgcgggcgctgggcgcgggcgcggcccgccggcggccgccaaccctcggcccggccgggactgtgggggccgcgctcgggggccgggatgcaggggccgcgggcgggggcctcggcgtgcacggccctgcgcggagatctggcggagaatagttggggggaagcggagctcgagacgggcgaagtgcaattgggatgaaaaaacaggcgctctcctcctcgggccgccgcgattgttgtgattagtttttggaaaggcttaagcctcgggctccaaacttctc-3’(SEQIDNo.8)
The coronal section of mice embryonic 13.5 and 15.5 days brains is have collected after us.The probe of Sox2ot and Sox2 after hybridization, can detect the expression of Sox2ot and Sox2 in 65 DEG C in section by BM-Purple colour developing.We find that Sox2 is expressed in concentrated cortex ventricles of the brain district (ventricularzone, VZ) (Fig. 3) of neural stem cell.Similar with Sox2, Sox2ot also expresses in cortex ventricles of the brain district.Cortex ventricles of the brain district is the region that in brain, neural stem cell is concentrated.Our result shows that Sox2ot and Sox2 may have close function, and same regulation and control neural stem cell is grown.
embodiment 3
We break up by Late Cambrian Sox2ot induced nerve stem cells: be explore the function of Sox2ot in brain development, the method that we are turned by mice embryonic electricity, process LAN Sox2ot in embryo's 13.5 days pallium, then observes the growth of neural stem cell in embryo's 14.5 days pallium.Concrete grammar is as follows:
The full-length cDNA fragment (shown in SEQIDNo.2) of Sox2ot has been cloned in [4] on pCAGIG carrier by the connection of XhoI and NotI two restriction enzyme sites by us.PCAGIG carrier contains actin promotor and cytomegalovirus promoter (CMV), therefore has higher expression activity [4].This plasmid loads green fluorescence protein gene (eGFP) simultaneously, the cell [4] after turning with spike electricity as mark.In contrast, we are also electric has turned the pCAGIG empty carrier plasmid not containing Sox2ot.
After female mouse anesthesia of 13.5 days period of pregnancys, uterus is exposed.By microinjection, Sox2otDNA enters the ventricles of the brain district of fetal mice by uterine veil injection.Use pincer-like electrode to fetal mice brain mild electrical shock [2] afterwards.Concrete electric shock condition is: under 35V voltage, gives 5 electric shocks, every minor tick 50 milliseconds (ms).Because DNA is electronegative, can proceed to positive electrode direction.So the pallium of positive electrode direction has just been transferred into Sox2otDNA.
Electricity turned after one day, and we have collected embryo's brain, are getting brain last hour, and mouse accepts BrdU injection, to mark mitotic division S-phase cell.Afterwards mouse brain with 4% formaldehyde fix.Cut into slices by freezing microtome, we have collected electricity turn after brain sheet, and have detected by antibody labeling the impact that Sox2ot grows neural stem cell.When being in neural stem cell, the neural progenitor cell of splitting status with BrdU antibody labeling, we have counted the ratio of " GFP+/BrdU+ " cell count and GFP+ cell count.We find, in the Cerebral Cortex of process LAN Sox2ot, BrdU positive cell number obviously reduces (Fig. 4).Further, for the neural stem cell number of Sox2 antibody labeling, we have counted the ratio of " GFP+/Sox2+ " cell count and GFP+ cell count.We find, also because process LAN Sox2ot, Sox2 positive cell number obviously reduces (Fig. 4).Our result shows: contrary with the effect of Sox2, and the function of Sox2ot is that promotion is neural stem cell differentiating.
embodiment 4
We find that Sox2ot promotes that neurone generates: for exploring the function of Sox2ot in brain development, the method that we are turned by mice embryonic electricity, process LAN Sox2ot in embryo's 13.5 days pallium, then observes neuronic generation in embryo's 17.5 days pallium.Concrete grammar is as follows:
The full-length cDNA fragment (shown in SEQIDNo.2) of Sox2ot has been cloned on pCAGIG carrier by the connection of XhoI and NotI two restriction enzyme sites by we.In contrast, we are also electric has turned the pCAGIG empty carrier plasmid not containing Sox2ot.After female mouse anesthesia of 13.5 days period of pregnancys, uterus is exposed.By microinjection, Sox2otDNA enters the ventricles of the brain district of fetal mice by uterine veil injection.Use pincer-like electrode to fetal mice brain mild electrical shock [2] afterwards.Concrete electric shock condition is: under 35V voltage, gives 5 electric shocks, every minor tick 50 milliseconds (ms).Because DNA is electronegative, can proceed to positive electrode direction.So the pallium of positive electrode direction has just been transferred into Sox2otDNA.Parent is put back to after turning in uterus by electricity, allows embryo be continued to grow.
