CN105199971A - Low temperature-resistant Saccharomyces cerevisiae JM33 and application thereof in munake grape wine - Google Patents
Low temperature-resistant Saccharomyces cerevisiae JM33 and application thereof in munake grape wine Download PDFInfo
- Publication number
- CN105199971A CN105199971A CN201510580279.XA CN201510580279A CN105199971A CN 105199971 A CN105199971 A CN 105199971A CN 201510580279 A CN201510580279 A CN 201510580279A CN 105199971 A CN105199971 A CN 105199971A
- Authority
- CN
- China
- Prior art keywords
- wood
- saccharomyces cerevisiae
- lattice
- grape wine
- saccharomycescerevisiae
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention low temperature-resistant Saccharomyces cerevisiae JM33 and application of the low temperature-resistant Saccharomyces cerevisiae JM33 in munake grape wine. According to the low temperature-resistant Saccharomyces cerevisiae JM33 disclosed by the invention, by carrying out strain separating, screening, breeding and acclimatizing on munake grapes and carrying out morphological characteristic and 26S rDNA (Ribosomal Deoxyribose Nucleic Acid) sequence determination and phylogenetic analysis on an obtained strain, a fermentation action of strain Saccharomyces cerevisiae JM33 CGMCC NO.10912 on the munake grapes is determined; the munake grape wine is prepared by fermenting the munake grapes by utilizing the Saccharomyces cerevisiae JM33 CGMCC NO.10912, the munake grape wine is straw-like yellow and is clear and transparent, the fruity flavor is strong, the taste is mellow and soft, and a special flavor of the munake grape wine is obtained.
Description
Technical field
The present invention relates to food microorganisms applied technical field, specifically, the present invention relates to the yeast saccharomyces cerevisiae of a kind of seed selection voluntarily screening and the technical field of application in making grape wine.
Background technology
Grape wine is the alcoholic beverage led to through fermentation with fresh grape or Sucus Vitis viniferae, belongs to the general beverage of world's type.It without digesting in advance, directly can be absorbed by the body.Medical research shows: nearly 600 kinds of the composition useful to human body known in grape wine, and containing abundant amino acid, minerals and vitamins, these are all the requisite nutrient substances of human body.Aldehydes matter in grape wine and Ao Li multielement, there is the function of hyperoxia agent, the reactive oxygen produced in body metabolism process can be prevented the injury of human body, these injuries cause some degenerative disorders, as cataract, one of cardiovascular diseases, arteriosclerosis, aging factor, often drink appropriate grape wine and have the effects such as having vessel softening, anti-aging, beauty and health care, prolongs life, therefore deeply like by consumers in general.
China is spirits culture country prevailing, and former people's party is main mainly with white wine, but in today of exquisite health, fashion and grade, grape wine has started the status replacing white wine and beer.In recent years, the consumption of grape wine traditional consumption state of the world maintained previous level, and Chinese market is a dark horse only, and grape wine sales volume constantly rises.Along with progressively popularizing of Grape Wine Culture knowledge, more human consumer will be had to accept wine product, and therefore grape wine has great market potential in China.
Large quantity research shows, the quality of yeast saccharomyces cerevisiae is the key factor determining wine quality, overwhelming majority sugar in Sucus Vitis viniferae is converted into alcohol and carbonic acid gas by it, generates the meta-bolitess such as glycerine, higher alcohols, ester, aldehyde simultaneously, directly affects color and luster vinous, fragrance and mouthfeel.The production of high-quality wine is in the urgent need to having producing region feature, embodying the quality yeast bacterial classification of grape wine characteristic and style.The quality of wine yeast bacterial classification performance is directly connected to quality product vinous, and desirable yeast not only will have good leavening property, also should have larger temperature tolerance range, and stronger alcohol holding capacity, does not produce the features such as strange taste.Low temperature fermentation can promote the synthesis of the aromatoising substances such as ester class, alcohols, ketone, terpenes, improves wine quality.But low temperature fermentation can extend the latent period of yeast saccharomyces cerevisiae, reduce cytoactive and fermentation rate, even make fermenting process stop.Therefore, the wine yeast bred varieties of Scientific exploration, seed selection characteristic wine yeast bacterial classification, is of great immediate significance to the foundation of China's region feature grape wine brand and the Sustainable development of wine industry.In addition, China's grape-growing areas is wide, and the ecological condition difference of viny region is large, thus can produce different sorts, differently flavoured Wine Grape.Particularly Xinjiang, having superior light and heat condition and unique weather, is the best producing region of China's grape wine raw material.But due to domestic brewery widely using for external active dry yeast, cause convergentization of domestic grape wine taste, the yeast introduced, due to the change of grape variety, cultivation condition and making method etc., the Production of Wine of China might not show its good character completely or can not embody quality and the characteristic of place of production grape completely.Therefore filter out the high-quality yeast saccharomyces cerevisiae that fully can represent native country grape variety individual character, soil characteristic and regional characteristic from Xinjiang, high-quality wine exploitation to Xinjiang region feature is significant.
Lattice grape received by wood, has another name called winter grape, Gobi desert grape, Eurasianly plants, grain great Pi is thin, taste is sweet and refreshing, pulp is thick and crisp, be late-maturing, the storage tolerance local variety of most Xinjiang characteristic, be adapted at Xinjiang and northwest drought, regional development that accumulated temperature is higher, the region that tool is stronger.
At present, although have many about utilizing grape and wine brewing strain fermentation to prepare report vinous, but wood can be applicable to receive the excellent species that the brew of lattice grape has a typicalness style about the yeast that can screen premium properties and have no report, utilize wood to receive lattice grape and prepare grape wine for fermenting raw materials, and the bacterial classification of separation screening has the characteristic of low temperature resistant high-yield ethanol, can when reducing leavening temperature, still keep ferment fast, high alcohol getting rate, the research that residual sugar is few also rarely has report.
Summary of the invention
For having no about can the excellent yeast of screenability and wood can be applicable to receive the brew of lattice grape there is the excellent species report of typicalness style in prior art, and the bacterial classification of separation screening can when reducing leavening temperature, still keep ferment fast, high alcohol getting rate, the state of the art that residual sugar is few, the present invention aims to provide a kind of low temperature resistant yeast JM33 and receives the application in lattice grape wine at wood.The present invention separates yeast saccharomyces cerevisiae bacterial classification by receiving at wood in lattice grape, and utilize the bacterial strain of the isolated JM33 of being numbered to receive lattice grape to wood to carry out fermentation and prepare wood and receive lattice grape wine, the bacterial strain being numbered JM33 of separation screening under the fermentation condition of low temperature, can play ferment fast; Lattice grape wine straw golden received by the wood simultaneously prepared, and clear is glossy, sediment-free; Fragrance is soothed the spirit, the happy heart, grace, the smell of fruits is very sweet, and have wood and receive the distinctive fruital of lattice grape, fragrance is pure, without other irrelevant fragrance; Taste is coordinated, and pleasant, mouthfeel is pure, quiet and tastefully laid out, sour and sweet palatability, and entrance is mellow and full, and vinosity is big and fleshy, and wine body is plentiful, mellow soft, and taste is fine and smooth, big and fleshy mellow and full.
The main technical schemes that the present invention adopts:
By the separation screening of microbial strains, in lattice grape received by wood, isolate a collection of microorganism strains, through being separated further, screening, seed selection, domestication, obtain the Wine brewing yeast strain that a strain is numbered JM33.By carrying out morphological specificity, physio-biochemical characteristics and 26SrDNA section determined dna sequence and Phylogenetic Analysis to obtained bacterial strain, tentatively determine its classification position, screening seed selection domestication obtains the Wine brewing yeast strain that a kind of with common yeast exists obvious different attribute.Meanwhile, utilize the yeast saccharomyces cerevisiae that is numbered JM33 to receive lattice Sucus Vitis viniferae at the condition bottom fermentation 10d of 15 DEG C to wood, prepare wood and receive lattice grape wine.The bacterial strain being numbered JM33 of separation screening of the present invention can when can when reducing leavening temperature, still keep ferment fast, high alcohol getting rate, residual sugar is few, namely the bacterial strain being numbered JM33 can when leavening temperature be 15-20 DEG C, plays ferment in 16h, wood receive lattice pol be 185g/L time, former wine alcohol getting rate is 10.57 degree, residual sugar amount <2g/L; The wood simultaneously prepared is received lattice grape wine color and luster and is presented straw golden, clear, and the smell of fruits is very sweet, good smell, has wood and receives the distinctive fragrance of lattice grape, pure in mouth feel, mellow soft, unique flavor.
The present invention specifically provides a kind of yeast saccharomyces cerevisiae (Saccharomycescerevisiae), be separated by receiving at wood in lattice grape, screening, domestication and cultivate, obtain a collection of fungal microbe bacterial strain, therefrom filter out the bacterial strain that a strain is numbered JM33, through microbiological classification and qualification, belong to yeast saccharomyces cerevisiae (Saccharomycescerevisiae).
Concrete, the present invention, by being separated the wood of the maturation microorganism received in lattice grape, screening and cultivate, obtains a collection of microorganism strains, therefrom filters out the bacterial strain that a strain is numbered JM33, through microbiological classification and qualification, this strain classification is in Saccharomycescerevisiae.The present invention adopts strain number to be the yeast saccharomyces cerevisiae (Saccharomycescerevisiae) of JM33, and this bacterial strain was preserved in budapest treaty microorganism International Depository Authority before the applying date: China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC).Address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode: 100101.Preservation date is on May 25th, 2015, and preserving number is CGMCCNo.10912.Yeast saccharomyces cerevisiae (Saccharomycescerevisiae) is accredited as through microbiology.This bacterial strain optimum growing condition is: temperature 28 DEG C, and substratum adopts YPD Agar substratum, pH5.5, incubation time 24-48h; 3-8 DEG C or alcoholic strength can be low to moderate in temperature to reach in the culture environment of 14 degree and ferment; This bacterial strain is oyster white on YPD Agar flat board, subcircular, and liquid culture does not form mould film, precipitate white consolidation; Vegetative manner is that multiterminal sprout; Not maternity leave mycelia, thecaspore 1; On WL substratum, bacterium colony is that cream color is slightly with green, spherical protuberances, smooth surface, opaque; Saccharomycescerevisiae bacterium is accredited as through microbiology.Identify being numbered JM33 bacterial strain with reference to " Fungal identification handbook ", in conjunction with the Physiology and biochemistry comprehensive detection determination bacterium numbering member that to be JM33 bacterial strain be in yeast saccharomyces cerevisiae (Saccharomycescerevisiae), be yeast saccharomyces cerevisiae (Saccharomycescerevisiae) from taxonomy angular divisions.Molecule sequencing result shows, this bacterium 26SrDNA and SaccharomycescerevisiaestrainCBS1171 homology the highest, be 98%.Yeast saccharomyces cerevisiae provided by the invention (Saccharomycescerevisiae) and common yeast saccharomyces cerevisiae have the otherness of obvious physio-biochemical characteristics difference and molecular level, according to bacterial classification Analysis of The Physiological And Biochemical Properties, the comprehensive identification of molecular level analysis and systematics, although the yeast saccharomyces cerevisiae of bacterial classification with common in physio-biochemical characteristics and molecular level being numbered JM33 is variant, it is a kind of typical Yeast bacterial classification, compared with common yeast saccharomyces cerevisiae, it is to alcohol, acid, sulfurous gas, the tolerance of Repone K and low temperature is stronger, yeast saccharomyces cerevisiae (Saccharomycescerevisiae) is accredited as according to taxonomy.
Further, the invention provides the application that a kind of yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912 receives in lattice wine making at wood.Prepare wood by utilizing JM33 strain fermentation and receive lattice grape wine, the wood of preparation is received lattice grape wine and all present effect unique in color and luster, flavour and fragrance.
Meanwhile, the present invention specifically provides a kind of wood to receive lattice preparation of wine, and concrete preparation method's step is as follows:
(1) inoculate: the YPD solid medium preparing yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912, strictly carry out aseptic technique after sterilizing, be forwarded to flat board from inclined-plane, cultivate 2 days at temperature 28 DEG C.
(2) enlarged culturing: picking list bacterium colony is forwarded in the Erlenmeyer flask that YPD liquid nutrient medium is housed from the YPD solid medium step (1), aseptic technique, 28 DEG C, 120r/min cultivates 24h-48h, prepares seed liquor.
(3) collection of seed liquor: it is 5000rpm that the seed liquor after step (2) being activated collects rotating speed for subsequent use, centrifugal after centrifuge washing twice.
(4) selecting of lattice grape received by wood: select maturation, receive lattice grape without going mouldy, without the wood of worm-eaten, for subsequent use.
(5) process of raw material: received by wood ripe for step (4) after the fragmentation of lattice grape extraction juice and collect Sucus Vitis viniferae, measure pol, be sub-packed in common fermenting container, liquid amount is 3/4 of fermenting container volume.
(6) inoculate: the seed liquor adding the step after centrifuge washing (3) according to 3% of step (5) raw material volume respectively, and be the condition bottom fermentation 10d of 15 DEG C in temperature.
(7) filter: the work in-process after step (6) being fermented utilize yarn or membrane filtration, and remove skin and seed, the liquid after filtration installs in container, be through the glycolysis of secondary fermentation precipitation and prepare wood and receive lattice grape wine.
The wooden lattice grape wine secondary fermentation technique after filtration of receiving of yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912 brew is adopted to adopt well known technique to carry out in the present invention.
By applying a kind of low temperature resistant yeast saccharomyces cerevisiae JM33 provided by the invention and receiving the application in lattice brewing grape wine at wood, utilize the present invention voluntarily the wood of yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912 to maturation of seed selection screening receive lattice grape and ferment, prepare grape wine; The bacterial strain being numbered JM33 has the characteristic of low temperature resistant high-yield ethanol, can when the leavening temperature of 15-20 DEG C, still keep ferment fast, high alcohol getting rate, the feature that residual sugar is few, the Wine Aroma of production is pleasant, and mouthfeel alcohol is just, for reduction production energy consumption, the Wine brewing yeast strain of seed selection tool region feature has active effect.
The former wine of lattice received by wood prepared by the present invention is straw golden, clear, and the smell of fruits is very sweet, and fragrance is pure, and mellow in taste is soft, has wood and receives the distinctive local flavor of lattice grape wine and fragrance.
By implementing the concrete summary of the invention of the present invention, following beneficial effect can be reached:
(1) bacterial strain being numbered JM33 of the present invention's screening has stronger growth and breeding ability, and growth velocity is fast, and hereditary property is stablized, and receives lattice grape to wood and have good fermentative action.
(2) bacterial strain being numbered JM33 of the present invention's screening can when 15-20 DEG C, 16h plays ferment, wood receive lattice sugar content be 185g/L time, alcohol getting rate is 10.57 degree, residual sugar amount <2g/L, and the bacterial strain being namely numbered JM33 has the characteristic of low temperature resistant high-yield ethanol, can when reducing leavening temperature, still keep ferment fast, high alcohol getting rate, the characteristic that residual sugar is few.
(3) lattice grape wine received by the wood that the present invention utilizes yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912 to prepare is straw golden, and clear is glossy, sediment-free; Fragrance is soothed the spirit, the happy heart, grace, the smell of fruits is very sweet, and have wood and receive the distinctive fruital of lattice grape, fragrance is pure, without other irrelevant fragrance; Taste is coordinated, and pleasant, mouthfeel is pure, quiet and tastefully laid out, sour and sweet palatability, and entrance is mellow and full, and vinosity is big and fleshy, and wine body is plentiful, mellow soft, and taste is fine and smooth, big and fleshy mellow and full.
(4) outward appearance vinous, mouthfeel, abundant, acidity, fragrance factor the evaluation of estimate of wine body that prepared by the present invention are all good, comprehensive grading is 86.44, and the wood that visible the present invention utilizes yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912 to prepare is received lattice grape wine and had good typical quality, style and fragrance.
Accompanying drawing explanation
Fig. 1 is shown as the colonial morphology figure of yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912.
Fig. 2 is shown as the thalli morphology figure of yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912.
Fig. 3 is shown as the 26SrDNA sequential system evo-devo tree graph of yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912.
Embodiment
, for embodiment, the present invention is described below, but the present invention is not limited to following embodiment.
The all raw and auxiliary materials selected in the present invention, and the spawn culture method selected is all well known selecting, the % related in the present invention is weight percentage, unless otherwise indicated.
Embodiment one: the separation of yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912, screening and qualification
1, the Isolation and screening of bacterial classification
Yeast saccharomyces cerevisiae used in the present invention is received the sampling of lattice grape from the wood of maturation and is separated, and according to bacterial classification Analysis on action mechanism, preliminary screening goes out to be received lattice grape to wood and have the bacterial strain of certain fermentation capacity.The microorganism utilizing traditional plating method to isolate wood to receive in lattice Sucus Vitis viniferae, primary dcreening operation and multiple sieve is utilized to carry out strain screening, plate streak purifying bacterial strain, by comparing the resistance to sugar of bacterial classification, ethanol-tolerant, acidproof, resistance to sulfurous gas, resistance to Repone K and resistance to low temperature, filter out a collection of well-grown microorganism strains, the strain therefrom optimizing good combination property is numbered the Wine brewing yeast strain of JM33.
Separating step: lattice grape received by the wood of harvesting ripe, and after broken, point juice is sub-packed in sterile chamber and carries out spontaneous fermentation 3-5d; Get 1mL fermented grape juice to be coated with after stepwise dilution in screening culture medium, primary dcreening operation substratum used is YPD Agar substratum; Bacterial classification after primary dcreening operation is cultivated 10d at 15 DEG C, is sieved again by WL substratum, choosing bacterium colony is that cream color is slightly with green, spherical protuberances, smooth surface, the strain of opaque bacterium colony 8, repeats line and is separated repeatedly, until fall without miscellaneous bacteria.A bacterial strain part after purifying is adopted the mode preservations such as lyophilized products ampoul tube, glycerine pipe and liquid nitrogen, and a part is stored in 4 DEG C and is directly used in follow-up study.
Described YPD Agar substratum: yeast extract paste 10g/L, peptone 20g/L, glucose 20g/L, agar powder 20g/L, distilled water 1L, dissolve, and 121 DEG C of sterilizing 15min; Described WL nutrient agar: yeast powder 5.0g/L, acid hydrolyzed casein 5.0g/L, glucose 50.0g/L, potassium primary phosphate 0.55g/L, Repone K 0.425g/L, calcium chloride 0.125g/L, magnesium sulfate 0.125g/L, iron(ic) chloride 0.0025g/L, manganous sulfate 0.0025g/L, tetrabromo-mcresolsulfonphthalein 0.022g/L, agar 17.0g/L, pH value 5.5 ± 0.2, dissolves, and 121 DEG C of sterilizing 15min.
2, the culture condition of bacterial strain
(1) growth medium being numbered the bacterial strain of JM33 is: YPD substratum.
(2) bacterial strain being numbered JM33 all can grow under 8-40 DEG C of condition, and optimum growth temperature is 28 DEG C, and it can ferment under the condition of 8 DEG C.
(3) the growth pH being numbered the bacterial strain of JM33 is 3.0-7.5, and optimal pH is 5.5.
(4) the bacterial strain alcohol tolerance maximum concentration being numbered JM33 is 16%, can reach in the culture environment of 14 degree ferment at alcoholic strength.
(5) the resistance experiment of JM33 bacterial strain is numbered
Adopt YPD liquid nutrient medium 10mL, Du Shi tube method investigates adverse-resistant characteristic.Wherein alcohol tolerance measures the alcohol concn detected is (V/V): 12%, 14%, 16%, 18%; During acidity tolerance detects, citric acid concentration is: 1.5%, 2.0%, 2.5%, 3.0%; The resistance to examined glucose concn of high sugar is 200g/L, 300g/L, 400g/L, 500g/L; SO
2the SO that tolerance detects
2concentration is: 100mg/L, 150mg/L, 200mg/L, 250mg/L; The KCl concentration that KCl tolerance detects is: 1.0M, 1.5M, 1.75M, 2.0M, 2.25M, 2.5M; Play ferment temperature in low temperature tolerant and be set to 8 DEG C, 10 DEG C, 15 DEG C, 20 DEG C, 25 DEG C.Inoculate the bacterium liquid 200 μ L activated respectively, inoculum size is 10
6individual/mL, 28 DEG C or relevant temperature cultivation.
Result shows, the highest alcohol tolerating 16%vol of bacterial strain JM33 of the present invention, the citric acid of 2.0%, the glucose of 500g/L, the SO of 250mg/L
2, the KCl of 2.25M.Although the time can be delayed to 40h, under low temperature 8 DEG C of conditions, JM33 still can start fermentation, is the strain that in sieved yeast, comprehensive anti-adversity is the most excellent.
Concrete, the present invention, by being separated the wood of the maturation microorganism received in lattice grape, screening and cultivate, obtains a collection of microorganism strains, therefrom filters out the bacterial strain that a strain is numbered JM33, through microbiological classification and qualification, this bacterial strain belongs to Saccharomycescerevisiae.The present invention adopts strain number to be the yeast saccharomyces cerevisiae (Saccharomycescerevisiae) of JM33, and this bacterial strain was preserved in budapest treaty microorganism International Depository Authority before the applying date: China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC).Address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode: 100101.Preservation date is on May 25th, 2015, and preserving number is CGMCCNo.10912.Yeast saccharomyces cerevisiae (Saccharomycescerevisiae) is accredited as through microbiology.This bacterial strain optimum growing condition is: temperature 28 DEG C, and substratum adopts YPD substratum, pH5.5, incubation time 24-48 hour; 8 DEG C or alcoholic strength can be low to moderate in temperature to reach in the culture environment of 14 degree and ferment; This bacterial strain bacterium colony on YPD substratum is oyster white, subcircular, and on WL substratum, bacterium colony is that cream color is slightly with green, spherical protuberances, smooth surface, opaque; Saccharomycescerevisiae bacterium is accredited as through microbiology.Identify being numbered JM33 bacterial strain with reference to " Fungal identification handbook ", in conjunction with the Physiology and biochemistry comprehensive detection determination bacterium numbering member that to be JM33 bacterial strain be in yeast saccharomyces cerevisiae (Saccharomycescerevisiae), be yeast saccharomyces cerevisiae (Saccharomycescerevisiae) from taxonomy angular divisions.
3, the Physiology and biochemistry qualification of bacterial strain JM33
Morphological specificity: this bacterial classification is through YPD Agar substratum separation and Culture, and the doubtful yeast bacterium colony of picking carries out microscopic examination, and it is tentatively defined yeast strain; This bacterial strain is streak culture 36h on WL culture medium flat plate, can form cream color and slightly be with green, spherical protuberances, smooth surface, opaque bacterium colony.YPD Agar flat board is oyster white, subcircular, liquid culture does not form mould film, precipitate white consolidation; Vegetative manner is that multiterminal sprout; Not maternity leave mycelia, thecaspore 1.
Physiological and biochemical property: carried out sugar-fermenting, carbon assimilation, nitrogenous source assimilation qualification to this bacterium, it the results are shown in Table 1.
Table 1: the physio-biochemical characteristics of bacterial strain JM33
By the above-mentioned thalli morphology for bacterial classification yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912, cultural characteristic is observed and Determination of Physiological And Biochemical Indices, namely observed by thalli morphology, strain culturing observation of characteristics, growth temperature measures, the tests such as resistance test, compared with common yeast saccharomyces cerevisiae, it is to alcohol, acid, sulfurous gas, the tolerance of Repone K and low temperature is stronger, method with reference to " Fungal identification handbook " is carried out, the bacterial strain comprehensive identification being JM33 by bacterium numbering from bacterium classification angle is yeast saccharomyces cerevisiae (Saccharomycescerevisiae), see accompanying drawing 1, 2.
Embodiment two: the molecular assay of yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912
1, the DNA sequence dna of pcr amplification yeast saccharomyces cerevisiae and order-checking thereof
Single bacterium colony of picking a small amount of JM33 bacterial strain, put into the EP pipe filling 25 μ L sterilized waters, 100 DEG C are boiled 8-10min, put into rapidly mixture of ice and water 5min afterwards.Centrifugal 10000r/min, 5min, 4 DEG C of preservations, the used time gets supernatant.
The structure of 26SrDNA gene sequencing and systematic evolution tree thereof: the STb gene extracting yeast strain according to a conventional method, with deionized water, dilution universal primer NL1 and NL4 is carried out the pcr amplification of 26SrDNA section, design of primers is as follows:
NL1：5'-GCATATCAATAAGCGGAGGAAAAG-3'
NL4：5'-GGTCCGTGTTTCAAGACGG-3'
The reaction system of 50 μ l contains: 10 × PCR damping fluid 5 μ l, each 20pmol of primer, template DNA 1 μ l, TaqTM (TaKaRa company) 0.5U, dNTP8 μ l.Pcr amplification condition: 95 DEG C of denaturation 5min, 94 DEG C of 45sec, 55 DEG C of 1min, 72 DEG C of 1min circulate 30 times, and 72 DEG C of 10min repair and extend, 4 DEG C of termination reactions.The purifying of PCR primer: PCR primer carries out electrophoresis in 1% sepharose, reclaims object fragment with TaKaRaPCRFragmentRecoveryKit from glue, is dissolved in the high purity water of 30 μ l.Deliver to the mensuration that order-checking company carries out 26SrDNA sector sequence, the gene order of bacterial classification JM33 is see attached gene order table.
3, the comparison of 26SrDNA gene order and Phylogenetic Analysis
Nucleotide sequence in the 26SrDNA sequence and GenBank database that obtain checking order carries out BLAST analysis, therefrom obtains close 26SrDNA sequence, after the 26SrDNA sequence of JM33 is carried out BLAST analysis in ncbi database, and constructing system evolutionary tree.Shown in accompanying drawing 3, between bacterial strain JM33 and SaccharomycescerevisiaestrainCBS1171, evolutionary distance is the shortest, is the allied species of SaccharomycescerevisiaestrainCBS1171.In conjunction with Morphologic Characteristics and the physio-biochemical characteristics of JM33, determine that it is yeast saccharomyces cerevisiae Pseudomonas.By measured 26SrDNA sequence inputting Genbank, tetraploid rice is carried out with Blast program, find that the similarity of the 26SrDNA sequence of it and SaccharomycescerevisiaestrainCBS1171 is maximum, being 98%, is a kind of typically new barms.In conjunction with Morphologic Characteristics and the physio-biochemical characteristics of JM33, to determine that it is bacterium numbering be JM33 comprehensive identification is yeast saccharomyces cerevisiae (Saccharomycescerevisiae).
Embodiment three: utilize yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912 and wood to receive lattice grape brew grape wine
(1) inoculate: the YPD solid medium preparing yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912, strictly carry out aseptic technique after sterilizing, be forwarded to flat board from inclined-plane, cultivate 2 days at temperature 28 DEG C.
(2) enlarged culturing: picking list bacterium colony is forwarded in the Erlenmeyer flask that YPD liquid nutrient medium is housed from the YPD solid medium step (1), aseptic technique, 28 DEG C, 120r/min cultivates 24h-48h, prepares seed liquor.
(3) collection of seed liquor: it is 5000rpm that the seed liquor after step (2) being activated collects rotating speed for subsequent use, centrifugal after centrifuge washing twice.
(4) selecting of lattice grape received by wood: select maturation, receive lattice grape without going mouldy, without the wood of worm-eaten, for subsequent use.
(5) process of raw material: received by wood ripe for step (4) after the fragmentation of lattice grape extraction juice and collect Sucus Vitis viniferae, measure pol, be sub-packed in common fermenting container, liquid amount is 3/4 of fermenting container volume.
(6) inoculate: the seed liquor adding the step after centrifuge washing (3) according to 3% of step (5) raw material volume respectively, and be the condition bottom fermentation 10d of 15 DEG C in temperature.
(7) filter: the work in-process after step (6) being fermented utilize yarn or membrane filtration, and remove skin and seed, the liquid after filtration installs in container, be through the glycolysis of secondary fermentation precipitation and prepare wood and receive lattice grape wine.
The wooden lattice grape wine secondary fermentation technique after filtration of receiving of yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912 brew is adopted to adopt well known technique to carry out in the present invention.
By applying a kind of low temperature resistant yeast saccharomyces cerevisiae JM33 provided by the invention and receiving the application in lattice brewing grape wine at wood, utilize the present invention voluntarily the wood of yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912 to maturation of seed selection screening receive lattice grape and ferment, prepare grape wine; The bacterial strain being numbered JM33 has the characteristic of low temperature resistant high-yield ethanol, can when the leavening temperature of 15-20 DEG C, still keep ferment fast, high alcohol getting rate, the feature that residual sugar is few, the Wine Aroma of production is pleasant, and mouthfeel alcohol is just, for reduction production energy consumption, the Wine brewing yeast strain of seed selection tool region feature has active effect.
The former wine of lattice received by the wood that the present invention utilizes yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912 of the domestication of screening and separating voluntarily to prepare is straw golden, clear; The smell of fruits is very sweet, fragrance is pure; Mellow in taste is soft, has wood and receives the distinctive local flavor of lattice grape wine.
Embodiment four: different yeast is prepared wood and received lattice grape wine and compare
1, experimentation
(1) the bacterial classification EC118 being representative to yeast saccharomyces cerevisiae conventional on yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912 and market respectively activates, the collection of enlarged culturing and seed liquor, obtains the bacterial classification being ready to use in fermentation after centrifuge washing;
(2) select maturation, receive lattice grape without going mouldy, without the wood of worm-eaten, collect Sucus Vitis viniferae after fragmentation of squeezing the juice, be sub-packed in 10L container, Intake Quantity is about 7L;
(3) add the bacterium liquid after centrifuge washing according to 3% of Sucus Vitis viniferae raw material volume, and be the condition bottom fermentation 10d of 15 DEG C in temperature, and results of regular determination residual sugar amount and alcoholic strength; Obtain wood after filtration and receive lattice Fructus Vitis viniferae wine base, after fermentation, get appropriate grape wine analysis-e/or determining fermentation parameter index.
2, subjective appreciation
Commenting wine expert to be made up of the slip-stick artist that 10 are engaged in wine making specialty, there is higher authoritative and reasonableness, evaluating two kinds of qualities vinous through judging expert group.
Table 2: sense organ evaluating meter
3, experimental result
Lattice grape received by (1) two kind of bacterial classification wood that ferments respectively, and parameter is as follows:
Table 3: two kinds of strain fermentation fermentation parameter tables vinous
As seen from the above table, utilize the wood after being numbered the strain fermentation of JM33 to receive residual sugar content in lattice grape wine and reducing sugar content and receive lattice grape wine lower than the wood after EC1118 strain fermentation; After the fermentation of two kinds of bacterium, to receive lattice total acid content vinous suitable with pH value for the wood of preparation, but being improved of total alcoholic strength.Visible, yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912 is applicable to receive lattice grape to wood and carries out fermentation for grape wine.EC1118 bacterial strain is industrial strain comparatively conventional on market, and infer thus, JM33 possesses the characteristic becoming excellent yeast saccharomyces cerevisiae.
(2) results of sensory evaluation
A kind of low temperature resistant yeast saccharomyces cerevisiae JM33 of the present invention and receive the utilisation technology in lattice brewing grape wine at wood, the color and luster vinous, fragrance and the flavour that prepare all present good characteristic.
Color and luster: straw golden, clear, glossy, sediment-free;
Fragrance: fragrance is soothed the spirit, the happy heart, grace, the smell of fruits is very sweet, have wood and receive the distinctive fruital of lattice grape, fragrance is pure, without other irrelevant fragrance;
Flavour: taste is coordinated, and pleasant, mouthfeel is pure, quiet and tastefully laid out, sour and sweet palatability, and entrance is mellow and full, and vinosity is big and fleshy, and wine body is plentiful, mellow soft, taste is fine and smooth, big and fleshy mellow and full.
Embodiment five: utilize mathematical model to receive lattice evaluation vinous to wood
Because comment result exists ambiguity, as " good with bad ", " have and do not have ", " pure and impure " do not have the boundary of absolute clarity, make an appraisal so fuzzy mathematics theory should be adopted to receive lattice grape wine quality to wood.
1. the foundation of mathematical model
If factor of evaluation set is { U
1, U
2..., U
nbe total to n factor.Evaluation approach set is V{V
1, V
2..., V
m, m grade altogether.Wood is received during lattice grape wine quality evaluates, and get { color and luster, fragrance, flavour }, V={ is excellent, good, in, poor }, wherein 86 ~ 100 are divided into excellent, and 85 ~ 85 are divided into good, and 60 ~ 80 are divided into difference.
If R be from U to fuzzy relation set, r
ij(i=1,2 ... n, j=l, 2 ..., m) represent and have in mind from i-th factor, lattice grape wine received to wood and makes the possible degree of jth kind comment.Fixing i, then (r
i1, r
i2..., r
im) be exactly a fuzzy set on V, represent from i-th factor and have in mind, for commented wood to receive single factor evaluation that lattice grape wine makes, the fuzzy evaluating matrix so formed is R=[r
ij]
m × n.
Each element u in U, namely each assessment item comprise in factor, the influence degree of lattice grape wine quality quality received to wood different, different weights is had between all homoatomics in explanation, a fuzzy subset that can be shown as, factor U is designated as A (u) by the weight had in mind, can be referred to as in U element u to the degree of membership of A.{ A (u
i) (i=1,2 ..., n) be called flexible strategy and distribute set, have A={A (u
1), A (u
2) ..., A (u
n), wherein A (u
1)>=0, A (u
1)+A (u
2)+... A (u
n)=1.According to fuzzy mathematics theory, the comprehensive evaluation model of making thus is: B=AR=(b
l, b
2..., b
m).Operation relation " AR " represents the synthesis of A to R, and its computing is b
1=V (a
1^V
ij), wherein " V " is logical add, represents maximizing operation; " ^ " is logical multiply, represents minimizing operation.
2. evaluation vinous
Invite 20 wine experts to carry out sensory quality assessment to grape wine prepared by the application, assessment item comprises outward appearance, mouthfeel, acidity, pleasant impression, fragrance five large projects 30 small projects, and evaluation result is in table 4.
Table 4: sense organ evaluating meter vinous
3 results
Outward appearance U can be obtained by sense organ evaluating meter vinous
levaluation approach fuzzy matrix be
In matrix, every column of figure shows the evaluation to a certain factor, evaluation approach respectively excellent (90-100), good (85-90), in (80-85), poor (60-80) number proportion.
The flexible strategy of outward appearance Ul factor are assigned as: A (U
1)=(0.3750.3750.25).To the synthetic evaluation matrix B of outward appearance
lfor
Normalization method: 0.375+0.30+0.20+0.10=0.975,
In like manner mouthfeel U can be obtained
2, the abundant U of wine body
3, acidity U
4, fragrance U
5synthetic evaluation matrix and normalization method: B
2'=[0.3640.3640.1820.09], B
3'=[0.2380.4760.2380.048], B
4'=[0.2940.2940.2940.118], B
5'=[0.3330.3330.3340] flexible strategy of factor U are assigned as (A
u)=[0.080.100.080.240.50].Thus obtain synthetic evaluation matrix vinous prepared by the present invention
For:
Normalization method, has B
u'=[0.2990.2990.2990.103], the mean vectors of getting evaluation approach score value is C=[9587.582.570], obtains comprehensive evaluation value vinous prepared by the present invention to be
To each factor, as abundant in outward appearance, mouthfeel, wine body, acidity, fragrance etc., also can calculate its comprehensive evaluation value.The comprehensive evaluation value of outward appearance is W
1=B
lc
t=85.375 points; In like manner, the comprehensive evaluation value of mouthfeel is W
2=87.745 points, the abundant comprehensive evaluation value of wine body is W
3=87.255 points, the comprehensive evaluation value of acidity is W
4=86.17 points, the comprehensive evaluation value of fragrance is W
5=88.328 points.
As can be seen from above-mentioned evaluation, the outward appearance vinous that the present invention utilizes yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912 of screening and separating domestication voluntarily to prepare, mouthfeel, abundant, acidity, fragrance factor the evaluation of estimate of wine body are all good, have good quality.
Above-described embodiment is only for example of the present invention is clearly described, and the restriction not to embodiment.For those of ordinary skill in the field, can also make other changes in different forms on the basis of the above description.Here exhaustive without the need to also giving all embodiments.And apparent change extended thus or variation are still among protection scope of the present invention.
SEQUENCELISTING
<110> Microorgan Application Inst., Xinjiang Agricultural Academy
The low temperature resistant yeast JM33 of <120> mono-kind and receive the application in lattice grape wine at wood
<130>1
<160>1
<170>PatentInversion3.3
<210>1
<211>552
<212>DNA
<213>Saccharomycescerevisiae
<400>1
cacggcgagtgagcggcaaaagctcaaatttgaaatctggtaccttcggtgcccgagttg60
taatttggagagggcaactttggggccgttccttgtctatgttccttggaacaggacgtc120
atagagggtgagaatcccgtgtggcgaggagtgcggttctttgtaaagtgccttcgaaga180
gtcgagttgtttgggaatgcagctctaagtgggtggtaaattccatctaaagctaaatat240
tggcgagagaccgatagcgaacaagtacagtgatggaaagatgaaaagaactttgaaaag300
agagtgaaaaagtacgtgaaattgttgaaagggaagggcatttgatcagacatggtgttt360
tgtgccctctgctccttgtgggtaggggaatctcgcatttcactgggccagcatcagttt420
tggtggcaggataaatccataggaatgtagcttgcctcggtaagtattatagcctgtggg480
aatactgccagctgggactgaggactgcgacgtaagtcaaggatgctggcataatggtta540
tatgccgccccg552
Claims (5)
1. one kind be applicable to brewage Mu Nage yeast saccharomyces cerevisiae vinous (
saccharomycescerevisiae) JM33, it is characterized in that, the deposit number of described yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33 is CGMCCNO.10912.
2. as claimed in claim 1 yeast saccharomyces cerevisiae (
saccharomycescerevisiae) gene order of JM33 is as SEQUENCELISTING.
3. a lattice grape wine preparation method received by wood, it is characterized in that, described wood is received lattice grape wine and obtained by following preparation method:
(1) inoculate: the YPD solid medium preparing yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912, strictly carry out aseptic technique after sterilizing, be forwarded to flat board from inclined-plane, cultivate 2 days at temperature 28 DEG C;
(2) enlarged culturing: picking list bacterium colony is forwarded in the Erlenmeyer flask that YPD liquid nutrient medium is housed from the YPD solid medium step (1), aseptic technique, 28 DEG C, 120r/min cultivates 24h-48h, prepares seed liquor;
(3) collection of seed liquor: it is 5000rpm that the seed liquor after step (2) being activated collects rotating speed for subsequent use, centrifugal after centrifuge washing twice;
(4) selecting of lattice grape received by wood: select maturation, receive lattice grape without going mouldy, without the wood of worm-eaten, for subsequent use;
(5) process of raw material: received by wood ripe for step (4) after the fragmentation of lattice grape extraction juice and collect Sucus Vitis viniferae, measure pol, be sub-packed in common fermenting container, liquid amount is 3/4 of fermenting container volume;
(6) inoculate: the seed liquor adding the step after centrifuge washing (3) according to 3% of step (5) raw material volume respectively, and be the condition bottom fermentation 10d of 15 DEG C in temperature;
(7) filter: the work in-process after step (6) being fermented utilize yarn or membrane filtration, and remove skin and seed, the liquid after filtration installs in container, be through the glycolysis of secondary fermentation precipitation and prepare wood and receive lattice grape wine;
The wooden lattice grape wine secondary fermentation technique after filtration of receiving of yeast saccharomyces cerevisiae (Saccharomycescerevisiae) JM33CGMCCNO.10912 brew is adopted to adopt well known technique to carry out in the present invention.
4. a kind of wood is received wood prepared by lattice grape wine preparation method and is received lattice grape wine as claimed in claim 3.
5. as claimed in claim 1 yeast saccharomyces cerevisiae (
saccharomycescerevisiae) JM33 receives the application received in lattice grape wine of lattice brewing grape wood at wood.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510580279.XA CN105199971B (en) | 2015-09-12 | 2015-09-12 | A kind of low temperature resistant yeast JM33 and the application in wood receives lattice grape wine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510580279.XA CN105199971B (en) | 2015-09-12 | 2015-09-12 | A kind of low temperature resistant yeast JM33 and the application in wood receives lattice grape wine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105199971A true CN105199971A (en) | 2015-12-30 |
| CN105199971B CN105199971B (en) | 2018-10-30 |
Family
ID=54947934
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510580279.XA Active CN105199971B (en) | 2015-09-12 | 2015-09-12 | A kind of low temperature resistant yeast JM33 and the application in wood receives lattice grape wine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105199971B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106520953A (en) * | 2016-11-18 | 2017-03-22 | 皖西学院 | Gene sequence of daoli huoshan dendrobium moniliforme HT2 endophytes |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1557229A (en) * | 2004-02-11 | 2004-12-29 | 吐尔逊江・卡日热西提 | Health and flavoring beverage sour grape liquid |
-
2015
- 2015-09-12 CN CN201510580279.XA patent/CN105199971B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1557229A (en) * | 2004-02-11 | 2004-12-29 | 吐尔逊江・卡日热西提 | Health and flavoring beverage sour grape liquid |
Non-Patent Citations (2)
| Title |
|---|
| 李静等: "木纳格葡萄采后病害拮抗酵母菌筛选及其应用", 《中国微生物学会-第二届全国农业微生物研究及产业化研讨会》 * |
| 李静等: "木纳格葡萄采后附生微生物区系分析及优势致病菌的确定", 《塔里木大学学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106520953A (en) * | 2016-11-18 | 2017-03-22 | 皖西学院 | Gene sequence of daoli huoshan dendrobium moniliforme HT2 endophytes |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105199971B (en) | 2018-10-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101503655B (en) | Preparation of artificial pit mud for improving aged aroma of aroma type white spirit | |
| Sefa-Dedeh et al. | Yeasts in the traditional brewing of pito in Ghana | |
| CN109439557A (en) | High acid, low yield fusel oil S. cervisiae and combinations thereof and application | |
| CN109097291B (en) | Composite fermentation agent and application thereof in brewing cabernet sauvignon anhydration wine | |
| CN105802865B (en) | One plant height fermentation activity and the fragrant characteristic of production ice brewer yeast outstanding and its application | |
| CN102352323B (en) | Ester producing yeast as well as method and application of yeast for producing Xiaoqu fen-flavor seasoning wine | |
| CN107177519A (en) | Schizosaccharomyces pombe bacterium, its composition and application | |
| CN108239608A (en) | One plant of Dell's kelvin has spore torula bacterial strain and its application in wine production | |
| CN110343635A (en) | The Pediococcus acidilactici of one plant of fermentation sauce flavouring | |
| CN110305804A (en) | A kind of Non-Saccharomyces bacterial strain and its application | |
| CN108179120A (en) | One Accharomyces cerevisiae and its application | |
| CN100453636C (en) | Armillaria luteo-virens and its culture process and application | |
| CN102876532A (en) | Coffee-type red grape wine | |
| CN101624573B (en) | Saccharomyces cerevisiae for brewing pomegranate fruit wine and pomegranate wine prepared by fermentation | |
| CN103215195A (en) | Saccharomyces cerevisiae and application of the same in dry red wine brewing | |
| CN109182156A (en) | One plant of saccharomyces cerevisiae for being suitable for making red core red pitaya wine and its application | |
| CN105368736A (en) | Bacillus aceticus and application of bacillus aceticus in coffee cherry peel and pulp fermentation vinegar | |
| CN108865910B (en) | Saccharomyces cerevisiae, screening method thereof and application of saccharomyces cerevisiae in blueberry red wine fermentation | |
| CN102168027B (en) | New strain J4 for biofermentation of fruit wine and application thereof | |
| CN109971657A (en) | A kind of Rhizopus oryzae of high-yield glucoamylase and its application | |
| CN107058140B (en) | One plant of kluyveromyces marxianus and its application in blueberry fruit wine brewing | |
| CN111621430B (en) | Saccharomyces cerevisiae suitable for brewing yellow peach fruit wine and application thereof | |
| CN109112036A (en) | A kind of composite enzyme fruit wine preparation method | |
| CN105199971B (en) | A kind of low temperature resistant yeast JM33 and the application in wood receives lattice grape wine | |
| CN104017740B (en) | Glycerin high-yielding saccharomyces cerevisiae strain and application thereof to dry white wine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 830091 Nanchang road the Xinjiang Uygur Autonomous Region Urumqi shayibake District No. 403 Applicant after: Institute of Applied Microbiology, Xinjiang Academy of Agricultural Sciences, Xinjiang Armenia, China Address before: 830091 Nanchang road the Xinjiang Uygur Autonomous Region Urumqi shayibake District No. 403 Applicant before: Microorgan Application Inst., Xinjiang Agricultural Academy |
|
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Wang Ning Inventor after: Bao Huifang Inventor after: Hou Min Inventor after: Chen Fushuang Inventor after: Ai Nijiang Inventor after: Jin Zhengzhong Inventor after: Wang Li Inventor after: Zhou Xianchun Inventor after: Zhang Haiying Inventor before: Wang Ning Inventor before: Bao Huifang Inventor before: Hou Min Inventor before: Chen Fushuang Inventor before: Jin Zhengzhong Inventor before: Zhou Xianchun Inventor before: Zhang Haiying |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |