CN105219383A - Oligonucleotide functional fluorescence nano-sized carbon point, Preparation Method And The Use - Google Patents
Oligonucleotide functional fluorescence nano-sized carbon point, Preparation Method And The Use Download PDFInfo
- Publication number
- CN105219383A CN105219383A CN201410311309.2A CN201410311309A CN105219383A CN 105219383 A CN105219383 A CN 105219383A CN 201410311309 A CN201410311309 A CN 201410311309A CN 105219383 A CN105219383 A CN 105219383A
- Authority
- CN
- China
- Prior art keywords
- carbon point
- fluorescence nano
- oligonucleotide
- solution
- citric acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Luminescent Compositions (AREA)
Abstract
The invention belongs to field of nanometer material technology, be specifically related to a kind of oligonucleotide functional fluorescence nano-sized carbon point, preparation method and its usage.The invention still further relates to citric acid is that carbon source, end are through the fluorescence nano carbon point and uses thereof of carboxyl modified.Fluorescence nano carbon point of the present invention and oligonucleotide functional fluorescence nano-sized carbon point, preparation method is simply efficient, there is regulatable photoluminescent property, higher fluorescence quantum yield, have a good application prospect in fields such as biomarker, location, spike, sensing and targets.
Description
Technical field
The invention belongs to field of nanometer material technology, particularly, the present invention relates to a kind of oligonucleotide functional fluorescence nano-sized carbon point, Preparation Method And The Use.The invention still further relates to citric acid is that carbon source, end are through the fluorescence nano carbon point and uses thereof of carboxyl modified.
Background technology
Fluorescence nano carbon point (being called for short carbon point or fluorescent carbon point, CarbonDots, CDots) refers to carbon main body nanoparticle that is discrete, spherical or torispherical, particle diameter is generally in below 10nm (AngewChemIntEd2010,49 (38), 6726-6744), there is fluorescent stability high, flicker free phenomenon, excitation wavelength and emission wavelength controllable, good biocompatibility, toxicity is low, molecular weight and particle diameter little, the features such as synthetic method is simple, operational safety.Compare with traditional quantum dot, fluorescence nano carbon point all has very high advantage in chemical stability and bio-compatibility.Wide application prospect is possessed in biomarker, bio-imaging, photoelectric device Application Areas.
The preparation method of current fluorescence associated nano-sized carbon point mainly contains " from top to bottom " or " from bottom to top " two kinds of approach, the former mainly comprises arc discharge ashing method, electrochemical synthesis, laser ablation method etc., and the latter mainly comprises ashes hydrolysis method, high temperature cabonization method, Ultrasonic treatment, microwave assisting method, acid hydrolyzation, hydrothermal method, Template preparation method etc.But at present for the research of fluorescence nano carbon point than other carbon material as the research of carbon nanotube, soccerballene is not yet deep, lack simple synthetic method efficiently, fluorescence efficiency is still needed raising, in addition, the contribution etc. to fluorescence of its luminescence mechanism, surface ligand is still not clear, and all limits the widespread use of fluorescence nano carbon point.Such as, nitric acid method for hydrolysis after the use such as S.C.Ray candle ash deposition, has prepared the water soluble fluorescence nano-sized carbon point of mg level first, but its fluorescence quantum yield only about 3% (J.Phys.Chem.C2009,113,18546-18551); H.Peng etc. use sugar to be carbon source, and with the fluorescence nano carbon point that the effective passivation of Diamines material obtains after acid hydrolysis, its fluorescence quantum yield is only increased to 13% (Chem.Mater.2009,21,563-5565) etc.; In addition, based on the high degree of biocompatibility of CDots, develop fluorescence nano carbon point that is functional, targeting and become quite concerned study hotspot, but this technology is still in preliminary development stage at present.
Summary of the invention
The present inventor, through lot of experiments, has prepared fluorescence nano carbon point and oligonucleotide functional fluorescence nano-sized carbon point, and its preparation method is simple, efficient, this completes the present invention.
First aspect present invention relates to oligonucleotide functional fluorescence nano-sized carbon point, and its coupling on fluorescence nano carbon point has oligonucleotide fragment.
The oligonucleotide functional fluorescence nano-sized carbon point of any one according to a first aspect of the present invention, described fluorescence nano carbon point can in several ways with oligonucleotide fragment coupling.Described mode is decided by the end modified mode of fluorescence nano carbon point and oligonucleotide merit fragment, and such as described fluorescence nano carbon point can have carboxyl modified end, and such as described oligonucleotide fragment can have amino (-NH
2), hydroxyl amino (-NH (OH)), diazanyl (-NHNH), sulfydryl (-SH) or aldehyde radical (-CHO) modify end.Such as, and the coupling method of described fluorescence nano carbon point and oligonucleotide fragment is well known in the art, can carry out coupling by coupling agent.
Described coupling agent is well known in the art, it can be selected according to the end modified mode of fluorescence nano carbon point and oligonucleotide fragment, such as when for connecting carboxyl and N-terminal, described coupling agent can be EDC (1-ethyl-3-(3-dimethyl aminopropyl)-carbodiimide), or EDC/ (sulfo-) NHS (N-hydroxyl (sulfo-) succinimide), or DCC (N, N '-dicyclohexylcarbodiimide), or DCC/NHS, or DCC/HOBt (1-hydroxy benzo triazole) etc.When for connecting carboxyl and hydroxyl amino, described coupling agent can be selected from EDC or EDC/NHS.When for connecting carboxyl and diazanyl, described coupling agent can be selected from EDC or EDC/NHS.When for connecting carboxyl and sulfydryl, described coupling agent can be two step coupling agents, and the first step can be selected from EDC or EDC/ (sulfo-) NHS, and second step can be selected from PDEA (2-2 (pyridine two sulphur) ethamine); Also can be three step coupling agents, the first step can be selected from EDC or EDC/ (sulfo-) NHS, second step can be selected from quadrol, and the 3rd step can be selected from sulfo-GMBS (N-(4-maleimide oxidation butyryl)-succinimide sulfonate sodium).When for connecting carboxyl and aldehyde radical, coupling agent can be selected from EDC or EDC/ (sulfo-) NHS and hydrazine (NH
2nH
2).
In embodiments of the invention, described fluorescence nano carbon point is by amido linkage (-CO-NH-) and oligonucleotide fragment coupling.
The oligonucleotide functional fluorescence nano-sized carbon point of any one according to a first aspect of the present invention, its be have C-terminal fluorescence nano carbon point and there is aminoterminal oligonucleotide fragment prepared by coupling.
The oligonucleotide functional fluorescence nano-sized carbon point of any one according to a first aspect of the present invention, wherein said fluorescence nano carbon point take citric acid as carbon source.
The oligonucleotide functional fluorescence nano-sized carbon point of any one according to a first aspect of the present invention, wherein said fluorescence nano carbon point prepares in accordance with the following methods:
A) appropriate citric acid is got, heat, temperature rises to 150-300 DEG C from room temperature with uniform rate (such as 2-20 DEG C/min, such as 2 DEG C/min, 5 DEG C/min, 10 DEG C/min, 20 DEG C/min), such as 200 DEG C-250 DEG C, be held in this temperature and make citric acid carbonization (such as carbonization 1.5-3h, such as 2h), obtain carbide;
B) or get appropriate citric acid, obtain aqueous citric acid solution by water dissolution, be heated to 180-260 DEG C, such as 200 DEG C-240 DEG C, hydro-thermal reaction 1.5-3h, such as 2h;
C) get the carbide that step a) obtains, by water dissolution, obtain solution;
D) step b is got) or the c) solution that obtains, after the membrane filtration of suitable aperture, be that the dialysis membrane of 1000-3000 (such as 1000) is dialysed with cutoff;
E) collect dialyzate, freeze-drying, obtains solid, and this solid is fluorescence nano carbon point (or being called fluorescence nano carbon point material), optionally, obtains fluorescence nano carbon point solution with water dissolution preparation.
The oligonucleotide functional fluorescence nano-sized carbon point of any one according to a first aspect of the present invention, wherein step a) described in the method for carbonization be well known in the art, suitable inertia thermally resistant container such as can be utilized to heat.In embodiments of the invention, the method for described carbonization for heat in porcelain crucible.
The oligonucleotide functional fluorescence nano-sized carbon point of any one according to a first aspect of the present invention, wherein step b) in the concentration of aqueous citric acid solution can be that comparatively strong solution (such as > 0.2M) until saturated solution, such as, is 0.5M.
The oligonucleotide functional fluorescence nano-sized carbon point of any one according to a first aspect of the present invention, wherein step b) in be well known in the art to the method for solution heating, arbitrary confined reaction device such as can be utilized to carry out reacting by heating.In embodiments of the invention, heat in airtight water heating kettle.
The oligonucleotide functional fluorescence nano-sized carbon point of any one according to a first aspect of the present invention, wherein step c) in dissolved carbon compound time, repeatedly can to dissolve according to reality situation of dissolving, or ultrasonic dissolution.
The oligonucleotide functional fluorescence nano-sized carbon point of any one according to a first aspect of the present invention, wherein steps d) in refer to can the aperture of the tiny insoluble particulates of elimination in suitable aperture, such as aperture is 0.45 μm or 0.22 μm.
The oligonucleotide functional fluorescence nano-sized carbon point of any one according to a first aspect of the present invention, wherein said oligonucleotide fragment length is 5-200nt, such as, be 10-100nt, such as, be 20-80nt.
The oligonucleotide functional fluorescence nano-sized carbon point of any one according to a first aspect of the present invention, its particle diameter is 1-100nm, such as, be 10-30nm, such as, be 20-30nm.
In the present invention, when preparing solution, water used is well known in the art, such as, can be ultrapure water, deionized water etc.
In the present invention, the method for mixing solution is well known in the art, such as, can adopt the mode of evenly vibration.
Second aspect present invention relates to the preparation method of the oligonucleotide functional fluorescence nano-sized carbon point of any one of first aspect present invention, and it comprises the following steps:
1) get the oligonucleotide fragment of end modified (such as terminal amino group, hydroxyl amino, diazanyl, sulfydryl or aldehyde group modified) in right amount, be dissolved in suitable neutral amphotericeledrolyte damping fluid, cool rapidly after heat denatured;
2) the fluorescence nano carbon point solution of appropriate end through carboxyl modified is got, join through step 1) process after oligonucleotide solution in, mixing, optionally, also comprises the step of fluorescence nano carbon point solution being carried out to pre-ultrasonic disperse before joining oligonucleotide solution;
3) appropriate coupling agent (being such as EDC, EDC/ (sulfo-) NHS, DCC, DCC/ (sulfo-) NHS, DCC/HOBt, EDC/ (sulfo-) NHS+PDEA, EDC/ (sulfo-) NHS+ quadrol+sulfo-GMBS or EDC/ (sulfo-) NHS/ hydrazine) is added, reaction for some time, remove unreacted carbon point and excess of coupling agent in reacted solution, namely obtain oligonucleotide functional fluorescence nano-sized carbon point.
The preparation method of any one according to a second aspect of the present invention, wherein said neutral amphotericeledrolyte damping fluid can be selected according to concrete reaction type, such as refer to not containing primary amine group, the damping fluid of pH scope between 6.0-7.5, can be such as 2-(N-morpholine) ethyl sulfonic acid (MES) solution or HEPES solution, its concentration can be such as 0.1M; Appropriate neutral salt can be added in damping fluid; In embodiments of the invention, described damping fluid is the MES containing 0.1M, the solution of 0.5MNaCl, pH6.5.
The preparation method of any one according to a second aspect of the present invention, wherein step 1) in the method for oligonucleotide fragment sex change be well known in the art, such as in 95 DEG C of sex change 5min, be then cooled to rapidly 4 DEG C, namely can obtain the oligonucleotide fragment that sex change is strand.
The preparation method of any one according to a second aspect of the present invention, wherein step 3) in add coupling agent coupling method be well known in the art, described coupling agent can be selected according to the end modified mode of fluorescence nano carbon point and oligonucleotide fragment, such as when for connecting carboxyl and N-terminal, described coupling agent can be EDC (1-ethyl-3-(3-dimethyl aminopropyl)-carbodiimide), or EDC/NHS (N-hydroxy-succinamide), or DCC (N, N '-dicyclohexylcarbodiimide), or DCC/NHS, or DCC/HOBt (1-hydroxy benzo triazole) etc.When for connecting carboxyl and hydroxyl amino, described coupling agent can be selected from EDC or EDC/ (sulfo-) NHS.When for connecting carboxyl and diazanyl, described coupling agent can be selected from EDC or EDC/ (sulfo-) NHS.When for connecting carboxyl and sulfydryl, described coupling agent can be two step coupling agents, and the first step can be selected from EDC or EDC/ (sulfo-) NHS, and second step is selected from PDEA; Also can be three step coupling agents, the first step can be selected from EDC or EDC/ (sulfo-) NHS, and second step can be selected from quadrol, and the 3rd step can be selected from sulfo-GMBS.When for connecting carboxyl and aldehyde radical, coupling agent can be selected from EDC or EDC/ (sulfo-) NHS and hydrazine.
In embodiments of the invention, the fluorescence nano carbon point that terminal carboxyl(group) is modified and the oligonucleotide fragment that terminal amino group is modified carry out coupling by forming amido linkage (-CO-NH-), such as, the mode of coupling agent can be adopted to carry out coupling by single stage method or two-step approach.
The preparation method of any one, wherein step 3 according to a second aspect of the present invention) in reaction for some time can determine according to concrete reaction conditions, can be such as 4 DEG C reaction 24-48h, or be 25 DEG C or 37 DEG C reaction 0.5h-2h.
The preparation method of any one according to a second aspect of the present invention, wherein step 3) in remove unreacted carbon point and excess of coupling agent in reacted solution method be well known in the art, the method of ultrafiltration such as can be adopted to remove, and the cutoff of ultrafiltration is such as 3kD.
The preparation method of any one according to a second aspect of the present invention, can according to the length adjustment consumption therebetween of the molecular weight of fluorescence nano carbon point and oligonucleotide fragment.In embodiments of the invention, the 10mg/mL fluorescence nano carbon point solution getting 10 μ L adds in the oligonucleotide fragment solution of 6OD.
The preparation method of any one according to a second aspect of the present invention, wherein said end prepares in accordance with the following methods through the fluorescence nano carbon point of carboxyl modified:
A) appropriate citric acid is got, heat, temperature rises to 150-300 DEG C from room temperature with uniform rate (such as 2-20 DEG C/min, such as 2 DEG C/min, 5 DEG C/min, 10 DEG C/min, 20 DEG C/min), such as 200 DEG C-250 DEG C, be held in this temperature and make citric acid carbonization (such as carbonization 1.5-3h, such as 2h), obtain carbide;
B) or get appropriate citric acid, obtain aqueous citric acid solution by water dissolution, be heated to 180-260 DEG C, such as 200 DEG C-240 DEG C, hydro-thermal reaction 1.5-3h, such as 2h;
C) get the carbide that step a) obtains, by water dissolution, obtain solution;
D) step b is got) or the c) solution that obtains, after the membrane filtration of suitable aperture, be that the dialysis membrane of 1000-3000 (such as 1000) is dialysed with cutoff;
E) dialyzate is collected, freeze-drying, obtains solid, and this solid is the fluorescence nano carbon point (or be called fluorescence nano carbon point material) of end through carboxyl modified, optionally, the fluorescence nano carbon point solution of end through carboxyl modified is obtained with water dissolution preparation.
The preparation method of any one according to a second aspect of the present invention, wherein step a) described in the method for carbonization be well known in the art, suitable inertia thermally resistant container such as can be utilized to heat.In embodiments of the invention, the method for described carbonization for heat in porcelain crucible.
The preparation method of any one, wherein step b according to a second aspect of the present invention) in the concentration of aqueous citric acid solution can be that comparatively strong solution (such as > 0.2M) until saturated solution, such as, is 0.5M.
The preparation method of any one, wherein step b according to a second aspect of the present invention) in solution heating method be well known in the art, arbitrary confined reaction device such as can be utilized to heat.In embodiments of the invention, heat in airtight water heating kettle.
The preparation method of any one, wherein step c according to a second aspect of the present invention) in dissolved carbon compound time, repeatedly can to dissolve according to reality situation of dissolving, or ultrasonic dissolution.
The preparation method of any one, wherein steps d according to a second aspect of the present invention) in refer to can the aperture of the tiny insoluble particulates of elimination in suitable aperture, such as aperture is 0.45 μm or 0.22 μm.
The preparation method of any one according to a second aspect of the present invention, wherein said oligonucleotide fragment length is 5-200nt, such as, be 10-100nt, such as, be 20-80nt.
The preparation method of any one according to a second aspect of the present invention, wherein said oligonucleotide functional fluorescence nano-sized carbon point particle diameter is 1-100nm, and being such as 10-30nm, such as, is 20-30nm.
In the present invention, when preparing solution, water used is well known in the art, such as, can be ultrapure water, deionized water etc.
In the present invention, the method for mixing solution is well known in the art, such as, can adopt the mode of evenly vibration.
Because oligonucleotide functional fluorescence nano-sized carbon point can be used as the effective fluorescent bio-probes of a class, the functionalization characteristic of oligonucleotide binding self, thus it is selectively targeted on the target molecule of organoid aspect, the wavelength-modulated characteristic of combined with fluorescent nano-sized carbon point, this fluorescent bio-probes presents distinct colors under the optical excitation of different wave length, thus is convenient to the object such as spike, location.Therefore third aspect present invention relate to the oligonucleotide functional fluorescence nano-sized carbon point of any one of first aspect present invention in vivo/the external purposes for mark, spike, location, sensing or target (such as target after birth, endochylema or karyon).
In embodiments of the invention, the 39nt covalent coupling of target EPO/EPOR is to fluorescence nano carbon point surface, and the oligonucleotide functional fluorescence nano-sized carbon point of formation can on the active targeting after birth that is attached to high expression level EPO/EPOR in viable cell and endochylema.
Fourth aspect present invention relates to a kind of fluorescence nano carbon point, and it prepares by the following method:
A) appropriate citric acid is got, heat, temperature rises to 150-300 DEG C from room temperature with uniform rate (such as 2-20 DEG C/min, such as 2 DEG C/min, 5 DEG C/min, 10 DEG C/min, 20 DEG C/min), such as 200 DEG C-250 DEG C, be held in this temperature and make citric acid carbonization (such as carbonization 1.5-3h, such as 2h), obtain carbide;
B) or get appropriate citric acid, obtain aqueous citric acid solution by water dissolution, be heated to 180-260 DEG C, such as 200 DEG C-240 DEG C, hydro-thermal reaction 1.5-3h, such as 2h;
C) get the carbide that step a) obtains, by water dissolution, obtain solution;
D) step b is got) or the c) solution that obtains, after the membrane filtration of suitable aperture, be that the dialysis membrane of 1000-3000 (such as 1000) is dialysed with cutoff;
E) collect dialyzate, freeze-drying, obtains solid, and this solid is fluorescence nano carbon point (or being called fluorescence nano carbon point material), optionally, obtains fluorescence nano carbon point solution with water dissolution preparation.
The fluorescence nano carbon point of any one according to a fourth aspect of the present invention, wherein step a) described in the method for carbonization be well known in the art, suitable inertia thermally resistant container such as can be utilized to heat.In embodiments of the invention, the method for described carbonization for heat in porcelain crucible.
The fluorescence nano carbon point of any one according to a fourth aspect of the present invention, wherein step b) in the concentration of aqueous citric acid solution can be that comparatively strong solution (such as > 0.2M) until saturated solution, such as, is 0.5M.
The fluorescence nano carbon point of any one according to a fourth aspect of the present invention, wherein step b) in be well known in the art to the method for solution heating, arbitrary confined reaction device such as can be utilized to heat.In embodiments of the invention, heat in airtight water heating kettle.
The fluorescence nano carbon point of any one according to a fourth aspect of the present invention, wherein step c) in dissolved carbon compound time, repeatedly can to dissolve according to reality situation of dissolving, or ultrasonic dissolution.
The fluorescence nano carbon point of any one according to a fourth aspect of the present invention, wherein steps d) in refer to can the aperture of the tiny insoluble particulates of elimination in suitable aperture, such as aperture is 0.45 μm or 0.22 μm.
The fluorescence nano carbon point of any one according to a fourth aspect of the present invention, its particle diameter is 1-100nm, such as, be 10-30nm, such as, be 20-30nm.
The invention still further relates to the fluorescence nano carbon point of any one of fourth aspect present invention in vivo/external for marking, spike, location or sensing purposes.
In embodiments of the invention, citric acid is utilized to prepare fluorescence nano carbon point.The chemistry of citric acid is called 2-hydroxy propane-1,2,3-tricarboxylic acid, and when molecule aggregation becomes carbon point, generally to be polymerized between C molecular skeleton, the exposed function base at outside surface then great majority, may doped with portion distal end hydroxyl based on terminal carboxyl(group).
The beneficial effect of the invention
Fluorescence nano carbon point of the present invention and oligonucleotide functional fluorescence nano-sized carbon point, its syntheti c route simple and effective, there is regulatable photoluminescent property, higher fluorescence quantum yield, have a good application prospect in fields such as biomarker, spike, location, sensing and targets (such as target after birth, endochylema or karyon).
Accompanying drawing explanation
In following figure, CDots represents fluorescence nano carbon point, and ODN-CDots represents oligonucleotide functional fluorescence nano-sized carbon point.
Fig. 1. uv-vis spectra (UV-Vis) spectrogram of fluorescence nano carbon point and oligonucleotide functional fluorescence nano-sized carbon point
Fig. 2. the fluorescence spectrum of fluorescence nano carbon point and oligonucleotide functional fluorescence nano-sized carbon point
Fig. 3. the electrophoretogram of fluorescence nano carbon point and oligonucleotide functional fluorescence nano-sized carbon point, 15% native polyacrylamide gel electrophoresis (PAGE)
A) before ethidium bromide (EB) dyeing; B) after EB dyeing; Swimming lane 1: fluorescence nano carbon point; Swimming lane 2: oligonucleotide functional fluorescence nano-sized carbon point
Fig. 4. the fluorescent modulation characteristic of oligonucleotide functional fluorescence nano-sized carbon point
Fig. 5. the fluorescent stability of oligonucleotide functional fluorescence nano-sized carbon point
Fig. 6. transmission electron microscope (TEM) figure of oligonucleotide functional fluorescence nano-sized carbon point, wherein scale is 100nm
Fig. 7. view under the fluorescent microscope of oligonucleotide functional fluorescence nano-sized carbon point
Fig. 8. viable cell laser co-focusing micro-(Confocal) image of oligonucleotide functional fluorescence nano-sized carbon point
505-530nm passage, light field, 560nm passage is respectively to upper right from upper left;
Be respectively 465-510 passage, 4,6-diamidines-2-phenylindone (DAPI) dyeing and stacking diagram to bottom right from lower-left.
Embodiment
Below in conjunction with embodiment, embodiment of the present invention are described in detail, but it will be understood to those of skill in the art that the following example only for illustration of the present invention, and should not be considered as limiting scope of the present invention.Unreceipted actual conditions person in embodiment, the condition of conveniently conditioned disjunction manufacturers suggestion is carried out.Agents useful for same or the unreceipted production firm person of instrument, being can by the conventional products of commercial acquisition.
embodiment 1.end is through the preparation of the fluorescence nano carbon point 17A-B of carboxyl modified
Get 1.051g citric acid, join in porcelain crucible, rise to 200 DEG C from 25 DEG C of beginning employings, 5 DEG C/min speed, be held in 200 DEG C, carbonization 2h; The carbide obtained, repeatedly with ultrapure water dissolving, ultrasonic extremely dissolving; After 0.22 μm of aperture membrane filtration, take cutoff as the dialysis membrane of 1000 (Mwcut-off1kD), dialysed overnight; Collect dialyzate, freeze-drying, obtains brownish black fluffy solid, and taking quality is 12mg, dissolves the fluorescence nano carbon point aqueous solution that preparation obtains 10mg/mL, namely obtain the fluorescence nano carbon point 17A-B of end through carboxyl modified with ultrapure water.
embodiment 2end is through the preparation of the fluorescence nano carbon point 17C-D of carboxyl modified
Get 2.102g citric acid, join in porcelain crucible, rise to 200 DEG C from 25 DEG C of beginning employings, 5 DEG C/min speed, be held in 200 DEG C, carbonization 2h; The carbide obtained, repeatedly with ultrapure water dissolving, ultrasonic extremely dissolving; After 0.22 μm of aperture membrane filtration, take cutoff as the dialysis membrane of 1000 (Mwcut-off1kD), dialysed overnight; Collect dialyzate, freeze-drying, obtains brownish black fluffy solid, and taking quality is 16mg, dissolves the fluorescence nano carbon point aqueous solution that preparation obtains 10mg/mL, namely obtain the fluorescence nano carbon point 17C-D of end through carboxyl modified with ultrapure water;
embodiment 3end is through the preparation of the fluorescence nano carbon point 17G of carboxyl modified
Get 2.102g citric acid, dissolve the aqueous citric acid solution obtaining 0.5M with 20mL ultrapure water, in airtight water heating kettle, 200 DEG C, hydro-thermal reaction 2h; The carbide obtained, repeatedly with ultrapure water dissolving, ultrasonic extremely dissolving; After 0.22 μm of aperture membrane filtration, take cutoff as the dialysis membrane of 1000 (Mwcut-off1kD), dialysed overnight; Collect dialyzate, freeze-drying, obtains brownish black fluffy solid, and taking quality is 2mg, dissolves the fluorescence nano carbon point aqueous solution that preparation obtains 10mg/mL, namely obtain the fluorescence nano carbon point 17G of end through carboxyl modified with ultrapure water;
embodiment 4.the preparation of oligonucleotide functional fluorescence nano-sized carbon point
Get the oligonucleotide (NH that 6OD terminal amino group is modified
2-ODN), be dissolved in the MES of 0.1M, the damping fluid 150 μ L of 0.5MNaCl, pH6.5, in 95 DEG C of sex change 5min, is cooled to rapidly 4 DEG C;
The oligonucleotide herein selected comprises: the 39nt of target EPO/EPOR is (see ZhangZ, GuoL, GuoA, XuH, TangJ, GuoX, XieJ.Invitrolectin-mediatedselectionandcharacterizationo frHuEPO-α-bindingssDNAaptamers.Bioorg.Med.Chem.2010, 18, 8016-8025), 5 ' end adds the connecting arm of 9A, total length 48nt, sequence is AAAAAAAAAGATTGAAAGGTCTGTTTTTGGGGTTGGTTTGGGTCAATA, SEQIDNO:1), C6-8 (length the 48nt) (GGTACTTCCATTTGTGTTTGCCCGGAGCCTTAGTCTGTTCAAAAGTGC of target karyon albumen, SEQIDNO:2), random NegControl sequence (length 48nt, sequence is ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT, SEQIDNO:3).
Get 10 μ L17A-B again, pre-ultrasonic disperse 10min, join above-mentioned 150 μ LNH
2in-ODN solution, then add the MES buffered soln of 0.1M, the damping fluid 40 μ L of 0.5MNaCl, pH6.5, in 37 DEG C of 30min that evenly vibrate after mixing;
Add 10mgEDC (1-ethyl-3-(3-dimethyl aminopropyl)-carbodiimide) coupling agent, in 4 DEG C of even oscillatory reaction 48h, obtain light yellow to yellow solution;
Carry out ultrafiltration (cutoff of ultra-filtration membrane is 3kD) again, remove unreacted fluorescence nano carbon point and excess of coupling agent, upper liquid is oligonucleotide functional fluorescence nano-sized carbon point.
Oligonucleotide functional fluorescence nano-sized carbon point is different according to selected oligonucleotide sequence, called after respectively, Y111 (C6-8 functional fluorescence nano-sized carbon point), Y112 (9A-39nt functional fluorescence nano-sized carbon point) and Y113 (NegControl functional fluorescence nano-sized carbon point).
Another parallel preparation is a collection of, respectively called after, Y131 (C6-8 functional fluorescence nano-sized carbon point), Y132 (9A-39nt functional fluorescence nano-sized carbon point) and Y133 (NegControl functional fluorescence nano-sized carbon point).
embodiment 5.the ultraviolet-visible spectrum analysis of fluorescence nano carbon point and oligonucleotide functional fluorescence nano-sized carbon point
Get 17A-B10 μ L, add 190 μ L ultrapure waters, mix; Separately get Y11210 μ L, add 190 μ L ultrapure waters, mix; Get 100 μ L respectively, be transferred in the microcell of 100 μ L, scan the uv-vis spectra of its 200-800nm.Result as shown in Figure 1.17A-B is typical end absorption, Y112 after oligonucleotide functionalization then presents existence one maximum absorption band, its maximum absorption wavelength is 260nm, consistent with the characteristic wavelength of oligonucleotide, illustrates that oligonucleotide fragment is successfully coupled to fluorescence nano carbon point surface.
embodiment 6.the fluorescent spectroscopy of fluorescence nano carbon point and oligonucleotide functional fluorescence nano-sized carbon point
Get 17A-B10 μ L, add 190 μ L ultrapure waters, mix; Separately get Y11210 μ L, add 190 μ L ultrapure waters, mix; Be transferred in the particle fluorescence pond of 200 μ L respectively, fluorescence slit width is set to 5nm (exciting Ex), and 5nm (launching Em), scans the fluorescence spectrum of its 200-800nm.Result as shown in Figure 2.The excitation/emission maximum wavelength of 17A-B is respectively Ex395nm/Em460nm; The excitation/emission maximum wavelength of Y112 is respectively Ex378nm/Em458nm.
embodiment 7.15% Native PAGE analysis of fluorescence nano carbon point and oligonucleotide functional fluorescence nano-sized carbon point
Get 17A-B10 μ L, Y11210 μ L, add respectively sample-loading buffer (6 ×: 0.25% tetrabromophenol sulfonphthalein, 30% glycerine) 2 μ L, in 1 × TBE, carry out 15% Native PAGE analysis, electrophoresis 35min under 170V, moves to tetrabromophenol sulfonphthalein forward position and arrives the stopping of gel middle and lower part.Take off gel, carry out ultraviolet gel imaging.And then gel is immersed in ethidium bromide (0.1%) staining fluid, take out after 1-2min, again carry out ultraviolet gel imaging.
Result as shown in Figure 3.Swimming lane 1 is 17A-B, and swimming lane 2 is Y112; A figure is before EB dyeing, and b figure is the gel imaging figure after EB dyeing.17A-B and Y112 all has comparatively hyperfluorescenceZeng Yongminggaoyingguang, and 17A-B is high far beyond Y112 mobility.After EB dyeing, there is oligonucleotide band in Y112 band same position, illustrates that oligonucleotide fragment is successfully coupled to fluorescence nano carbon point surface.
embodiment 8.the fluorescent modulation characteristic of oligonucleotide functional fluorescence nano-sized carbon point
Get Y11210 μ L, add 190 μ L ultrapure waters, mix; Be transferred in the particle fluorescence pond of 200 μ L, fluorescence slit width is set to 5nm (exciting Ex), and 10nm (launching Em), scans the fluorescence spectrum of its 200-800nm; And set excitation wavelength and start stepping 20nm at its maximum excitation wavelength place, gather the fluorescence spectrum of its 200-800nm.Result as shown in Figure 4.
Visible oligonucleotide functional fluorescence nano-sized carbon point has regulatable photoluminescent property, excites, all can obtain certain emmission spectrum within the scope of 380-520nm, suitable to polychromatic probe.
embodiment 9.the fluorescent stability of oligonucleotide functional fluorescence nano-sized carbon point and fluorescence quantum yield
Get Y11210 μ L, add 190 μ L ultrapure waters, mix; Be transferred in the particle fluorescence pond of 200 μ L, fluorescence slit width is set to 5nm (exciting Ex), and 5nm (launching Em), is set in 378nm place and excites, collect the fluorescence response value at its 458nm place every 10s, collect 3600s (60min) altogether.Result as shown in Figure 5.Illustrate that the fluorescent stability of this oligonucleotide functional fluorescence nano-sized carbon point is stronger.
With rhodamine 110 (its fluorescence quantum yield is for 31%) for contrast, the fluorescence quantum yield calculating Y112 is 26%.Illustrate that the preparation method of this oligonucleotide functional fluorescence nano-sized carbon point is comparatively efficient.
embodiment 10.the TEM (transmission electron microscope) analysis of oligonucleotide functional fluorescence nano-sized carbon point
Appoint and get obtained Y131, add 300 μ L ultrapure waters, super filter tube (cutoff of ultra-filtration membrane is 3kD) upper strata is added to after mixing, under 14000rpm, centrifugal 30min, discards lower floor, and 5 times with except after the interference of desalting repeatedly, dilute 5 times, and after ultrasonic 10min, drop on copper mesh, with its form of TEM (transmission electron microscope) analysis and particle diameter.Result as shown in Figure 6.
Oligonucleotide functional fluorescence nano-sized carbon point is spherical in shape, and size is comparatively homogeneous, and particle diameter is within the scope of 25 ± 10nm.
embodiment 11.analyze under the fluorescent microscope of oligonucleotide functional fluorescence nano-sized carbon point
Appoint and get 10 μ LY132, add 190 μ L ultrapure waters, mix; Drop on slide glass and carry out observing under fluorescent microscope.Result as shown in Figure 7.
Visible under each Color Channel (330-385nm blue light, 480-485nm green glow, 510-515nm ruddiness), oligonucleotide functional fluorescence nano-sized carbon point all can produce intense fluorescence.
embodiment 12.viable cell copolymerization Jiao micro-(Confocal) imaging analysis of oligonucleotide functional fluorescence nano-sized carbon point
The Hela cell of logarithmic phase is added the digestion of appropriate trypsin solution, be prepared into single cell suspension, adjustment cell concn, be inoculated in cell compartments with the amount of 5000 cells/well, after incubated overnight, hatch by Y111, Y112, Y113,17A-B group and tumour cell, incubation buffer is 100 μ L/ hole (1 × PBS-1mMMgCl
2), after 37 DEG C of cultivation 60min, after DAPI room temperature dyeing 15min, Confocal observes.Result as shown in Figure 8.
Depend on the difference of different oligonucleotide aptamers targeting proteins, the fluorescence nano carbon point of this oligonucleotide functionalization can directly to endochylema or karyon, be modified as 39nt and the Y112 group that obtains only is targeted to tumour cell after birth and the part endochylema of EPO/EPOR high expression level by target; The Y111 group major part that C6-8 modifies and obtains is targeted to karyon; The Y113 group that unrelated sequences NegControl modifies and obtains is substantially without location, and reason is to create between the negative charge of oligonucleotide self and the negative charge of after birth larger repulsion; 17A-B group only has minority target to after birth and endochylema, and this is directly related with its characteristic as nanoparticle.
Although the specific embodiment of the present invention has obtained detailed description, it will be understood to those of skill in the art that.According to disclosed all instructions, can carry out various amendment and replacement to those details, these change all within protection scope of the present invention.Four corner of the present invention is provided by claims and any equivalent thereof.
Claims (13)
1. oligonucleotide functional fluorescence nano-sized carbon point, its coupling on fluorescence nano carbon point has oligonucleotide fragment.
2. the oligonucleotide functional fluorescence nano-sized carbon point of claim 1, it is that the fluorescence nano carbon point with carboxyl modified end forms with the oligonucleotide fragment coupling with amino, hydroxyl amino, diazanyl, sulfydryl or aldehyde group modified end.
3. the oligonucleotide functional fluorescence nano-sized carbon point of claim 2, described fluorescence nano carbon point is by amido linkage (-CO-NH-) and oligonucleotide fragment coupling.
4. the oligonucleotide functional fluorescence nano-sized carbon point of any one of claim 1-3, wherein said fluorescence nano carbon point take citric acid as carbon source.
5. the oligonucleotide functional fluorescence nano-sized carbon point of claim 4, wherein said fluorescence nano carbon point prepares in accordance with the following methods:
A) appropriate citric acid is got, heat, temperature rises to 150-300 DEG C from room temperature with uniform rate (such as 2-20 DEG C/min, such as 2 DEG C/min, 5 DEG C/min, 10 DEG C/min, 20 DEG C/min), such as 200 DEG C-250 DEG C, be held in this temperature and make citric acid carbonization (such as carbonization 1.5-3h, such as 2h), obtain carbide;
B) or get appropriate citric acid, obtain aqueous citric acid solution by water dissolution, be heated to 180-260 DEG C, such as 200 DEG C-240 DEG C, hydro-thermal reaction 1.5-3h, such as 2h;
C) get the carbide that step a) obtains, by water dissolution, obtain solution;
D) step b is got) or the c) solution that obtains, after the membrane filtration of suitable aperture, be that the dialysis membrane of 1000-3000 (such as 1000) is dialysed with cutoff;
E) collect dialyzate, freeze-drying, obtains solid, and this solid is fluorescence nano carbon point (or being called fluorescence nano carbon point material), optionally, obtains fluorescence nano carbon point solution with water dissolution preparation.
6. the oligonucleotide functional fluorescence nano-sized carbon point of any one of claim 1-3, wherein said oligonucleotide fragment length is 5-200nt, such as, be 10-100nt, such as, be 20-80nt.
7. the oligonucleotide functional fluorescence nano-sized carbon point of any one of claim 1-3, its particle diameter is 1-100nm, such as, be 10-30nm, such as, be 20-30nm.
8. the preparation method of the oligonucleotide functional fluorescence nano-sized carbon point of any one of claim 3-7, it comprises the following steps:
1) get the oligonucleotide fragment of end modified (such as terminal amino group, hydroxyl amino, diazanyl, sulfydryl or aldehyde group modified) in right amount, be dissolved in suitable neutral amphotericeledrolyte damping fluid, cool rapidly after heat denatured;
2) the fluorescence nano carbon point solution of appropriate end through carboxyl modified is got, then join through step 1) process after oligonucleotide solution in, mixing, optionally, also comprises the step of fluorescence nano carbon point solution being carried out to pre-ultrasonic disperse before joining oligonucleotide solution;
3) appropriate coupling agent (such as EDC, EDC/NHS, DCC, DCC/NHS or DCC/HOBt coupling agent) is added, reaction for some time, remove unreacted carbon point and excess of coupling agent in reacted solution, namely obtain oligonucleotide functional fluorescence nano-sized carbon point.
9. the preparation method of claim 8, wherein said end prepares in accordance with the following methods through the fluorescence nano carbon point of carboxyl modified:
A) appropriate citric acid is got, heat, temperature rises to 150-300 DEG C from room temperature with uniform rate (such as 2-20 DEG C/min, such as 2 DEG C/min, 5 DEG C/min, 10 DEG C/min, 20 DEG C/min), such as 200 DEG C-250 DEG C, be held in this temperature and make citric acid carbonization (such as carbonization 1.5-3h, such as 2h), obtain carbide;
B) or get appropriate citric acid, obtain aqueous citric acid solution by water dissolution, be heated to 180-260 DEG C, such as 200 DEG C-240 DEG C, hydro-thermal reaction 1.5-3h, such as 2h;
C) get the carbide that step a) obtains, by water dissolution, obtain solution;
D) step b is got) or the c) solution that obtains, after the membrane filtration of suitable aperture, be that the dialysis membrane of 1000-3000 (such as 1000) is dialysed with cutoff;
E) collect dialyzate, freeze-drying, obtains solid, this solid is the fluorescence nano carbon point (or be called fluorescence nano carbon point material) of end through carboxyl modified, optionally, obtains the fluorescence nano carbon point solution of end through carboxyl modified with water dissolution preparation.
10. the oligonucleotide functional fluorescence nano-sized carbon point of any one of claim 1-7 in vivo/external for marking, spike, location, sensing or target purposes.
11. 1 kinds of fluorescence nano carbon points, it prepares by the following method:
A) appropriate citric acid is got, heat, temperature rises to 150-300 DEG C from room temperature with uniform rate (such as 2-20 DEG C/min, such as 2 DEG C/min, 5 DEG C/min, 10 DEG C/min, 20 DEG C/min), such as 200 DEG C-250 DEG C, be held in this temperature and make citric acid carbonization (such as carbonization 1.5-3h, such as 2h), obtain carbide;
B) or get appropriate citric acid, obtain aqueous citric acid solution by water dissolution, be heated to 180-260 DEG C, such as 200 DEG C-240 DEG C, hydro-thermal reaction 1.5-3h, such as 2h;
C) get the carbide that step a) obtains, by water dissolution, obtain solution;
D) step b is got) or the c) solution that obtains, after the membrane filtration of suitable aperture, be that the dialysis membrane of 1000-3000 (such as 1000) is dialysed with cutoff;
E) collect dialyzate, freeze-drying, obtains solid, and this solid is fluorescence nano carbon point (or being called fluorescence nano carbon point material), optionally, obtains fluorescence nano carbon point solution with water dissolution preparation.
The fluorescence nano carbon point of 12. claims 11, its particle diameter is 1-100nm, such as, be 10-30nm, such as, be 20-30nm.
The fluorescence nano carbon point of 13. claims 11 or 12 in vivo/external for marking, spike, location or sensing purposes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410311309.2A CN105219383A (en) | 2014-07-02 | 2014-07-02 | Oligonucleotide functional fluorescence nano-sized carbon point, Preparation Method And The Use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410311309.2A CN105219383A (en) | 2014-07-02 | 2014-07-02 | Oligonucleotide functional fluorescence nano-sized carbon point, Preparation Method And The Use |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105219383A true CN105219383A (en) | 2016-01-06 |
Family
ID=54988668
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410311309.2A Pending CN105219383A (en) | 2014-07-02 | 2014-07-02 | Oligonucleotide functional fluorescence nano-sized carbon point, Preparation Method And The Use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105219383A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107840319A (en) * | 2016-09-20 | 2018-03-27 | 首都医科大学 | A kind of nitrogenous carbon point and its synthetic method and its application in terms of cell marking imaging |
| CN108519360A (en) * | 2017-11-16 | 2018-09-11 | 华侨大学 | The kit of terramycin in a kind of detection water |
| CN110387233A (en) * | 2019-08-08 | 2019-10-29 | 西南大学 | A kind of simple mass producible green fluorescent carbon dots and its preparation method and application |
| CN111662243A (en) * | 2020-05-28 | 2020-09-15 | 广州大学 | Citric acid-based functionalized carbon dot corrosion inhibitor and preparation method and application thereof |
| CN113440607A (en) * | 2021-06-30 | 2021-09-28 | 澳门大学 | Full-target antigen presenting cell tumor vaccine and preparation method and application thereof |
| CN113797356A (en) * | 2020-06-17 | 2021-12-17 | 广东量子墨滴生物科技有限公司 | Carbon nano composite biological preparation, preparation method and application |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2060916A1 (en) * | 2006-09-14 | 2009-05-20 | Konica Minolta Medical & Graphic, Inc. | Fluorescent semiconductor microparticle assembly, fluorescent labeling agent assembly for biological substance, and bioimaging method and biological substance analysis method using the assemblies |
| CN103693633A (en) * | 2013-12-04 | 2014-04-02 | 上海交通大学 | Method for green synthesis of fluorescent chiral carbon dots |
| CN103771390A (en) * | 2014-01-06 | 2014-05-07 | 上海交通大学 | Method for synthesizing carbon quantum dot by using biologic active enzyme auxiliary microwave method, carbon quantum dot prepared by using method, and application thereof |
| CN103787299A (en) * | 2014-01-02 | 2014-05-14 | 南京航空航天大学 | Method for preparing high-brightness fluorescent carbon dots with single organic solvent by hot reflux method |
| CN103834397A (en) * | 2014-03-11 | 2014-06-04 | 太原理工大学 | Method for preparing water-soluble fluorescent carbon dots |
| CN103834727A (en) * | 2014-01-26 | 2014-06-04 | 浙江师范大学 | Preparation method of fluorescence probe and applications of the fluorescence probe |
| CN103881701A (en) * | 2013-12-30 | 2014-06-25 | 安徽师范大学 | Phosphorescent energy transfer system, synthetic method and use of system and detection method of thrombin |
-
2014
- 2014-07-02 CN CN201410311309.2A patent/CN105219383A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2060916A1 (en) * | 2006-09-14 | 2009-05-20 | Konica Minolta Medical & Graphic, Inc. | Fluorescent semiconductor microparticle assembly, fluorescent labeling agent assembly for biological substance, and bioimaging method and biological substance analysis method using the assemblies |
| CN103693633A (en) * | 2013-12-04 | 2014-04-02 | 上海交通大学 | Method for green synthesis of fluorescent chiral carbon dots |
| CN103881701A (en) * | 2013-12-30 | 2014-06-25 | 安徽师范大学 | Phosphorescent energy transfer system, synthetic method and use of system and detection method of thrombin |
| CN103787299A (en) * | 2014-01-02 | 2014-05-14 | 南京航空航天大学 | Method for preparing high-brightness fluorescent carbon dots with single organic solvent by hot reflux method |
| CN103771390A (en) * | 2014-01-06 | 2014-05-07 | 上海交通大学 | Method for synthesizing carbon quantum dot by using biologic active enzyme auxiliary microwave method, carbon quantum dot prepared by using method, and application thereof |
| CN103834727A (en) * | 2014-01-26 | 2014-06-04 | 浙江师范大学 | Preparation method of fluorescence probe and applications of the fluorescence probe |
| CN103834397A (en) * | 2014-03-11 | 2014-06-04 | 太原理工大学 | Method for preparing water-soluble fluorescent carbon dots |
Non-Patent Citations (1)
| Title |
|---|
| 陈清爱: "基于量子点的金属离子检测和碳点的制备及其发光研究", 《福建农林大学硕士学位论文》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107840319A (en) * | 2016-09-20 | 2018-03-27 | 首都医科大学 | A kind of nitrogenous carbon point and its synthetic method and its application in terms of cell marking imaging |
| CN108519360A (en) * | 2017-11-16 | 2018-09-11 | 华侨大学 | The kit of terramycin in a kind of detection water |
| CN110387233A (en) * | 2019-08-08 | 2019-10-29 | 西南大学 | A kind of simple mass producible green fluorescent carbon dots and its preparation method and application |
| CN111662243A (en) * | 2020-05-28 | 2020-09-15 | 广州大学 | Citric acid-based functionalized carbon dot corrosion inhibitor and preparation method and application thereof |
| CN113797356A (en) * | 2020-06-17 | 2021-12-17 | 广东量子墨滴生物科技有限公司 | Carbon nano composite biological preparation, preparation method and application |
| WO2021253470A1 (en) * | 2020-06-17 | 2021-12-23 | 广东量子墨滴生物科技有限公司 | Carbon nanocomposite biological agent and preparation method and application therefor |
| CN113440607A (en) * | 2021-06-30 | 2021-09-28 | 澳门大学 | Full-target antigen presenting cell tumor vaccine and preparation method and application thereof |
| WO2023274299A1 (en) * | 2021-06-30 | 2023-01-05 | 澳门大学 | Full-target antigen-presenting cell tumor vaccine, and preparation method therefor and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105219383A (en) | Oligonucleotide functional fluorescence nano-sized carbon point, Preparation Method And The Use | |
| Zhang et al. | Mitochondrial specific photodynamic therapy by rare-earth nanoparticles mediated near-infrared graphene quantum dots | |
| Xu et al. | Integration of IR‐808 sensitized upconversion nanostructure and MoS2 nanosheet for 808 nm NIR light triggered phototherapy and bioimaging | |
| Gulzar et al. | Nano-graphene oxide-UCNP-Ce6 covalently constructed nanocomposites for NIR-mediated bioimaging and PTT/PDT combinatorial therapy | |
| Zhao et al. | High quantum yield Ag 2 S quantum dot@ polypeptide-engineered hybrid nanogels for targeted second near-infrared fluorescence/photoacoustic imaging and photothermal therapy | |
| Chinnathambi et al. | Silicon quantum dots for biological applications | |
| Tong et al. | Amorphous carbon dots with high two-photon fluorescence for cellular imaging passivated by hyperbranched poly (amino amine) | |
| US20220001032A1 (en) | Coated up-conversion nanoparticles | |
| Shen et al. | Lanthanide-doped upconverting luminescent nanoparticle platforms for optical imaging-guided drug delivery and therapy | |
| Zhou et al. | Recent insights into near-infrared light-responsive carbon dots for bioimaging and cancer phototherapy | |
| Wu et al. | High performance photosensitizers with aggregation-induced emission for image-guided photodynamic anticancer therapy | |
| Chen et al. | Core–shell nanocarriers with ZnO quantum dots-conjugated Au nanoparticle for tumor-targeted drug delivery | |
| Shen et al. | Engineering the upconversion nanoparticle excitation wavelength: cascade sensitization of tri‐doped upconversion colloidal nanoparticles at 800 nm | |
| Su et al. | BODIPY@ carbon dot nanocomposites for enhanced photodynamic activity | |
| Chung et al. | Recent advances in luminescence properties of lanthanide-doped up-conversion nanocrystals and applications for bio-imaging, drug delivery, and optosensing | |
| Yu et al. | Chitosan-mediated green synthesis and folic-acid modification of CuS quantum dots for photoacoustic imaging guided photothermal therapy of tumor | |
| Li et al. | Self-destructive PEG–BODIPY nanomaterials for photodynamic and photothermal therapy | |
| Wang et al. | Stable mesoporous silica nanoparticles incorporated with MoS2 and AIE for targeted fluorescence imaging and photothermal therapy of cancer cells | |
| Xu et al. | Design, fabrication, luminescence and biomedical applications of UCNPs@ mSiO 2–ZnPc–CDs–P (NIPAm-MAA) nanocomposites | |
| Zhang et al. | Rapid microwave synthesis of N-doped carbon nanodots with high fluorescence brightness for cell imaging and sensitive detection of iron (III) | |
| CN105622620B (en) | A kind of preparation method of the porphyrin photosensitizer with visualization optical dynamic therapy characteristic | |
| CN107137723A (en) | A kind of nanometer system integrated for multi-modal diagnosis and treatment and preparation method and application | |
| CN102776237A (en) | Cavitation-bubble-mediated laser cell transfection method | |
| CN108853497B (en) | Construction of targeted photodynamic nanoprobe based on up-conversion nanoparticles and ultrathin silicon dioxide layer | |
| Wang et al. | Mesoporous silica nanoparticles combined with MoS 2 and FITC for fluorescence imaging and photothermal therapy of cancer cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160106 |
|
| RJ01 | Rejection of invention patent application after publication |