Electricity turns after four days (17.5 days embryonic stages), and we have collected embryo's brain.Because this period is the neurogenetic stage, we can detect the impact that Sox2ot generates neurone.After formaldehyde with 4% fixes brain, cut into slices by freezing microtome, we have collected electricity turn after brain sheet, and have detected by antibody labeling the impact (Fig. 5 A) that Sox2ot generates neurone.Tbr1 and Satb2 antibody marks the neurone on pallium deep layer and upper strata respectively.We have counted the ratio of " GFP+/Tbr1+ " and " GFP+/Satb2+ " cell count and GFP+ cell count, the size of this ratio reflect neurone generate number number (Fig. 5 B, C, D, E).We find, the newborn neuron quantity of Tbr1 and Satb2 mark all significantly raises (Fig. 4).Our result shows: the function of Sox2ot promotes that neurone generates.
The following prior art of biologic operation Technical Reference involved by the present invention, marks in an embodiment with reference to part:
1.PollockA,BianS,ZhangC,ChenZ,SunT:GrowthofthedevelopingcerebralcortexiscontrolledbymicroRNA-7throughthep53pathway.CellRep2014,7(4):1184-1196.
2.BianS,HongJ,LiQ,SchebelleL,PollockA,KnaussJL,GargV,SunT:MicroRNAClustermiR-17-92RegulatesNeuralStemCellExpansionandTransitiontoIntermediateProgenitorsintheDevelopingMouseNeocortex.CellRep2013,3(5):1398-1406.
3.HuangZ,Kawase-KogaY,ZhangS,VisvaderJ,TothM,WalshCA,SunT:TranscriptionfactorLmo4definestheshapeoffunctionalareasindevelopingcorticesandregulatessensorimotorcontrol.DevBiol2009,327(1):132-142.
4.MatsudaT,CepkoCL:ElectroporationandRNAinterferenceintherodentretinainvivoandinvitro.ProcNatlAcadSciUSA2004,101(1):16-22.
Above specific embodiments of the invention are described.It is to be appreciated that the present invention is not limited to above-mentioned particular implementation, those skilled in the art can make various distortion or amendment within the scope of the claims, and this does not affect flesh and blood of the present invention.
Claims (8)
1. a long non-coding RNA Sox2ot, is characterized in that, its genome sequence is as shown in SEQIDNo.2.
2. long non-coding RNA Sox2ot described in a claim 1 is in the developmental application of regulation and control neural stem cell.
3. regulate and control a method for neural stem cell growth with long non-coding RNA Sox2ot described in claim 1, it is characterized in that, described method comprises: in pallium, process LAN Sox2ot reduces neural stem cell quantity.
4. the application of long non-coding RNA Sox2ot in induced nerve stem cells differentiation according to claim 1.
5., by a method for long non-coding RNA Sox2ot induced nerve stem cells differentiation described in claim 1, it is characterized in that, described method comprises: in pallium, process LAN Sox2ot induced nerve stem cells is divided into neurone.
6. the application of long non-coding RNA Sox2ot described in a claim 1 in promoting neurone to generate.
7. promote with long non-coding RNA Sox2ot described in claim 1 method that neurone generates, described method comprises: process LAN Sox2ot Induction of neuronal differentiation in pallium.
8. one kind according to claim 1 long non-coding RNA Sox2ot detect in exploitation affect brain early development gene reagent for clinical diagnosis to prevent the application in the generation of cerebellum disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510673123.6A CN105238784B (en) | 2015-10-16 | 2015-10-16 | Long non-coding RNA and as regulation nerve stem cell proliferation and differentiation in application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510673123.6A CN105238784B (en) | 2015-10-16 | 2015-10-16 | Long non-coding RNA and as regulation nerve stem cell proliferation and differentiation in application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105238784A true CN105238784A (en) | 2016-01-13 |
| CN105238784B CN105238784B (en) | 2019-01-25 |
Family
ID=55036604
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510673123.6A Expired - Fee Related CN105238784B (en) | 2015-10-16 | 2015-10-16 | Long non-coding RNA and as regulation nerve stem cell proliferation and differentiation in application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105238784B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20190063333A (en) * | 2017-11-29 | 2019-06-07 | 연세대학교 산학협력단 | A lncRNA FOR INDUCED PLURIPOTENT STEM CELL DIFFERENTIATION AND USES THEREOF |
| CN116926072A (en) * | 2023-05-04 | 2023-10-24 | 广州准优生物科技有限公司 | Method for inhibiting neural stem cell induced differentiation and application thereof |
-
2015
- 2015-10-16 CN CN201510673123.6A patent/CN105238784B/en not_active Expired - Fee Related
Non-Patent Citations (6)
| Title |
|---|
| CHAN LI 等: "Sox2 Transcriptionally Regulates Pqbp1, an Intellectual Disability-Microcephaly Causative Gene, in Neural Stem Progenitor Cells", 《PLOS ONE》 * |
| JIE LV 等: "Long Non-coding RNAs: key players in brain and central nervous system development", 《COMPUTATIONAL MOLECULAR BIOLOGY》 * |
| MANDALOS,N. 等: "GenBank 登录号：NR_015580.2", 《NCBI》 * |
| PAULO P.AMARAL 等: "Complex architecture and regulated expression of the Sox2ot locus during vertebrate development", 《RNA》 * |
| SHAN BIAN 等: "Functions of noncoding RNAs in neural development and neurological diseases", 《MOL NEUROBIOL》 * |
| TIM R. MERCER 等: "Specific expression of long noncoding RNAs in the mouse brain", 《PNAS》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20190063333A (en) * | 2017-11-29 | 2019-06-07 | 연세대학교 산학협력단 | A lncRNA FOR INDUCED PLURIPOTENT STEM CELL DIFFERENTIATION AND USES THEREOF |
| KR102477906B1 (en) | 2017-11-29 | 2022-12-15 | 연세대학교 산학협력단 | A lncRNA FOR INDUCED PLURIPOTENT STEM CELL DIFFERENTIATION AND USES THEREOF |
| CN116926072A (en) * | 2023-05-04 | 2023-10-24 | 广州准优生物科技有限公司 | Method for inhibiting neural stem cell induced differentiation and application thereof |
| CN116926072B (en) * | 2023-05-04 | 2024-03-08 | 广州飞来爱生命科技有限公司 | Method for inhibiting neural stem cell induced differentiation and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105238784B (en) | 2019-01-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hirotsune et al. | Graded reduction of Pafah1b1 (Lis1) activity results in neuronal migration defects and early embryonic lethality | |
| EP3607073B1 (en) | Tissue selective transgene expression | |
| Raike et al. | Limited regional cerebellar dysfunction induces focal dystonia in mice | |
| Imayoshi et al. | Temporal regulation of Cre recombinase activity in neural stem cells | |
| Hoesche et al. | The 5'-flanking region of the rat synapsin I gene directs neuron-specific and developmentally regulated reporter gene expression in transgenic mice. | |
| Bryantsev et al. | Differential requirements for Myocyte Enhancer Factor-2 during adult myogenesis in Drosophila | |
| Schätzl et al. | Facioscapulohumeral muscular dystrophy: genetics, gene activation and downstream signalling with regard to recent therapeutic approaches: an update | |
| Barembaum et al. | Identification and dissection of a key enhancer mediating cranial neural crest specific expression of transcription factor, Ets-1 | |
| CN104593418A (en) | Method for establishing humanized rat drug evaluation animal model | |
| Tan et al. | Coordinated expression of cell death genes regulates neuroblast apoptosis | |
| Borrell | In vivo gene delivery to the postnatal ferret cerebral cortex by DNA electroporation | |
| Hanson et al. | Novel α-tubulin mutation disrupts neural development and tubulin proteostasis | |
| Stojkovic et al. | Vocal cord and diaphragm paralysis, as clinical features of a French family with autosomal recessive Charot-Marie-Tooth disease, associated with a new mutation in the GDAP1 gene | |
| Zhu et al. | Ndrg2 regulates vertebral specification in differentiating somites | |
| CN105238784A (en) | Long non-coding RNA and application thereof in regulating and controlling proliferation and differentiation of neural stem cells | |
| Kirstein et al. | Regulation of human myocilin/TIGR gene transcription in trabecular meshwork cells and astrocytes: role of upstream stimulatory factor | |
| Lin et al. | Regulation of neuroD2 expression in mouse brain | |
| Martin et al. | Characterization of 5′ untranslated regions of the voltage-gated sodium channels SCN1A, SCN2A, and SCN3A and identification of cis-conserved noncoding sequences | |
| CN108018310A (en) | The construction method of derivable transgenic mice cardiomyopathic animals model and application | |
| Zhu et al. | Regulation of ADAM10 by microRNA-23a contributes to epileptogenesis in pilocarpine-induced Status Epilepticus mice | |
| CN107955818B (en) | Establishing method and application of non-human primate animal model with neurological diseases | |
| Ryabinin et al. | Immediate upstream promoter regions required for neurospecific expression of SNAP-25 | |
| CN101054580A (en) | Imitation miRNA sequence and preparation method thereof | |
| CN108396036B (en) | Over-expression COX5A transgenic mouse model and construction method and application thereof | |
| CN108315350B (en) | COX5A overexpression/BDNF low expression transgenic mouse model and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190125 Termination date: 20211016 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |