CN105219796A - A kind of transcription terminator and the application in gene clone thereof - Google Patents

Abstract

The present invention relates to molecular biology and genetically engineered field, disclose the application of a kind of transcription terminator in gene clone.The invention provides a kind of cloning vector, does is it SEQ that described cloning vector contains coding strand sequence? ID? the transcription terminator of NO:1.Invention further provides the application of above-mentioned cloning vector.By the confirmatory experiment of transcription terminator efficiency, prove that the transcription terminator synthesized described in the present invention has effective Transcription Termination effect, by its sequence clone in carrier, build the carrier inserting this transcription terminator, effectively can stop transcription initiation concealed on carrier, make this carrier can be used in the clone of virulent gene.Transcription terminator sequences of the present invention can be widely used in E. coli cloning vector and the recombinant vectors that the present invention builds can be widely used in gene clone experiment.

Description

A kind of transcription terminator and the application in gene clone thereof

Technical field

The present invention relates to molecular biology and genetically engineered field.Concretely, the present invention relates to a kind of transcription terminator sequences and the application of cloning vector in gene clone field containing this transcription terminator.

Background technology

20 century 70s, the appearance of genetic engineering technique, indicates the arrival of human knowledge and the transformation life new period, sets up and developed recombinant DNA technology.Recombinant DNA technology refer in vitro by containing goal gene or other significant DNA fragmentation with can the carrier DNA of self-replacation connect, then proceeded to the process that host cell or receptor biological carry out the molecule manipulation expressed or study further; Recombinant DNA technology is also known as molecular cloning, genetic manipulation or DNA clone, it relates to a series of Protocols in Molecular Biology, as the acquisition of target DNA fragment, the selection of carrier, the selecting of various toolenzyme, vitro recombination, importing host cell technology and recombinant screen technology etc.

Transcription terminator (terminator) is the DNA sequence dna giving rna polymerase transcribe termination signal.At least after last gene of structure gene group, a terminator is had in an actuation unit.In eukaryote, transcription terminator is that one is positioned at poly (A) sites downstream, the structure of length within hundreds of base; In prokaryotic organism, find that termination signal is present among the sequence that RNA polymerase transcribed.Transcription terminator can be divided into two classes: a class dependent protein cofactor could realize termination, and this protein cofactors is commonly referred to rho factor (the Rho factor); One class does not rely on protein cofactors just can realize termination; This kind of terminator has some common features in sequence, namely one section of inverted repeats (invertedrepeatsequence) being rich in GC is had, thereafter follow one section of sequence being rich in AT thus to transcribe in the sequence of the mRNA of generation and can form hair pin type structure, follow-up a succession of U, the structure of this section of mRNA of rna polymerase transcribe generation stops RNA polymerase to continue to move along DNA just, and polysaccharase is split away off from DNA chain, stop transcribing.

The Rho factor is responsible for the Transcription Termination of in cell about 20%; The Transcription Termination of Rho factor independent form accounts for about 80%.At present, what people studied for the detailed mechanism of first kind transcription terminator is not also very thorough, more concentrate in the research to the second transcription terminator, the transcription terminator sequences of this type in synthetic biology, can be able to be used for stopping unnecessary transcription initiation as independently element application usually.

About the proposition of unnecessary transcription initiation concept, come from the cloning experimentation of some virulent genes comparatively early.Find under study for action, some are cloned into virulent gene in T7 expression system not only can not stable existence in Host Strains BL21 (DE3), and can not exist in the intestinal bacteria of originating without t7 rna polymerase.The explanation that this phenomenon is possible is that virulent gene has been readed over by the RNA polymerase in intestinal bacteria.May there is the promotor of some secrets in the upstream of virulent gene promotor, they can by colibacillary RNA polymerase identification and initiation transcription, and the amount of the mRNA of generation is perhaps few, but produces the albumen being enough to cell be produced to overt toxicity.In order to solve this problem of read-through, add that in the promotor upstream of virulent gene strong effective transcription terminator can effectively solve above-mentioned produced problem.

Summary of the invention

The object of the invention is to the defect overcoming existing cloning vector, a kind of cloning vector and the preparation thereof that contain synthetic transcription terminator are provided, and use it in a large amount of cloning experimentations.

Carrier of the present invention for skeleton, is connected into the transcription terminator carrier of synthetic with pUC57 carrier, and employing green fluorescent protein is reporter gene, with can obviously Fluorophotometry protein gene whether transcribe the efficiency verifying transcription terminator; The pUC57 carrier being connected with this transcription terminator sequences is used for cloning experimentation simultaneously, confirms that it can carry out alternative pUC57 carrier as the clone standby carrier of virulent gene or difficult gene.

Research of the present invention is around a kind of application start of transcription terminator, and the sequence of described transcription terminator coding strand is:

5’-GCGGCCGCTTCTAGAGAAAAAAAAACCCCGCCCCTGACAGGGCGGGGTTTTTTTTTACTAGTAGCGGCCG-3’(SEQIDNO:1)

Further, described transcription terminator two ends are flush end, or the two ends of described transcription terminator also comprise sticky end.

Described sticky end is mainly used in connection carrier.Sticky end can be cloned into the design of the restriction enzyme site corresponding to position of carrier as required.As the embodiment of the present invention is enumerated, can be corresponding HindIII and PstI enzyme cut after sticky end, or for corresponding EcoRI and KpnI enzyme cut after sticky end.

First aspect present invention provides a kind of cloning vector containing transcription terminator of the present invention.

Further, described cloning vector is E. coli cloning vector, and the multiple clone site clone of described E. coli cloning vector has described transcription terminator.

The skeleton of described cloning vector can be pUC57, also can be the E. coli cloning vector that other are common.

As embodiment is enumerated, described cloning vector take pUC57 as skeleton carrier, and transcription terminator sequences is arranged in the multiple clone site region of this carrier.

Concrete, described cloning vector described transcription terminator is cloned into pUC57 carrier by EcoRI and KpnI site obtain.

Cloning vector of the present invention, still containing multiple clone site, can be widely used in gene clone experiment.

Second aspect present invention, provides the purposes of described cloning vector in gene clone field.

Further, described cloning vector is used for the clone of virulent gene or difficult gene.

Described virulent gene refers to: the gene that directly or indirectly can kill host cell after expression.

Concrete, as embodiment is enumerated, described virulent gene can be virulent gene ccdB.

Described difficult gene refers to: be difficult to clone successful gene in Bacillus coli communis carrier.Described Bacillus coli communis carrier can be pUC57 etc.As the embodiment of the present invention is enumerated, described difficult gene can be the soybean mosaic virus polyprotein precursor gene that sequence is SEQIDNO.2, or encoding sequence is the soybean mosaic virus polyprotein gene of SEQIDNO.3.

Third aspect present invention, provides the cloning process of a kind of virulent gene or difficult gene, for cloning vector of the present invention for carrier, described virulent gene or difficult gene clone are entered the downstream of the transcription terminator in described cloning vector multiple clone site.

Fourth aspect present invention, provide a kind of carrier, obtain for being cloned into foreign gene in the multiple clone site of cloning vector of the present invention, the soybean mosaic virus polyprotein precursor gene that described foreign gene is selected from green fluorescence protein gene, encoding sequence is SEQIDNO.2 or encoding sequence are the soybean mosaic virus polyprotein gene of SEQIDNO.3, and described foreign gene is positioned at the downstream of transcription terminator of the present invention.

Fifth aspect present invention, provides a kind of method verifying transcription terminator transcription effects of the present invention, comprises the following steps:

1) encoding gene of green fluorescent protein GFP is cloned into the multiple clone site of pUC57 carrier, and is positioned at the downstream of pUC57 carrier lac promotor;

2) encoding gene of transcription terminator of the present invention and green fluorescent protein GFP is all cloned into the multiple clone site of pUC57 carrier, described transcription terminator sequences is inserted into the downstream of lac promotor, the upstream region of green fluorescent protein initiator codon;

3) by step 1) and 2) carrier that obtains transformation of E. coli competent cell respectively, competent cell through transforming is coated with the ampicillin plate containing IPTG/X-Gal respectively, under natural light or under UV-light, observe the intensity of variation that can bacterium colony present green fluorescence and fluorescence intensity, reflected the efficiency of transcription terminator by the change of fluorescence intensity.

Transcription terminator of the present invention has effective Transcription Termination effect, and by its sequence clone in carrier, the carrier of structure, effectively can stop transcription initiation concealed on carrier, make this carrier can be used in the clone of virulent gene or difficult gene.Therefore, transcription terminator sequences of the present invention can be widely used in E. coli cloning vector and the present invention build recombinant vectors can be widely used in gene clone experiment.

Accompanying drawing explanation

Fig. 1 sticky end is the electrophorogram that after transcription terminator sequences TT1 that the enzyme of HindIII with PstI cuts rear sequence is connected with pUC57 carrier, PCR detects

Fig. 2 insert transcription terminator and not containing the carrier of transcription terminator on the impact of GFP protein transcription level

Fig. 3 sticky end is the electrophorogram that after transcription terminator TTEK that EcoRI with KpnI enzyme cuts rear sequence is connected with pUC57 carrier, PCR detects

Fig. 4 ccdB stable gene is present in the sequencing result peak figure in TTEK-pUC57 carrier

The enzyme that Fig. 5 difficulty gene EF is cloned into TTEK-pUC57 carrier cuts detection figure

The enzyme that Fig. 6 difficulty gene GH is cloned into TTEK-pUC57 carrier cuts detection figure

The PCR that Fig. 7 difficulty gene EF and GH is cloned into TTEK-pUC57 carrier detects electrophorogram

Embodiment

The present invention adopts the first synthetic primer of the mode of chemosynthesis, and obtains complete transcription terminator sequences by the complementary pairing of base in primer.

As embodiment is enumerated, the cloning vector containing transcription terminator of the present invention can adopt following method to prepare:

A. the transcription terminator sequences of two ends with HindIII and PstI restriction enzyme site is obtained by synthetic primer and annealing.

B. use HindIII and PstI digestions pUC57 carrier, after the fragment after annealing being connected with carrier, obtain the cloning vector containing transcription terminator.

Embodiment is also reporter gene with green fluorescent protein, transcription terminator sequences is inserted into the downstream of lac promotor, the upstream region of green fluorescent protein initiator codon, prove that it can effectively suppress transcribing of reporter gene, the green fluorescence that bacterium colony is presented under natural light or UV-light obviously weakens.

Concrete, the verification method of described transcription terminator efficiency can comprise the following steps:

A. coding strand and the complementary strand of PCR or full genome synthesis acquisition encoding green fluorescent protein GFP is carried out by synthetic primer.The gene order of described green fluorescent protein is as follows:

ATGAGCAAAGGCGAAGAACTGTTTACCGGCGTGGTGCCGATTCTGGTTGAACTGGATGGCGATGTTAATGGCCATAAGTTTAGCGTGCGCGGCGAAGGCGAAGGCGATGCGACCAACGGCAAACTGACCCTGAAGTTTATTTGCACCACCGGCAAACTGCCGGTGCCGTGGCCGACCCTGGTGACCACCCTGACCTATGGCGTGCAGTGCTTTAGCCGCTATCCGGATCACATGAAACGCCATGATTTCTTTAAGTCCGCGATGCCGGAAGGCTATGTTCAGGAACGCACCATTAGCTTTAAAGATGATGGCACCTATAAGACCCGCGCGGAAGTGAAATTTGAAGGCGATACCCTGGTGAACCGCATTGAACTGAAAGGCATTGACTTCAAAGAAGATGGCAACATTCTGGGCCATAAACTGGAGTACAATTTCAACAGCCATAACGTGTATATTACCGCGGACAAACAGAAGAACGGCATCAAAGCGAATTTCAAAATCCGCCATAATGTGGAAGATGGCAGCGTGCAGCTGGCGGATCACTATCAGCAGAATACCCCGATCGGCGATGGCCCGGTGCTGCTGCCGGACAATCACTACCTGAGCACCCAGTCCGTGCTGAGCAAAGATCCGAATGAGAAACGCGATCACATGGTTCTGCTGGAGTTTGTGACCGCGGCGGGTATCACTCATGGCATGGACGAGCTGTACAAGTAA(SEQIDNO:4)

The encoding gene of green fluorescent protein GFP is cloned in pUC57 carrier by blunt end cloning by the restriction endonuclease SmaI B. by producing flat end; By the vector bacillus coli DH 5 alpha competent cell obtained, the ampicillin plate of coating containing IPTG/X-Gal, the flat-plate bacterial colony of acquisition can observe obvious green fluorescence under natural light He under UV-light.

C. the restriction endonuclease SmaI producing flat end is utilized to be cloned in the pUC57 cloning vector containing transcription terminator of the present invention by the encoding gene of green fluorescent protein GFP by blunt end cloning; By the vector bacillus coli DH 5 alpha competent cell obtained, the ampicillin plate of coating containing IPTG/X-Gal, observes the intensity of variation that can bacterium colony present green fluorescence and fluorescence intensity under natural light or under UV-light.The efficiency of transcription terminator is reflected by the change of fluorescence intensity.

Below enumerate specific embodiment and illustrate the present invention further, but example is not for limiting the scope of the invention.Those skilled in the art can use for reference present disclosure, adapt to special purposes to suitable carrier transformation.Special needs to be pointed out is, all similar replacements or change are all deemed to be included in the present invention.

In embodiment, what conversion bacillus coli DH 5 alpha competent cell adopted is prepared by Calcium Chloride Method; Restriction enzyme used, ligase enzyme etc., pUC57 carrier and DNAmarkerSM0331 are all purchased from ThermoFisherScientific company.Conventional reagent all adopts Sangon Biotech's product.Amplification green fluorescent protein GFP gene and ccdB gene (method of being synthesized by full genome by Sangon Biotech (Shanghai) Co., Ltd. is synthesized)

The synthesis of embodiment 1 transcription terminator sequences

Transcription terminator called after TT1 used in the present embodiment, sequence is as follows:

TT1：

Coding strand: (SEQIDNO:5)

5’- AGCTTGCGGCCGCTTCTAGAGAAAAAAAAACCCCGCCCCTGACAGGGCGGGGTTTTTTTTTACTAGTAGCGGCCG CTGCA-3’

Antisense strand: (SEQIDNO:6)

5’-TGCAGCGGCCGCTACTAGTAAAAAAAAACCCCGCCCTGTCAGGGGCGGGGTTTTTTTTTCTCTAGAAGCGGCCGCAAGCT-3’

Underscore part is the sticky end region be connected for the carrier after cutting with enzyme.

Design following primer:

TT1-F1:(SEQIDNO:7)

5’-AGCTTGCGGCCGCTTCTAGAGAAAAAAAAACCCCGCCCCT-3’

TT1-F2:(SEQIDNO:8)

5’-GACAGGGCGGGGTTTTTTTTTACTAGTAGCGGCCGCTGCA-3’

TT1-R1:(SEQIDNO:9)

5’-CTGTCAGGGGCGGGGTTTTTTTTTCTCTAGAAGCGGCCGCA-3’

TT1-R2:(SEQIDNO:10)

5’-GCGGCCGCTACTAGTAAAAAAAAACCCCGCC-3’

Use chemical synthesis to complete the synthesis of primer, water-soluble its final concentration that makes of synthetic primer is 10 μm of ol/L, and every bar primer is got 2 μ L and annealed, and carries out anneal according to following system and program:

Response procedures: 37 DEG C of for30min, 95 DEG C of for4min, naturally cool to room temperature.After completion of the reaction, obtain the sequence that complementary DNA double chain is transcription terminator, the enzyme of the outstanding sticky end at two ends corresponding HindIII and PstI respectively cut after sequence.

Embodiment 2 is with the preparation of the carrier of transcription terminator sequences

Transcription terminator embodiment 1 obtained connects with the pUC57 carrier through same double digestion respectively, and linked system is as follows:

16 DEG C connect 2h, transformation of E. coli DH5 α competent cell, 37 DEG C of incubated overnight in LB resistant panel.The upstream F1 annealed with transcription terminator and downstream R2 primer carry out PCR checking, and the electrophoresis result of PCR checking is as Fig. 1.

Picking positive colony upgrading grain, determines that transcription terminator sequences has all successfully been cloned in pUC57 carrier, carrier called after TT1-pUC57 through DNA sequencing checking.

Embodiment 3 is verified with the result of use of the carrier of transcription terminator sequences

3.1 structures inserting the carrier of green fluorescent protein GFP gene

Use the synthesis of chemical synthesis process complete design sequence, and the gene order of green fluorescent protein GFP and pUC57 carrier are carried out flat end clone by flat terminal enzyme SmaI, obtain the carrier that can carry out GFP expression under the lac promotor on pUC57.

The connection of 3.2GFP gene and pUC57, linked system is as follows:

22 DEG C connect 2h, transformation of E. coli DH5 α competent cell, 37 DEG C of incubated overnight in the LB resistant panel containing IPTG.

Flat board is checked under ultraviolet lamp, takes pictures, obviously can see and have most of bacterium colony to present bright green; Show effectively expressing under the lac promotor of the gene of green fluorescent protein on carrier.

The connection of 3.3GFP gene and transcription terminator carrier

GFP gene is connected with the carrier TT1-pUC57 containing transcription terminator sequences, and linked system is as follows:

22 DEG C connect 2h, transformation of E. coli DH5 α competent cell, 37 DEG C of incubated overnight in the LB resistant panel containing IPTG.Carry out pcr amplification detection with M13+/-primer, amplifying length is that the clone of 900bp is for positive colony.

The clone as positive control described in the carrier and 3.2 of three positive colonies described in 3.3 is chosen inducing culture to liquid LB respectively spend the night, centrifugal by the bottom of microorganism collection to pipe, observe, take pictures, contrast thalline is in the power of the green fluorescence presented under natural light.Image results is as Fig. 3.

Found that, compare with positive control vector GFP-pUC57, transcription terminator all presents certain transcripting suppressioning action, and TT1 is obvious to the restraining effect of transcribing, and causes bacterium colony to present white.

Embodiment 4 is with the application of carrier in virulent gene ccdB clones of transcription terminator sequences

4.1 design primers, produce the transcription terminator sequences with EcoRI and KpnI sticky end by annealing.Transcription terminator sequences:

Coding strand: (SEQIDNO:11)

5’- AATTCGCGGCCGCTTCTAGAGAAAAAAAAACCCCGCCCCTGACAGGGCGGGGTTTTTTTTTACTAGTAGCGGCCG GGTAC-3’

Antisense strand (SEQIDNO:12)

5’-GTACCCGGCCGCTACTAGTAAAAAAAAACCCCGCCCTGTCAGGGGCGGGGTTTTTTTTTCTCTAGAAGCGGCCGCGAATT-3’

Primer:

TTEK-F1:(SEQIDNO:13)

5’- AATTCGCGGCCGCTTCTAGAGAAAAAAAAACCCCGCCCCT-3’

TTEK-F2:(SEQIDNO:14)

5’-GACAGGGCGGGGTTTTTTTTTACTAGTAGCGGCCG GGTAC-3’

TTEK-R1:(SEQIDNO:15)

5’-CTGTCAGGGGCGGGGTTTTTTTTTCTCTAGAAGCGGCCGC G-3’

TTEK-R2:(SEQIDNO:16)

5’- CCGGCCGCTACTAGTAAAAAAAAACCCCGCC-3’

Be connected in the pUC57 carrier of same double digestion, transform, 37 DEG C of incubated overnight in LB resistant panel.

Carry out PCR checking with TTEK-F1 and TTEK-R2 primer, the electrophoresis result of PCR checking is as Fig. 4.

Picking positive colony carries out liquid culture, adopts the plasmid a small amount of extraction agent box of raw work biology to carry out plasmid extraction, finally verifies through DNA sequencing; The TTEK-pUC57 carrier obtained is used for the cloning experimentation of virulent gene and difficult gene.

4.2ccdB gene is connected with the clone of TTEK-pUC57 carrier

CcdB gene can produce ccdB albumen after e. coli expression, this albumen energy deactivation DNA gyrase, thus causing the death of conventional host, therefore common escherichia coli vector can not being cloned into ccdB stable gene in normal intestinal bacteria cloning host.In E. coli mutant strain DB3.1 cell, this gene can normal colonic, because the genome of bacterial strain is for this reason through sudden change transformation, has resistance to ccdB albumen.In the present embodiment, with the addition of synthetic transcription terminator carrier can normal colonic stable existence in Bacillus coli communis bacterial strain.

Full genome synthesis ccdB gene.

CcdB gene order: (SEQIDNO:17)

ATGCAATTTAAGGTGTATACCTACAAACGTGAATCTCGTTACCGTCTGTTCGTTGACGTGCAGTCTGACATCATCGACACCCCGGGTCGTCGTATGGTTATCCCGCTGGCGTCTGCCCGTCTGCTCTCTGACAAAGTTTCTCGTGAACTGTACCCGGTCGTTCACATCGGCGATGAATCTTGGCGCATGATGACCACCGACATGGCGAGCGTTCCGGTATCTGTTATCGGTGAAGAAGTTGCGGACCTGTCTCACCGTGAAAACGACATCAAGAACGCGATCAACCTGATGTTCTGGGGTATCTGATAA

Adopt the flat terminal enzyme of EcoRV by ccdB gene clone in TTEK-pUC57, linked system is as follows:

22 DEG C connect 2h, transformation of E. coli DH5 α competent cell, 37 DEG C of incubated overnight in LB resistant panel.Carry out pcr amplification detection with M13+/-primer, amplifying length is that the clone of 450bp is for positive colony.Send order-checking by positive colony, sequencing result finds that ccdB stable gene is present in TTEK-pUC57 carrier, and be positioned at the downstream of transcription terminator sequences, comparison result as shown in Figure 5.

Embodiment 5 is with the application of carrier in difficult gene clone of transcription terminator sequences

In gene chemical synthesis process, the cloning vector that pUC57 right and wrong are usually shown in also is the first-selection of cloning vector, generally attempts repeatedly still being difficult to successful clone and other carriers just can be selected to attempt to the gene in pUC57 carrier.Be about 2.6kb and be difficult to the gene be cloned in pUC57 carrier so have selected two length run in gene chemical synthesis process in the present embodiment and test, gene numbering is respectively referred to as EF and GH; A kind of polyprotein precursor of gene EF coding soybean mosaic virus, its sequence is as follows:

EF gene (SequenceID:gbAAP45048.1):

TCAAATGCTGACATGATCCAACATGGAAACAATTTGCTTGTATATGTTGCTAGTTATAATGAAGTTGACCAATTGTCACGATTATTAACTGAAAAACATTACAAGGTGACAAAGGTCGATGGGAGGACAATGCAAATGGGAAATGTAGAAATTGCAACCACAGGCACAGAGGGAAAACCACACTTCATAGTTGCAACGAACATCATTGAGAATGGAGTGACTCTTGACATTGATTGTGTGATTGACTTTGGACTTAAAGTGGTGGCTACTCTTGACACAGACAACCGGTGTGTGCGCTACAACAAACAGTCAGTATCTTATGGAGAGCGCATCCAGAGGCTTGGCAGAGTTGGTCGTTGTAAACCTGGATTTGCACTTAGGGTTGGACACACGGGAAAAGGAATTGAGGAAGTTCCCGAATTCATAGCCACAGAGGCAGCTTTTCTATCCTTTGCTTATGGCCTGCCAGTAACAACACAAAGTGTCTCAACCAACATATTGTCCCGTTGCACAGTGAAGCAAGCACGAGTAGCTCTTAATTTTGAGCTGACTCCATTTTTCACCACTAACTTCATAAAGTATGATGGTAGCATGCACCCAGAGATCCACAGATTGCTCAAGCCCTACAAACTCAGGGAGTCTGAGATGTTGTTAACCAAGTTAGCAATACCATATCAGTTTGTTGGGCAGTGGATAACAGTTAAGGAGTATGAACGTCAGGGTGTTCACCTCAATTGTCCAGAGAAAGTGAAAGTACCTTTTTATGTGCATGGCATACCAGACAAGTTATATGAGATGTTGTGGGACATAGTTTGCAAATACAAGAATGATGCTGGATTTGGCTCAATTAGGAGTGTGAATGCAACAAAGATTAGTTACACTCTAAGCACTGATCCAACAGCAATCCCTCGAACACTTGCAATATTGGACCATTTGTTAAGTGAAGAGATGACCAAGAAGAGTCATTTTGACACAATTGGCTCTTCTGTCACTGGATACTCCTTTTCTCTTGCAGGCATAGCCGATGGATTTAGGAAAAGGTACTTGAGGGACTACACACAGCACAATATAGTCATCCTACAACAGGCTAAAGCACAACTGCTAGAATTTGATTGCAACAAAGTTGACATCAACAACCTGCACAATGTTGAGGGTATAGGCATTTTGAATGCAGTCCAATTACAGAGCAAACATGAGGTGAGTAAGTTCTTGCAACTTAAAGGAAAATGGGATGGAAAGAAATTCATGAATGATGCTGTTGTGGCTATCTTTACTTTAGTGGGTGGTGGCTGGATGTTATGGGACTACTTCACGAGAGTTATACGCGAGCCAGTATCAACTCAAGGAAAGAAGAGGCAGATACAAAAACTCAAATTTAGGGATGCCTTTGATAGAAAAGTAGGCCGTGAGGTGTACGCAGATGACTACACCATGGAGCACACCTTTGGGGAGGCCTACACCAAGAAAGGAAAGCAGAAAGGTAGCACTCGCACAAAAGGGATGGGTCGCAAGTCGAGAAATTTCATACACTTGTATGGAGTCGAGCCAGAGAATTACAGTATGATTAGATTTGTTGACCCGCTAACTGGACACACAATGGATGAACACCCCAGGGTTGATATCAGGATGGTGCAGCAAGAGTTTGAGGAGATAAGGAAAGACATGATTGGGGAAGGTGAACTGGACCGGCAAAGAGTCTACCACAATCCTGGTTTACAGGCTTATTTCATTGGGAAAAATACAGAGGAAGCACTCAAGGTTGATCTCACACCACACAGACCCACACTTCTCTGCCAAAATAGCAATGCTATAGCAGGTTTTCCTGAGAGGGAGGACGAATTGCGTCAGACAGGATTGCCACAAGTGGTTTCCAAATCAGATGTCCCACGTGCCAAAGAAAGAGTTGAAATGGAAAGCAAGTCTGTCTACAAGGGACTTAGAGATTATAGTGGCATTTCCACATTAATATGCCAGCTTACAAATTCATCGGATGGGCATAAAGAAACAATGTTTGGGGTCGGCTATGGTTCTTTTATTATCACAAATGGACATTTGTTCAGAAGGAACAATGGAATGCTCACAGTTAAGACATGGCATGGTGAGTTTGTGATACACAACACAACACAGCTCAAGATACATTTTATTCAAGGGAAGGATGTGATTCTGATTCGCATGCCAAAGGATTTTCCTCCATTCGGAAAACGCAACCTTTTTAGACAACCAAAGCGTGAGGAACGGGTTTGTATGGTTGGGACAAATTTCCAAGAGAAGAGCTTGCGTGCAACAGTTTCAGAATCTTCTATGATATTGCCGGAGGGGAAGGGCTCTTTCTGGATACATTGGATCACAACCCAGGATGGTTTCTGTGGGTTGCCTCTCGTTTCTGTTAATGATGGGCACATTGTTGGAATACATGGATTAACATCCAATGATTCAGAAAAGAACTTCTTCGTCCCACTCACTGATGGGTTTGAGAAAGAATATCTAGAGAATGCTGACAACTTGTCATGGGATAAGCATTGGTTTTGGGAACCAAGCAAGATAGCATGGGGCTCTTTGAACTTAGTTGAGGAACAACCAAAAGAGGAGTTCAAAATATCAAAGCTTGTGTCAGATCTCTT(SEQIDNO:2)

Gene GH also encodes a kind of polyprotein in soybean mosaic virus, and its sequence is as follows:

GH gene (SequenceID:gbAAO32625.1):

AGATCTCTTTGGAAATACAGTGACAGTACAAGGGAAAAAGGAGAGATGGGTTTTGGATGCAATGGAAGGTAACCTAGTGGCTTGTGGGCAAGCCGACAGTGCATTGGTAACAAAGCATGTTGTTAAAGGAAAGTGCCCCTATTTTGCACAATATCTTTCAGTGAATCAAGAGGCAAAGTCCTTCTTTGAACCACTTATGGGTGCATATCAACCAAGCCGATTAAACAAAGATGCATTCAAACGAGACTTCTTTAAATATAACAAACCAGTTGTTTTGAATGAAGTTGATTTTCAAGCTTTCGAGAAGGCAGTGGCTGGAGTGAAATTGATGATGATGGAATTTGATTTCAAGGAGTGTGTGTATGTGACTGATCCTGATGAGATATATGACTCCTTGAATATGAAAGCTGCAGTTGGTGCACAATACAAAGGGAAGAAGCAAGATTATTTCTCTGGAATGGACAGTTTCGACAAGGAACGCTTGCTCTATCTCAGCTGCGAAAGGTTATTCTATGGGGAAAAAGGAGTGTGGAATGGATCCCTGAAAGCAGAGTTGAGGCCAATTGAAAAAGTGCAAGCAAACAAAACCAGGACATTTACAGCAGCACCAATCGACACATTACTTGGAGCAAAGGTTTGTGTTGATGATTTCAACAACCAATTTTACAGTCTCAATCTTACATGTCCATGGACAGTTGGGATGACCAAATTTTATAGAGGTTGGGACAAGTTGATGAGGAGTTTACCTGATGGGTGGGTGTATTGTCATGCAGATGGCTCACAATTTGATAGTTCCCTGACACCACTACTACTGAATGCAGTTTTGGATGTTAGGAGCTTTTTCATGGAGGACTGGTGGGTTGGGAGAGAAATGCTAGAAAACCTCTATGCTGAGATAGTCTACACACCAATTTTAGCACCTGATGGTACAATTTTTAAGAAGTTCAGAGGAAACAACAGCGGGCAACCATCTACAGTTGTGGACAACACCTTGATGGTAGTCATTGCCGTGTACTATTCTTGTTGTAAGCAAGGGTGGTCAGAGGAGGACATTCAGGAAAGATTAGTGTTTTTCGCCAATGGTGATGACATCATCCTGGCAGTTAGTGAGAAGGACACATGGCTGTATGACACTCTCAGCACTTCGTTCGCCGAACTTGGTCTCAACTACAACTTTGAGGAACGGACAAAGAAAAGGGAGGAATTGTGGTTCATGTCACACCAAGCCATGTTAGTTGATGGAATCTATATTCCAAAACTTGAACCTGAGAGAATTGTCTCTATCCTAGAGTGGGACAGGAGCAAAGAGCTTATGCATCGCACTGAGGCGATATGCGCAGCAATGATTGAGGCATGGGGATACACTGAATTGCTGCAAGAGATCCGCAAATTTTATTTGTGGCTTCTAAACAAGGATGAATTTAAAGAGCTTGCTTCGTCTGGAAAAGCACCATATATTGCAGAGACAGCTTTGAGAAAGCTGTACACAGATGTCAATGCTCAGACAAGTGAGCTACAAAGATATCTTGAAGTGCTGGATTTCACTCATGCTGATGACTGTTGTGAATCAGTGTCCTTACAATCAGGCAAGGAGAAGGAAGGAGAAATGGATGCAGGTAAGGATCCAAAGAAGAGCACCAGCAGTAGCAAAGGAGCTGGTACAAGCAGCAAAGATGTAAATGTTGGATCAAAAGGAAAGGTGGTTCCGCGTTTGCAGAAGATTACAAGAAAGATGAATCTTCCAATGGTCGAAGGGAAGATCATTCTTAGCTTGGACCACTTGCTTGAGTACAAACCCAATCAGATTGATTTATTCAACACTCGAGCAACAAGAACACAGTTTGAAGCGTGGTACAATGCAGTTAAAGATGAATATGAGCTTGATGATGAGCAAATGGGTGTGGTCATGAATGGTTTCATGGTTTGGTGTATTGACAATGGCACATCTCCAGATGCCAATGGCGTGTGGGTGATGATGGATGGAGAGGAACAAATTGAATATCCGCTGAAGCCCATTGTCGAAAATGCAAAGCCAACTTTGAGACAAATCATGCATCATTTCTCAGATGCAGCAGAAGCTTATATTGAAATGAGAAATTCTGAAAGTCCGTATATGCCTAGATATGGACTGCTAAGAAATTTGAGAGATAGAGAGTTAGCCCGCTATGCTTTTGACTTCTATGAGGTCACTTCTAAAACACCAAACAGGGCAAGGGAAGCAATAGCGCAAATGAAGGCTGCAGCTCTCTCGGGAGTTAACAACAAGTTGTTTGGACTTGATGGAAATATCTCAACCAACTCCGAAAATACTGAAAGGCACACTGCAAGGGATGTGAATCAAAACATGCACACTCTTCTGGGCATGGGCCCACAGCAGTAAAGGCTAAGTAAATTGGCCACAGTTATCATTTCGGGTCGCTTTATAGTTTGCTATAATATAGTAGTTGCACTTTCTTTGAGTATAGTGTGATTGCATCACCAAATAATACTTTTGTTTAGTGTGGTTTTAACCACCTCAGTGTGCTTTATATTATAGTTTATGAATGGCAGGGAGAACCATTGTGTTACTGGAGCCCCTTGAAGAGTGATTCTATCACGTTTAGTGGCCGAGGTACGGCAATGTTTGTTGTCCTAAA(SEQIDNO:3)

By the flat terminal enzyme of SmaI by EF and GH gene clone in TTEK-pUC57, linked system is as follows:

22 DEG C connect 3h, transformation of E. coli DH5 α competent cell, 37 DEG C of incubated overnight in LB resistant panel, picking mono-clonal is in LB liquid medium, plasmid extraction is carried out with the little test kit of taking out of the biological plasmid of raw work, adopt the mono-clonal of BglII and NcoI single endonuclease digestion to EF gene and GH gene to detect respectively, all should produce the band of one ~ 5.3kb in theory.Carry out pcr amplification detection with gene-specific primer, positive colony can increase the band of a generation 2.6kb in theory; Enzyme cut detect and DNA electrophoresis result that PCR detects as shown in Figure 6, DNAmarker employing be ThermoFisherScientific Products SM0331, wherein three brighter bands are followed successively by 3kb, 1kb and 0.5kb from top to bottom.

The gene successful clone of detected result display EF and GH is in TTEK-pUC57 carrier.

Demonstrate effective use of TTEK-pUC57 as cloning vector effectively from above-mentioned example, it inserts transcription terminator sequences provided by the invention on pUC57 carrier, and the multiple clone site remained on pUC57 carrier, make improved carrier still can be widely used in clone, carrier for inserting transcription terminator sequences can be not limited to pUC57, and conventional escherichia coli vector can both use.

Claims (8)

1. a cloning vector, described cloning vector contains the transcription terminator that coding strand sequence is SEQIDNO:1.

2. cloning vector as claimed in claim 1, it is characterized in that, described cloning vector is E. coli cloning vector.

3. cloning vector as claimed in claim 1, it is characterized in that, the skeleton of described cloning vector is pUC57, and described transcription terminator sequences is arranged in the multiple clone site region of carrier.

4. the purposes of cloning vector in gene clone field as described in claim as arbitrary in claim 1-3.

5. purposes as claimed in claim 4, is characterized in that, described cloning vector is used for the clone of virulent gene or difficult gene.

6. a cloning process for virulent gene or difficult gene, for the cloning vector described in the arbitrary claim of claim 1-3 for carrier, described virulent gene or difficult gene clone are entered the downstream of the described transcription terminator in vector multiple cloning site.

7. a carrier, obtain for being cloned into foreign gene in the multiple clone site of the cloning vector described in the arbitrary claim of claim 1-3, the soybean mosaic virus polyprotein precursor gene that described foreign gene is selected from green fluorescence protein gene, encoding sequence is SEQIDNO.2 or encoding sequence are the soybean mosaic virus polyprotein gene of SEQIDNO.3, and described foreign gene is positioned at the downstream of the transcription terminator described in cloning vector.

8. verify that coding strand sequence is a method for the transcription terminator transcription effects of SEQIDNO:1, comprise the following steps:

1) encoding gene of green fluorescent protein GFP is cloned into the multiple clone site of pUC57 carrier, and is positioned at the downstream of pUC57 carrier lac promotor;

2) by coding strand sequence be the multiple clone site that the transcription terminator of SEQIDNO:1 and the encoding gene of green fluorescent protein GFP are all cloned into pUC57 carrier, described transcription terminator sequences is inserted into the downstream of lac promotor, the upstream region of green fluorescent protein initiator codon;

3) by step 1) and 2) carrier that obtains transformation of E. coli competent cell respectively, competent cell through transforming is coated with the ampicillin plate containing IPTG/X-Gal respectively, under natural light or under UV-light, observe the intensity of variation that can bacterium colony present green fluorescence and fluorescence intensity, reflected the efficiency of transcription terminator by the change of fluorescence intensity.