CN105177049A - Method for improving bacillus subtilis strain - Google Patents

Abstract

The invention belongs to the field of biology engineering technologies, and particularly relates to a method for improving bacillus subtilis strains. The method includes the steps of manually constructing a gene sequence not containing spore production lethal factor genes, electric shock conversion, sieving verifying and others. In the prior art, although part of basic research is already implemented on the spore production lethal factor genes (skf), whether the yield of endogenous enzymes can be increased through deleting the spore production lethal factor genes is still not determined, and meanwhile for different microorganism strains, after the spore production lethal factor genes are deleted, whether improvements on the fermentation capacity of the strains are the same lacks more research. With the detailed bacillus subtilis strains being examples, new strains lacking spore production lethal factor genes (skf) are successfully constructed, when the strains are concretely used for fermenting and producing amylase, determination results show that the enzyme activity of the constructed new strains is improved well, and good application prospects are achieved.

Description

A kind of method of transformed bacillus Bacillus strain

Technical field

The invention belongs to technical field of bioengineering, be specifically related to a kind of method of transformed bacillus Bacillus strain.

Background technology

Subtilis ( bacillussubtilis) there is non-virulent and the characteristic such as secretory protein ability is strong, be widely used in the fields such as agricultural, medicine and industrial enzyme preparation.The zymin utilizing subtilis to produce has amylase, proteolytic enzyme, lipase, cellulase and Nattokinase etc., improves the method rationalization mutagenesis screening new strains that its fermenting enzyme vigor is commonly used or the expression utilizing the relevant goal gene of genetic engineering means increase.Thus the regulation mechanism of bacillus subtilis enzyme synthesis is understood in depth, to the seed selection of subtilis height bacterium producing multi enzyme preparation by of great advantage.

Existing research is thought, a large amount of synthesis of bacillus subtilis enzyme to enter in deceleration phase and stationary phase subsequently through logarithmic growth after date thalli growth at bacterial growth to occur.But, after bacterial growth enters stationary phase, somatic cells successively can start the expression of sporulation genes involved, and starts the cell of sporulation related gene expression in advance, also can start simultaneously produce spore lethal gene (sporulationkillingfactor, Skf) gene ( skf) expression, thus kill those thalline not yet starting sporulation genes involved and right skfexpress responsive vegetative cell, to make the cell starting sporulation related gene expression in advance obtain enough nutrition and postpone the formation of gemma, this result finally causes the reduction of active somatic cell number and Fungal biodiversity, and this phenomenon is called cannibalism.Just because of the existence of this phenomenon, make bacillus subtilis enzyme output receive basic restriction, and there is no good improved procedure at present.

In prior art, for product spore lethal gene gene ( skfalthough) existing part basis research, but produce spore lethal gene gene by knocking out whether can to improve endogenous enzyme output be then unknown number, simultaneously for different microorganisms bacterial strain, knock out after producing spore lethal gene gene and lack research especially for whether the improvement of strain fermentation ability is identical.The present invention for concrete bacillus subtilis strain, successfully construct disappearance produce spore lethal gene gene ( skf) new strains, by this bacterial strain specifically for fermentative production amylase time, measurement result shows, the enzyme of constructed new strains is lived and obtained better lifting, has shown application prospect preferably.

Summary of the invention

To on existing cannibalism phenomenal research basis, the present invention proposes a kind of method of transformed bacillus Bacillus strain, the method mainly by genetic engineering means knock out produce spore lethal gene gene ( skf) thus build new bacterium producing multi enzyme preparation thus evade the generation of cannibalism phenomenon, there is the effect better improving bacillus subtilis enzyme output simultaneously.

The technique means that the present invention takes is described in detail as follows.

A method for transformed bacillus Bacillus strain, the method comprises the steps:

(1) artificial constructed containing (knocking out) produce spore lethal gene gene ( skf) gene order,

Described containing (knocking out) produce spore lethal gene gene ( skf) gene order, 3173bp, is made up of 3 part DNA fragmentations, is respectively skfupstream portion sequence (Segment A, SEQIDNO.1), tetracycline resistance gene expressed sequence (fragment B, SEQIDNO.3), skfdownstream of gene partial sequence (fragment C, SEQIDNO.2); (it should be noted that, in sequence table, sequence has lap, needs the sequence removing a wherein overlapped part in two sequences during concrete calculating)

Detailed process is as follows:

a. STb gene is extracted,utilize the STb gene of DNA extraction kit extraction Bacillus subtilis genes group for subsequent use;

b. Segment A ( skfupstream portion sequence) pcr amplification, the STb gene of the Bacillus subtilis genes group extracted with steps A is template, designs following primer according to Bacillus subtilis genes group sequence (GenBank sequence number CP010052.1):

P1，5′-TGCGCTGACGTCGATTACCTGGGTTGGTGCGTTA-3′；

P2，5′-CTGTCAAACATGAGAATTACGTGTCATAGCAATACT-3′；

In P2 primer, the CTGTCAAACATGAGAATT partial sequence of 5 ' end belongs to and fragment B(tetracycline resistance gene expressed sequence) overlapping region of joint;

Pcr amplification, amplified production is through electrophoresis and extraction is reclaimed for subsequent use;

c. fragment B(tetracycline resistance gene expressed sequence) pcr amplification, take pBR322 plasmid as template, as follows according to the primers of plasmid:

P3，5′-AGTATTGCTATGACACGTAATTCTCATGTTTGACAG-3′；

P4，5′-TATCAAACACTAATCCAAGTCACCCGAGATGCGCC-3′；

In P3 primer 5 ' end AGTATTGCTATGACACGT partial sequence belong to Segment A ( skfupstream portion sequence) overlapping region, joint;

In P4 primer, the TATCAAACACTAATCCAA partial sequence of 5 ' end belongs to and fragment C( skfdownstream of gene partial sequence) overlapping region, joint;

Pcr amplification, amplified production is through electrophoresis and extraction is reclaimed for subsequent use;

d. fragment C( skfdownstream of gene partial sequence) pcr amplification , the STb gene of the Bacillus subtilis genes group extracted with steps A is template, designs following primer according to Bacillus subtilis genes group sequence (GenBank sequence number CP010052.1):

P5，5′-GGCGCATCTCGGGTGACTTGGATTAGTGTTTGATA-3′；

P6，5′-TCCGGACCCGGGCCATAAAAGTAATAGAAACACAGTAAAG-3′；

In P5 primer, the GGCGCATCTCGGGTG partial sequence of 5 ' end belongs to and fragment B(tetracycline resistance gene expressed sequence) overlapping region of joint;

Pcr amplification, amplified production is through electrophoresis and extraction is reclaimed for subsequent use;

e.PCR merges,pCR prepared by step B, step C, step D is expanded product and carries out PCR fusion, fusion DNA vaccine carries out three-wheel, and detailed process is as follows:

first round fusion DNA vaccine, with Segment A, fragment B for template, do not add primer and carry out pcr amplification;

second takes turns fusion DNA vaccine, in first round PCR reaction solution, add fragment C increase;

third round fusion DNA vaccine,take turns in PCR reaction solution second and add primer P1 and primer P6, amplified production is through electrophoresis and extraction is reclaimed for subsequent use;

Pcr amplification product after three-wheel merges be artificial constructed not containing (knocking out) produce spore lethal gene gene ( skf) gene order;

it is (2) electroporated,

By constructed by step (1) containing (knocking out) produce spore lethal gene gene ( skf) the electroporated bacillus subtilis bacterium competence cell of gene order, obtain transformant;

(3) screening verification,

To constructed bacillus subtilis strain, screening, checking acquisition knock out product spore lethal gene gene and correctly transform bacterial strain.

Described bacillus subtilis strain is subtilis WB800.

Utilize the bacillus subtilis strain constructed by described transformed bacillus Bacillus strain method, the application in amylase preparation, can improve amylase production.

Accompanying drawing explanation

Fig. 1 be artificial constructed containing (knocking out) produce spore lethal gene gene ( skf) gene order process in Segment A, fragment B, fragment C the electrophorogram of PCR primer, wherein A is Segment A electrophorogram, and B is fragment B electrophorogram, and C is fragment C electrophorogram;

Fig. 2 be after fusion DNA vaccine constructed not containing (knocking out) produce spore lethal gene gene ( skf) the electrophorogram of gene order, wherein 1,2 for merging fragment, and be 3173bp, M is 1kbplusmarker;

Fig. 3 verifies across the PCR of genomic dna and homologous recombination fragment, and wherein M is 1kbplusmarker, and 1 is CK(starting strain), 2 ~ 10 is transformant bacterial strain;

Fig. 4 verifies the PCR across genomic dna and homologous recombination fragment upstream sequence of No. 5 transformants, wherein M is 1kbplusmarker, 1 is starting strain take Y1-F/Y1-R as the PCR result of primer, 2 is starting strain take Y2-F/Y2-R as the PCR result of primer, 3 is No. 5 transformants take Y1-F/Y1-R as the PCR result of primer, 4 is No. 5 transformants take Y2-F/Y2-R as the PCR result of primer, and 5 ~ 9 is No. 5 transformants take Y1-F/Y2-R as the PCR result of primer;

Fig. 5 is the viable count comparison diagram after cultivation 24h in nutrient solution;

Fig. 6 is transformant bacterial strain and starting strain amylase activity measurement result comparison diagram.

Embodiment

Below in conjunction with embodiment, explanation is further explained to the present invention, before introducing specific embodiment, briefly introduces as follows to sample segment used in the present invention.

bacterial strain and plasmid

In following embodiment, bacillus subtilis strain used is subtilis WB800, and by Shanghai, Bei Nuo bio tech ltd provides;

In genes involved operation, plasmid used is pBR322 plasmid, and purchased from Shanghai Ji Ning Industrial Co., Ltd., it is mainly as the template of tetracycline resistance gene in PCR process.

used medium in microbial cultivation process

Cultivate subtilis used medium in following embodiment and mainly contain LB liquid medium and solid LB media two class, concrete formula and preparation require as follows:

LB liquid medium: yeast extract 5g, peptone 10g, NaCl10g, distilled water is settled to 1000mL, and be dispensed in 500mL triangular flask after stirring, autoclaving 45min is for subsequent use;

Solid LB media: yeast extract 5g, peptone 10g, NaCl10g, agar 20g, adding distil water boils and mixes, and is then settled to 1000mL with distilled water, and be dispensed in 500mL triangular flask, autoclaving 45min is for subsequent use.

portion of reagent and enzyme

Cell/bacterium/pastoris genomic dna extracts test kit, 2 × TagMix, 2 × pfuMix, 1kbplusmarker, Lai Feng bio tech ltd, Shanghai product;

TaqMasterMix is ShiJi Co., Ltd purchased from health;

LATag, 10 × LAPCRBuffer (Mg ²⁺plus), dNTPMix, purchased from TaKaRa;

Electric shock recovers liquid RM: trehalose 0.5M, sorbyl alcohol 0.5M, glycerine 50%, N.F,USP MANNITOL 0.38M, 121 DEG C, 45min sterilizing;

DNS reagent: preparation method is, takes 3,5-dinitrosalicylic acid (DNS) 1g, being dissolved in 20mL concentration is in the sodium hydroxide solution of 2mol/L, then adds distilled water 50mL, takes and adds 30g Rochelle salt, after dissolving, distilled water is settled to 100mL, and sealing room temperature preservation, avoids CO ₂enter.

embodiment 1

The method of transformed bacillus Bacillus strain provided by the present invention, be first artificial constructed containing (knocking out) produce spore lethal gene gene ( skf) gene order, then by constructed not containing (knocking out) produce spore lethal gene gene ( skf) gene order homologous recombination replacement is carried out to subtilis, obtain and new to knock out (not containing) produce spore lethal gene gene ( skf) bacillus subtilis strain, specifically comprise the steps.

(1) artificial constructed containing (knocking out) produce spore lethal gene gene ( skf) gene order

Described containing (knocking out) produce spore lethal gene gene ( skf) gene order, be made up of 3 part DNA fragmentations, be respectively skfupstream portion sequence (Segment A), tetracycline resistance gene expressed sequence (fragment B), skfdownstream of gene partial sequence (fragment C); Concrete sequence is as shown in sequence table SEQ IDNO.1, table SEQIDNO.2, table SEQIDNO.3.

Concrete construction step is as described below:

a. STb gene is extracted,to specifications, DNA extraction kit is utilized to extract the genomic STb gene of subtilis WB800 for subsequent use;

b. Segment A ( skfupstream portion sequence) pcr amplification, the genomic STb gene of subtilis WB800 extracted with steps A is template, designs following primer according to Bacillus subtilis genes group sequence (GenBank sequence number CP010052.1):

P1，5′-TGCGCTGACGTCGATTACCTGGGTTGGTGCGTTA-3′；

P2，5′-CTGTCAAACATGAGAATTACGTGTCATAGCAATACT-3′；

In P2 primer, the CTGTCAAACATGAGAATT partial sequence of 5 ' end belongs to and fragment B(tetracycline resistance gene expressed sequence) overlapping region of joint;

50 μ L amplification system designs are as follows:

Bacillus subtilis genes group DNA, 1 μ L;

2×pfuMix，25μL；

P1 primer, 1 μ L;

P2 primer, 1 μ L;

ddH ₂O，22μL；

Pcr amplification: 94 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C extend 1min, totally 30 circulations, and 72 DEG C extend 10min, and amplified production is through electrophoresis and extraction is reclaimed for subsequent use;

c. fragment B(tetracycline resistance gene expressed sequence) pcr amplification, take pBR322 plasmid as template, as follows according to the primers of plasmid:

P3，5′-AGTATTGCTATGACACGTAATTCTCATGTTTGACAG-3′；

P4，5′-TATCAAACACTAATCCAAGTCACCCGAGATGCGCC-3′；

In P3 primer 5 ' end AGTATTGCTATGACACGT partial sequence belong to Segment A ( skfupstream portion sequence) overlapping region, joint;

In P4 primer, the TATCAAACACTAATCCAA partial sequence of 5 ' end belongs to and fragment C( skfdownstream of gene partial sequence) overlapping region, joint;

50 μ L amplification system designs are as follows:

PBR322 plasmid, 1 μ L;

2×pfuMix，25μL；

P3 primer, 1 μ L;

P4 primer, 1 μ L;

ddH ₂O，22μL；

Pcr amplification: 94 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 90s, totally 30 circulations, and 72 DEG C extend 10min, and amplified production is through electrophoresis and extraction is reclaimed for subsequent use;

d. fragment C( skfdownstream of gene partial sequence) pcr amplification , the genomic STb gene of subtilis WB800 extracted with steps A is template, designs following primer according to Bacillus subtilis genes group sequence (GenBank sequence number CP010052.1):

P5，5′-GGCGCATCTCGGGTGACTTGGATTAGTGTTTGATA-3′；

P6，5′-TCCGGACCCGGGCCATAAAAGTAATAGAAACACAGTAAAG-3′；

In P5 primer, the GGCGCATCTCGGGTG partial sequence of 5 ' end belongs to and fragment B(tetracycline resistance gene expressed sequence) overlapping region of joint;

50 μ L amplification system designs are as follows:

Bacillus subtilis genes group DNA, 1 μ L;

2×pfuMix，25μL；

P5 primer, 1 μ L;

P6 primer, 1 μ L;

ddH ₂O，22μL；

Pcr amplification: 94 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C extend 1min, totally 30 circulations, and 72 DEG C extend 10min, and amplified production is through electrophoresis and extraction is reclaimed for subsequent use;

e.PCR merges,pCR prepared by step B, step C, step D is expanded product and carries out PCR fusion, fusion DNA vaccine carries out three-wheel, and detailed process is as follows:

first round fusion DNA vaccine, with Segment A, fragment B for template, do not add primer and carry out pcr amplification;

49 μ L amplification system designs are as follows:

2×pfuMix，25μL；

skfthe PCR purified product of upstream gene Segment A, 1 μ L;

tetthe PCR purified product of resistance gene fragment B, 1 μ L;

ddH ₂O，22μL；

Amplification condition is: 94 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, and 72 DEG C extend 150s, totally 14 circulations, and 72 DEG C extend 10min, and amplified production 4 DEG C saves backup;

second takes turns fusion DNA vaccine, in first round PCR reaction solution, add fragment C increase;

50 μ L amplification system designs are as follows:

First round PCR reaction soln, 49 μ L;

skfthe PCR purified product of downstream gene fragment C, 1 μ L;

Amplification condition is: 94 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, and 72 DEG C extend 210s, totally 14 circulations, and 72 DEG C extend 10min, and amplified production 4 DEG C saves backup;

third round fusion DNA vaccine,take turns in PCR reaction solution second and add primer P1 and primer P6;

100 μ L amplification system designs are as follows:

Second takes turns PCR reaction soln, 50 μ L;

2×LATaqMix，46μL；

Primer P1,2 μ L;

Primer P6,2 μ L;

Amplification condition is: 94 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, and 72 DEG C extend 150s, totally 14 circulations, and 72 DEG C extend 10min, and amplified production is through electrophoresis and extraction is reclaimed for subsequent use.

Pcr amplification product after three-wheel merges be artificial constructed not containing (knocking out) produce spore lethal gene gene ( skf) gene order.

After product electrophorogram is increased as shown in Figure 1 to Segment A, fragment B, fragment C.

After three-wheel merges, the electrophoresis detection result of PCR primer as shown in Figure 2.

(2) electroporated

By constructed by step (1) containing (knocking out) produce spore lethal gene gene ( skf) the electroporated bacillus subtilis bacterium competence cell of gene order, obtain transformant, detailed process is as follows:

Get 60 μ L subtilis WB800 competent cells, add 1 μ L(50ng/ μ L) purifying after containing salt ion step (1) prepared by not containing (knocking out) skfthe DNA fragmentation of gene, mixing; Transfer in the electroporated cup of 1mm precooling, ice bath 5min, then shocks by electricity, and electric shock condition is voltage 2kv, 200 Ω, electric shock time 5.5 ~ 5ms;

The electric shock adding 1mL precooling after electric shock immediately recovers liquid RM, hatches (cultivation of shaking table low speed) 3h, then coats on the LB flat board containing 20mg/mL tsiklomitsin for 37 DEG C, is inverted and incubated overnight for 37 DEG C.

Observe transformant form and number next day, take out after forming single white colony and be placed in 4 DEG C of Refrigerator stores.

The bacillus subtilis strain that white colony (transformant) is namely constructed new.

(3) screening verification

To constructed bacillus subtilis strain, generally speaking, further screening verification of still needing, could prove that it successfully constructs, and embody rule.Screening verification mainly refers to the genome of transformant and starting strain (subtilis WB800) as template, verify the PCR across genomic dna and homologous recombination fragment respectively, verify across the PCR of genomic dna and homologous recombination fragment upstream sequence, verify across the PCR of genomic dna and homologous recombination fragment downstream sequence, detailed process briefly introduces as follows.

pCR across genomic dna and homologous recombination fragment verifies

Optionally can in 7 of tetracyclin resistance grow on plates a single white colony, be placed in the LB liquid medium of the tetracyclin resistance containing 20mg/mL of 5mL, 37 DEG C, 220rpm/min shaking table concussion cultivation 12 ~ 16h, choose muddy test tube, extract bacterial genomes DNA and carry out PCR checking.

Design primer sequence is as follows:

Y1-F，5′-ACCGTGTATGAAATCTAACAATGC-3′；

Y2-R，5′-GCCGCAAACGGAGCAACTATT-3′；

50 μ L amplification system designs are as follows:

Pfu enzyme, 22 μ L;

Bacterial genomes DNA, 1 μ L;

Primer Y1-F, 1 μ L;

Primer Y2-R, 1 μ L;

ddH ₂O，25μL；

Pcr amplification: 94 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 51 DEG C of annealing 30s, 72 DEG C extend 2min, totally 30 circulations, and 72 DEG C extend 10min, and amplified production carries out detected through gel electrophoresis.

PCR primer electrophoresis detection result as shown in Figure 3.

As can be seen from the figure, only have No. 4 and No. 5 transformants to amplify band in the position of about 4000bp, this position produce just spore lethal gene gene be knocked after fragment length.And starting strain and remaining transformant only amplify band in the position of bp more than 7000, this position is the complete genome sequence before integrating.Thus the result roughly can judge whether fusion fragment is incorporated into the tram in strain chromosome.In addition, because No. 4 and No. 5 transformants (bacterial strain) also can amplify the band of bp more than 7000, supposition may be that to transform bacterial strain impure, thus still needs and carries out secondary resistance screening further to obtain the transformant bacterial strain isozygotied.

pCR across genomic dna and homologous recombination fragment upstream sequence verifies

Based on above-mentioned PCR the result, for verify further No. 5 transformant bacterial strains be really whether produce spore lethal gene gene ( skf) positive strain that knocks out, the PCR therefore carried out further across genomic dna and homologous recombination fragment upstream sequence verifies.

First primer sequence is designed as follows:

Y1-F，5′-ACCGTGTATGAAATCTAACAATGC-3′；

Y1-R，5′-GCGGGACCAGTGACGAAG-3′；

50 μ L amplification system designs are as follows:

Pfu enzyme, 22 μ L;

Bacterial genomes DNA, 1 μ L;

Primer Y1-F, 1 μ L;

Primer Y1-R, 1 μ L;

ddH ₂O，25μL；

Pcr amplification: 94 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 51 DEG C of annealing 30s, 72 DEG C extend 2min, totally 30 circulations, and 72 DEG C extend 10min, and amplified production carries out detected through gel electrophoresis.

Electrophoresis result is shown in Fig. 4.

As can be seen from the figure, No. 5 transformants amplify single band in correct position, and starting strain then cannot amplify correct band.

pCR across genomic dna and homologous recombination fragment downstream sequence verifies

Based on above-mentioned PCR the result, carry out further verifying across the PCR of genomic dna and homologous recombination fragment downstream sequence to No. 5 transformant bacterial strains.

First primer sequence is designed as follows:

Y2-F，5′-TGTCGCTTGCGGTATTCGGA-3′；

Y2-R，5′-GCCGCAAACGGAGCAACTATT-3′；

50 μ L amplification system designs are as follows:

Pfu enzyme, 22 μ L;

Bacterial genomes DNA, 1 μ L;

Primer Y2-F, 1 μ L;

Primer Y2-R, 1 μ L;

ddH ₂O，25μL；

Pcr amplification: 94 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 51 DEG C of annealing 30s, 72 DEG C extend 2min, totally 30 circulations, and 72 DEG C extend 10min, and amplified production carries out detected through gel electrophoresis.

Electrophoresis result as shown in Figure 4.

As can be seen from the figure, No. 5 transformants amplify single band in correct position, and starting strain then cannot amplify correct band.

embodiment 2

The present embodiment mainly carries out applicability inspection to the new bacillus subtilis strain (i.e. No. 5 transformant bacterial strains) constructed by embodiment 1, and after mainly comprising viable count and fermentation, amylase activity measures two contents, and related check briefing is as follows.

viable count measures

No. 5 transformants (constructed new bacillus subtilis strain) obtain embodiment 1 and starting strain (subtilis WB800) carry out shake-flask culture respectively, 37 DEG C, 220rpm, get respectively and cultivate bacterium liquid 0.1mL after 24h, add in the centrifuge tube containing 0.9mL sterilized water respectively, vortex mixes, and carries out 10 times of serial dilutions (10,10 respectively ¹, 10 ², 10 ³, 10 ⁴, 10 ⁵, 10 ⁶, 10 ⁷, 10 ⁸, 10 ⁹).

Draw 0.1mL diluent, add in LB solid plate, then with spreading rod, bacterium liquid is coated with evenly, each extent of dilution makees 3 plates, be inverted in 37 DEG C of constant incubators after leaving standstill 30min, take out dull and stereotyped after 16 ~ 20h, calculate colony number in flat board, be multiplied by extension rate again, obtain contained B. subtilis cell number (colony forming units cfu) in often milliliter of bacterium liquid sample.

Concrete statistics as shown in Figure 5.

Statistics shows, the viable count of No. 5 transformants is 1.72 × 10 ⁹cfu/mL, and the viable count of starting strain is 8.24 × 10 ⁸cfu/mL, that is: the viable count of No. 5 transformants is significantly higher than starting strain, improves 108.67%(p < 0.05 than starting strain).

fermentation amylase activity measures

37 DEG C, the cultivation of 220rpm/min shaking table in LB liquid nutrient medium respectively of the transformant (constructed new bacillus subtilis strain) that embodiment 1 is obtained and starting strain (subtilis WB800), get bacterium liquid, 4 DEG C, the centrifugal 20min of 8000rpm, get its supernatant liquor and be containing the diastatic crude enzyme liquid of fermentation.

Adopt DNS method to measure its amylase activity to crude enzyme liquid, concrete determination step is as follows:

(1) the tool plug scale test tube of 20 20mL is got, sterilizing-drying in advance, and label; Starting strain (subtilis WB800) and transformant (constructed new bacillus subtilis strain) are sampled respectively respectively at 16h and 24h, sampling amount is 1mL, centrifugal, acquisition crude enzyme liquid, arrange control group, in control group, crude enzyme liquid boils deactivation in 20 minutes simultaneously;

(2) in crude enzyme liquid after crude enzyme liquid in step (1) or deactivation, 2% Zulkovsky starch solution 1mL is added respectively, distilled water 3mL, 60 DEG C of insulation 5min;

(3) in step (2) solution, add citrate buffer solution (PH6.5) 1mL that concentration is 0.1mol/L, in 60 DEG C of water-baths, be incubated 30min;

(4) in step (3) solution, add 1.5mLDNS reagent, boiling water bath 5min, then cools rapidly, and adding distil water is settled to 20mL;

(5) step (4) solution is shaken up, the OD value at spectrophotometric determination 520nm place, and the light absorption value typical curve consulting maltose solution obtains corresponding maltose content.

In the present invention, enzyme activity unit is defined as: 60 DEG C, under the condition of pH6.5, the enzyme amount that 30min discharges needed for 1mg maltose is an enzyme activity unit.

Detected result as shown in Figure 6.

As can be seen from the figure, No. 5 transformant bacterial strains are 27.07U/mL and 26.11U/mL at the enzyme activity of cultivation 16h and 24h respectively, and the enzyme work of starting strain is only 16.17U/mL and 19.33U/mL, this result shows, the work of No. 5 transformant enzymes improves 67.42% and 34.48%(respectively than starting strain p< 0.05).

SEQUENCELISTING

<110> Henan Yangshao Biochemical Engineering Co., Ltd.

The method of a <120> transformed bacillus Bacillus strain

<130>none

<160>3

<170>PatentInversion3.5

<210>1

<211>1171

<212>DNA

<213>Bacillussubtilis

<400>1

tgcgctgacgtcgattacctgggttggtgcgttaggggttatgattgcaattattgcatc60

attgctgattttcaattcgcaaccgaaacaagcgctaaaagatatcaatcaataatttcg120

aaagttctaacatccgctcgttatacaagcgggtgttttttttagcgtagtcagtccatg180

catgagtcttccaagggccgacatcgttctgtatgtgtcgaaggtgcactgaagctgaat240

gagatttcttaaggctttgccgcggcgagctgaagtacagtacgattgccttgatcgaac300

actggaaacacaagagaacgtaaacctgaacatccgcgtaaacgtcaaggaagttgccac360

ttggggagtaaacacttgcatcatctcgctgaaaggcctagacaatgcggatgacagatt420

cgtattgccggaagtaaacacagcgcttgctctgtttccgttgtcgattgcagctgattg480

cttactaatgctgccctgcatctcggttgtgatgtcgataagcagcgtaatgaagagtgt540

tactgtggagtaagatgtttaacccctctggatattttagccgaaggggtttttagtata600

gatatttgatttaaattacaggagacttcattcatttaaccaaagtcattgctttcttaa660

tcactaaagtttatttgaaaataatctcttgatttaatttcctcgaagagattttttgtc720

aatctattaggcatcagaatttttataacataatggaccgtctttttgacgttttgttta780

tagaacaagaaaatattcaaaacataagtggaaaattaggggtgagctcctgtttttctc840

gagaggatagcttgtcagcttttctatttttaaagggttaaaatattctatttatactaa900

ttaatgtaatttttaggataatatacaaaatcccccttacttcgacaattgcaatctggt960

attatcgtatcgcatgggagctatgtcaatagactctatgcaaaaattgagaggaggttt1020

acttatgaaaagaaaccaaaaagaatgggaatctgtgagtaaaaaaggacttatgaagcc1080

gggaggtacttcgattgtgaaagctgctggctgcatgggctgttgggcctcgaagagtat1140

tgctatgacacgtaattctcatgtttgacag1171

<210>2

<211>566

<212>DNA

<213>Bacillussubtilis

<400>2

ggcgcatctcgggtgacttggattagtgtttgatacattgtcaccgttgtatgtggttgt60

atttattgggattatcacagtctcttttatgacaattgcttttacgagccgtcaggtaga120

aatgaaggaatcgttggtgaaagaagctgaattctgggaggaatttcaagaacgtcaatt180

tggttcaggtcaaattatacagaaaccaaaaacgacttggtggggcttgcaaggtctaaa240

tggcatttggtcttttctgtggttggaactgttgctttttaaaaaatatttattttttca300

tagcattcatacggtcatgctcagtggcgtcttttatgtcgtcattttcatgtatccaga360

atggttttatcttctattctttcttatcgtctcggcagtcatgttaagttcctattattc420

aggaattgtcagacattctcaatcaggcacccttcatttattccccggtgccctttggaa480

aaaaatcattattctagagctgacgaatacagtctggttgtatattctttactgtgtttc540

tattacttttatggcccgggtccgga566

<210>3

<211>1472

<212>DNA

<213> plasmid pBR32

<400>3

agtattgctatgacacgtaattctcatgtttgacagcttatcatcgataagctttaatgc60

ggtagtttatcacagttaaattgctaacgcagtcaggcaccgtgtatgaaatctaacaat120

gcgctcatcgtcatcctcggcaccgtcaccctggatgctgtaggcataggcttggttatg180

ccggtactgccgggcctcttgcgggatatcgtccattccgacagcatcgccagtcactat240

ggcgtgctgctagcgctatatgcgttgatgcaatttctatgcgcacccgttctcggagca300

ctgtccgaccgctttggccgccgcccagtcctgctcgcttcgctacttggagccactatc360

gactacgcgatcatggcgaccacacccgtcctgtggatcctctacgccggacgcatcgtg420

gccggcatcaccggcgccacaggtgcggttgctggcgcctatatcgccgacatcaccgat480

ggggaagatcgggctcgccacttcgggctcatgagcgcttgtttcggcgtgggtatggtg540

gcaggccccgtggccgggggactgttgggcgccatctccttgcatgcaccattccttgcg600

gcggcggtgctcaacggcctcaacctactactgggctgcttcctaatgcaggagtcgcat660

aagggagagcgtcgaccgatgcccttgagagccttcaacccagtcagctccttccggtgg720

gcgcggggcatgactatcgtcgccgcacttatgactgtcttctttatcatgcaactcgta780

ggacaggtgccggcagcgctctgggtcattttcggcgaggaccgctttcgctggagcgcg840

acgatgatcggcctgtcgcttgcggtattcggaatcttgcacgccctcgctcaagccttc900

gtcactggtcccgccaccaaacgtttcggcgagaagcaggccattatcgccggcatggcg960

gccgacgcgctgggctacgtcttgctggcgttcgcgacgcgaggctggatggccttcccc1020

attatgattcttctcgcttccggcggcatcgggatgcccgcgttgcaggccatgctgtcc1080

aggcaggtagatgacgaccatcagggacagcttcaaggatcgctcgcggctcttaccagc1140

ctaacttcgatcactggaccgctgatcgtcacggcgatttatgccgcctcggcgagcaca1200

tggaacgggttggcatggattgtaggcgccgccctataccttgtctgcctccccgcgttg1260

cgtcgcggtgcatggagccgggccacctcgacctgaatggaagccggcggcacctcgcta1320

acggattcaccactccaagaattggagccaatcaattcttgcggagaactgtgaatgcgc1380

aaaccaacccttggcagaacatatccatcgcgtccgccatctccagcagccgcacgcggc1440

gcatctcgggtgacttggattagtgtttgata1472

Claims (4)

1. a method for transformed bacillus Bacillus strain, is characterized in that, the method comprises the steps:

it is (1) artificial constructed not containing the gene order of producing spore lethal gene gene,

Described not containing the gene order of producing spore lethal gene gene, be made up of 3 part DNA fragmentations, be respectively skfupstream region of gene partial sequence Segment A SEQIDNO.1, tetracycline resistance gene Express Sequence Tags BSEQIDNO.3, skfdownstream of gene partial sequence fragment CSEQIDNO.2;

it is (2) electroporated,

By constructed by step (1) containing (knocking out) produce spore lethal gene gene ( skf) the electroporated bacillus subtilis bacterium competence cell of gene order, obtain transformant;

(3) screening verification,

To the bacillus subtilis strain constructed by step (2), screening, checking obtain and correctly do not transform bacterial strain containing producing spore lethal gene gene.

2. the method for transformed bacillus Bacillus strain as claimed in claim 1, is characterized in that, described in step (1), the artificial constructed detailed process containing the gene order of producing spore lethal gene gene is as follows:

athe STb gene extracting Bacillus subtilis genes group is for subsequent use;

bthe STb gene of the Bacillus subtilis genes group extracted with steps A is template, design primer, pcr amplification, and amplified production is through electrophoresis and extraction is reclaimed for subsequent use;

ctake pBR322 plasmid as template, design primer, pcr amplification, amplified production is through electrophoresis and extraction is reclaimed for subsequent use;

dthe STb gene of the Bacillus subtilis genes group extracted with steps A is template, design primer, pcr amplification, and amplified production is through electrophoresis and extraction is reclaimed for subsequent use;

epCR prepared by step B, step C, step D is expanded product and carries out three-wheel PCR fusion, the pcr amplification product after three-wheel merges is the artificial constructed gene order not containing product spore lethal gene gene.

3. the method for transformed bacillus Bacillus strain as claimed in claim 1, it is characterized in that, described bacillus subtilis strain is subtilis WB800.

4. utilize the bacillus subtilis strain constructed by transformed bacillus Bacillus strain method described in claim 2, for diastatic preparation.