CN105154568A - Primer pair and kit for detecting CYP3A4 genotyping by pyrosequencing - Google Patents
Primer pair and kit for detecting CYP3A4 genotyping by pyrosequencing Download PDFInfo
- Publication number
- CN105154568A CN105154568A CN201510672628.0A CN201510672628A CN105154568A CN 105154568 A CN105154568 A CN 105154568A CN 201510672628 A CN201510672628 A CN 201510672628A CN 105154568 A CN105154568 A CN 105154568A
- Authority
- CN
- China
- Prior art keywords
- cyp3a4
- test kit
- primer
- plasmid
- sequencing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Abstract
The invention relates to a primer pair and kit for detecting CYP3A4 genotyping by pyrosequencing, belonging to the technical field of in vitro nucleic acid detection. The primer pair comprises a forward amplification primer, a reverse amplification primer and a sequencing primer, wherein a 5' terminal of the forward amplification primer is subjected to biotin labelling. The kit comprises the forward amplification primer, a PCR (polymerase chain reaction) liquid containing the reverse amplification primer, the sequencing primer, uracil DNA (deoxyribonucleic acid)glycosylase and Taq polymerase. The kit provided by the invention has the advantages of accurate detection results, high specificity, short detection period, simplicity in operation, capability of effectively meeting the requirements of clinical examination, capability of monitoring the reaction process in real time, short reaction time, sequencing of PCR products on a pyrosequencing instrument after the PCR products are simply treated, high throughput sample detection and higher sensitivity than gold standard methods, namely capillary electrophoresis sequencing methods.
Description
Technical field
The present invention relates to external nucleic acid detection technique field, particularly relate to primer pair and test kit that a kind of Manganic pyrophosphate complex initiation method detects CYP3A4 gene type.
Background technology
CYP450 enzyme is a kind of important mono-oxygenase, plays an important role, comprise steroid, lipid acid, prostaglandin(PG), medicine, carcinogenic substance and toxin etc. in the oxidation or reductive metabolism of many endogenous and exogenous compounds.In recent years, in people's hepatomicrosome, found nearly 200 kinds of CYP450 isozymes abroad, wherein, CYP3A4 accounts for into 25% of liver CYP450 enzyme total amount, and it take part in the metabolic reaction of multiple environmental toxin and Common Chemotherapy medicine thereof.
Up to now, the CYP3A4 mutation allele found in Chinese is mainly intron 2, introne 10, CYP3A4*3, CYP3A4*4, CYP3A4*5, CYP3A4*6, CYP3A4*18 (wherein, CYP3A4*18B and CYP3A4*1G has identical mutation site 20230G>A) and CYP3A4*19.CYP3A4*1G (same to CYP3A4*18B) is the site that the current CYP3A4 gene mutation frequency found in Chinese population is the highest, has this sudden change of bibliographical information can improve CYP3A4 enzymic activity.
CYP3A4 enzyme participates in the metabolism of multiple opiates medicine (as fentanyl, alfentanil, sufentanil, buprenorphine and methadone etc.).Mainly go hydroxylation to generate at liver through N-after fentanyl intravenously administrable and remove first fentanyl.Research shows, CYP3A4*1G and the metabolism of analgesic fentanyl have substantial connection, reduces relevant with postoperative 24 hours fentanyl anesthesia analgesia consumptions.
Potent immunosuppressant inhibitor tacrolimus (FK506), as clinical first-line drug, because of narrow treatment window and significant individual difference, must adjust dosage by Therapeutic Drug Monitoring in time.FK506 is main through CYP3A4 and CYP3A5 drug metabolism enzymes metabolism in vivo.There is many single nucleotide polymorphism (singlenucleotidepolymorphisms, SNP) in the gene of coding CYP3A4 and CYP3A5 enzyme, if these SNP site are saltant type, will affect metabolic process and the curative effect of patient FK506.Research finds, the genotype in CYP3A4*1G site is relevant to tacrolimus Plasma Concentration and using dosage, untoward reaction and acute rejection.The genotype tests of therefore carrying out CYP3A4*1G site has very important meaning for the personalized medicine realizing tacrolimus.
Manganic pyrophosphate complex initiation (Pyrosequencing) is a kind of based on being polymerized the DNA sequencing of principle (namely, determine the order of DNA nucleotide) method, belong to DNA sequence analysis technology of new generation, possess the ability of simultaneously a large amount of sample being carried out to sequencing analysis, and there is the advantage of high, quick, the directly perceived and low cost of high-throughput, specificity.Its ultimate principle is, by the enzyme cascade chemiluminescence reaction in 4 kinds of enzymatic same reaction systems, take turns in sequencing reaction at each, only add a kind of dNTP, if this dNTP and template are matched, polysaccharase just can be incorporated in primer strand and the tetra-sodium group (PPi) of mole number such as to be discharged, and PPi finally can be converted into visible light signal, and being converted into a peak value by PyrogramTM, the height of each peak value is directly proportional to the nucleotide number mixed in reaction; Then add lower a kind of dNTP, continue the synthesis of DNA chain; Finally by the situation analyzing peak value, reach the object measuring DNA sequence dna.But, pyrosequencing techniques is not also utilized to detect the product of CYP3A4 gene type in prior art.
At present, in prior art, main employing PCR machine (PCR-RFLP), craft or the method such as automatic sequencing and sequence specific primers PCR detect CYP3A4 gene type, these methods exist that detected result accuracy is not high, sense cycle is long and the shortcoming of complex operation, are difficult to the standard-required meeting Clinical Laboratory.
Summary of the invention
In order to solve aforesaid method detect in CYP3A4 genotyping process have that detected result accuracy is not high, sense cycle long, complex operation and be difficult to meet the technical problem of Clinical Laboratory requirement, the invention provides that a kind of detected result is accurate, specificity is high, sense cycle is short, primer pair and test kit that the simple to operate and Manganic pyrophosphate complex initiation method effectively meeting Clinical Laboratory requirement detects CYP3A4 gene type.
The invention provides the primer pair that a kind of Manganic pyrophosphate complex initiation method detects CYP3A4 gene type, the pleomorphism site of described CYP3A4 gene test is CYP3A4*1G, and described primer pair comprises:
Forward amplimer: 5 '-GGAGGAAATTGATGCAGTTTTACC-3 ' (SEQIDNO.1);
Reverse amplimer: 5 '-ACGCTTCTGCCAGTAGCAA-3 ' (SEQIDNO.2);
Sequencing primer: 5 '-CCCTCCTTCTCCATGTA-3 ' (SEQIDNO.3);
Wherein, 5 ' end of described forward amplimer carries out biotin labeling.
Present invention also offers the test kit that a kind of Manganic pyrophosphate complex initiation method detects CYP3A4 gene type, the pleomorphism site of described CYP3A4 gene test is CYP3A4*1G, and described test kit comprises:
Forward amplimer: 5 '-GGAGGAAATTGATGCAGTTTTACC-3 ' (SEQIDNO.1);
PCR reaction solution, described PCR reaction solution contains reverse amplimer: 5 '-ACGCTTCTGCCAGTAGCAA-3 ' (SEQIDNO.2);
Sequencing primer: 5 '-CCCTCCTTCTCCATGTA-3 ' (SEQIDNO.3);
Wherein, 5 ' end of described forward amplimer carries out biotin labeling.
In a kind of preferred embodiment of described test kit provided by the invention, described test kit also comprises:
CYP3A4*1G positive reference substance 1, its wild homozygote plasmid of CYP3A4*1G for being inserted with nucleotide sequence shown in SEQIDNO.5;
CYP3A4*1G positive reference substance 2, its plasmid mixture formed with the CYP3A4*1G no mutant homozygote plasmid being inserted with nucleotide sequence shown in SEQIDNO.6 for the wild homozygote plasmid of described CYP3A4*1G;
CYP3A4*1G positive reference substance 3, it is for being inserted with the CYP3A4*1G no mutant homozygote plasmid of nucleotide sequence shown in SEQIDNO.6;
Wherein, plasmid vector is pMD18-T plasmid; The number ratio of CYP3A4*1G no mutant homozygote plasmid described in described CYP3A4*1G positive reference substance 2 and the wild homozygote plasmid of described CYP3A4*1G is 1:1.
In a kind of preferred embodiment of described test kit provided by the invention, described test kit also comprises: quality control product (controloligo) and blank product, and the sequence of described quality control product is: TAYGGTTTGCA (SEQIDNO.4); Described blank product are water; The sequence of quality control product is by one of QIAGEN design and synthesis section of oligonucleotide chain, for detecting the property indices of PyroMarkQ24 sequenator.
Described PCR reaction solution, also containing other components, is respectively conventional 10 × PCRBuffer, dNTPS and H
2o, each component is volume ratio configuration (10 × PCRBuffer, dNTPs, H routinely
2in O and PCR reaction solution, the volume ratio of reverse amplimer is 5:3:37.5:1).
In described test kit, other reagent and solution are the conventional reagent of PCR and DNA Manganic pyrophosphate complex initiation, as the enzyme mixture be made up of archaeal dna polymerase, adenosine triphosphate sulfurylase, luciferase and bisphosphatase, the substrate mixture be made up of 5'-phosphosulfate and fluorescein, uracil dna glycosylase, Taq polysaccharase etc.
Present invention also offers the application of primer pair as above in the reagent for the preparation of detection CYP3A4 gene type.
Present invention also offers the application of test kit as above in the reagent for the preparation of detection CYP3A4 gene type.
Compared to prior art, primer pair and the test kit of Manganic pyrophosphate complex initiation method detection CYP3A4 gene type provided by the invention have following beneficial effect:
One, by utilizing Manganic pyrophosphate complex initiation law technology to devise highly sensitive and that specificity is good primer pair and test kit thereof, making described test kit when detecting CYP3A4*1G gene type, having accurately qualitative, the advantage of highly sensitive and high specificity; In addition, also have that sample preparation is simple, sequencing steps is simple, order-checking speed is fast, half hour completes and once go up the advantage that machine reacts, directly provides detection site frequency analysis and visual result;
Two, by utilizing Manganic pyrophosphate complex initiation law technology to devise highly sensitive and that specificity is good primer pair and test kit thereof, make described test kit when detecting CYP3A4*1G gene type, Real-Time Monitoring reaction process, reaction times short, PCR primer simple process can go up tetra-sodium sequencer, easy and simple to handle and high-throughput sample detection, and than gold standard method, namely the sensitivity of capillary electrophoresis sequencing is higher, is more suitable for the requirement for Clinical Laboratory;
Three, by being provided with blank product, positive reference substance and quality control product in described test kit, making described test kit when detecting CYP3A4*1G gene type, better can guarantee the accuracy of detected result.
Accompanying drawing explanation
Fig. 1 is the Manganic pyrophosphate complex initiation figure of clinical sample CYP3A4*1G wild-type;
Fig. 2 is the Manganic pyrophosphate complex initiation figure of clinical sample CYP3A4*1G sudden change heterozygous;
Fig. 3 is the Manganic pyrophosphate complex initiation figure of clinical sample CYP3A4*1G mutant homozygous type;
Fig. 4 is the Manganic pyrophosphate complex initiation figure of clinical quality control product controloligo;
Fig. 5 is the Manganic pyrophosphate complex initiation figure of clinical blank product;
Fig. 6 to Fig. 8 is the Manganic pyrophosphate complex initiation figure of many group design primers; Wherein the sequencing result of Fig. 6 and Fig. 7 is all inaccurate, only has the sequencing result of Fig. 8 true and reliable.
Embodiment
In order to make object of the present invention, technical scheme and advantage clearly understand, below in conjunction with drawings and Examples, the present invention is described in further detail.Should be appreciated that specific embodiment described herein only in order to explain the present invention, be not intended to limit the present invention.
Embodiment 1: the preparation of test kit
One, the Design and synthesis of primer and probe
For the pleomorphism site CYP3A4*1G of people CYP3A4 gene test, select special mutational site, use PyroMarkAssayDesign2.0 software, design primer; Wherein forward amplimer, oppositely amplimer and sequencing primer are first through PAGE purifying, then through HPLC purifying, wherein 5 ' of SEQIDNO.1 is biotin labeling.
Table 1. mutational site and type:
| Mutation | Base change |
| CYP3A4*1G(rs2242480) | C>T |
Extension increasing sequence is as table 2:
Table 2. specificity amplification primer and primer sequence
Two, reference substance is selected
The one section of oligonucleotide chain TAYGGTTTGCAcontrololigo using synthetic is quality control product; DNase/RNase-Free water is blank product.
Three, PCR reaction solution composition
Table 3.PCR reaction solution composition
| Material name | Volume (μ L) |
| 10×PCR Buffer | 5 |
| dNTP | 3 |
| The reverse amplimer of CYP3A4*1G | 1 |
| H 2O | 37.5 |
| Cumulative volume | 46.5μL |
Embodiment 2: the use of test kit
One, sample detection
Dissolve primer dry powder (it is 1 month that primer dissolves rear validity period).According to template number preparation system: get PCR reaction solution, add solvent primer, uracil dna glycosylase, Taq DNA polymerase, packing system, adding sample DNA, blank product or positive reference substance is template, composition PCR reaction system.Pcr amplification is carried out according to PCR response procedures.
The each main component of CYP3A4*1G system is as follows:
The each main component of table 4.CYP3A4*1G system
This system response procedures is as follows:
Table 5.PCR response procedures
After having increased, sepharose inspection PCR result, to carry out next step program.
Two, Manganic pyrophosphate complex initiation
Carry out sequencing procedures according to Manganic pyrophosphate complex initiation standard operating procedure, key step is: the preparation of sample and purifying, then the sample after purifying is added upper machine order-checking in the MIX containing annealing liquid and sequencing primer.The corresponding dATP of working procedure, dTTP, dCTP, dGTP, enzyme mixture, substrate mixture is added in Manganic pyrophosphate complex initiation instrument agent bin.Quality control product controloligo carries sequencing primer, and ultimate density is 0.2 μM.
Three, result judges
Quality control product base recall rate is 100%; Blank product recall rate is 0.
Four, quality control standard
All kinds of contrast quality control product judged result is as following table:
Table 6. quality control product standard testing result
Five, report the test:
As shown in Figure 1, Figure 2 and Figure 3, the judging criterion of sample result is as follows for result:
Sample detection result reported by table 7.
| Sample detection result | Report the result | |
| 1 | CYP3A4*1G(C≥90％，T≤10％) | Wild-type |
| 2 | CYP3A4*1G(C≤10％，T≥90％) | Mutant homozygous type |
| 3 | CYP3A4*1G(40％≤C≤60％，40％≤T≤60％) | Sudden change heterozygous |
Fig. 1 display be the wild-type of CYP3A4*1G in clinical sample detected result, Fig. 2 display be the sudden change heterozygous of CYP3A4*1G in clinical sample detected result, Fig. 3 display be the mutant homozygous type of CYP3A4*1G in clinical sample detected result; The quality control product controloligo that what Fig. 4 and Fig. 5 showed respectively is in clinical detection result and the Manganic pyrophosphate complex initiation figure of blank product, Fig. 6 to Fig. 8 display be the Manganic pyrophosphate complex initiation design sketch of many groups primer of design, wherein the primer of Fig. 8 is best (CYP3A4*1G, G=99%, A=1%), be primer selected in our product.
Primer pair and the test kit of Manganic pyrophosphate complex initiation method detection CYP3A4 gene type provided by the invention have following beneficial effect:
One, by utilizing Manganic pyrophosphate complex initiation law technology to devise highly sensitive and that specificity is good primer pair and test kit thereof, making described test kit when detecting CYP3A4*1G gene type, having accurately qualitative, the advantage of highly sensitive and high specificity; In addition, also have that sample preparation is simple, sequencing steps is simple, order-checking speed is fast, half hour completes and once go up the advantage that machine reacts, directly provides detection site frequency analysis and visual result;
Two, by utilizing Manganic pyrophosphate complex initiation law technology to devise highly sensitive and that specificity is good primer pair and test kit thereof, make described test kit when detecting CYP3A4*1G gene type, Real-Time Monitoring reaction process, reaction times short, PCR primer simple process can go up tetra-sodium sequencer, easy and simple to handle and high-throughput sample detection, and than gold standard method, namely the sensitivity of capillary electrophoresis sequencing is higher, is more suitable for the requirement for Clinical Laboratory;
Three, by being provided with blank product, positive reference substance and quality control product in described test kit, making described test kit when detecting CYP3A4*1G gene type, better can guarantee the accuracy of detected result.
The foregoing is only embodiments of the invention; not thereby the scope of the claims of the present invention is limited; every equivalent flow process conversion utilizing description of the present invention to do, or be directly or indirectly used in other relevant technical field, be all in like manner included in scope of patent protection of the present invention.
SEQUENCELISTING
Help bio tech ltd in <110> Changsha three
<120> Manganic pyrophosphate complex initiation method detects primer pair and the test kit of CYP3A4 gene type
<160>6
<170>PatentInversion3.3
<210>1
<211>24
<212>DNA
<213> homo sapiens
<400>1
ggaggaaattgatgcagttttacc24
<210>2
<211>19
<212>DNA
<213> homo sapiens
<400>2
acgcttctgccagtagcaa19
<210>3
<211>17
<212>DNA
<213> homo sapiens
<400>3
ccctccttctccatgta17
<210>4
<211>11
<212>DNA
<213> homo sapiens
<400>4
tayggtttgca11
<210>5
<211>210
<212>DNA
<213> homo sapiens
<400>5
aggaggaaattgatgcagttttacccaataaggtgagtggatggtacatggagaaggagg60
gaggaggtgaaaccttagcaaaaatgcctcctcaccacttcccaggagaatttttataaa120
aagcataatcactgattctttcactgactctatgtaggaaggctctgaaaagaaaaagaa180
agaaacatagttgctactggcagaagcgta210
<210>6
<211>210
<212>DNA
<213> homo sapiens
<400>6
aggaggaaattgatgcagttttacccaataaggtgagtggatgatacatggagaaggagg60
gaggaggtgaaaccttagcaaaaatgcctcctcaccacttcccaggagaatttttataaa120
aagcataatcactgattctttcactgactctatgtaggaaggctctgaaaagaaaaagaa180
agaaacatagttgctactggcagaagcgta210
Claims (8)
1. Manganic pyrophosphate complex initiation method detects a primer pair for CYP3A4 gene type, and it is characterized in that, the pleomorphism site of described CYP3A4 gene test is CYP3A4*1G, and described primer pair comprises:
Forward amplimer: 5 '-GGAGGAAATTGATGCAGTTTTACC-3 ';
Reverse amplimer: 5 '-ACGCTTCTGCCAGTAGCAA-3 ';
Sequencing primer: 5 '-CCCTCCTTCTCCATGTA-3 ';
Wherein, 5 ' end of described forward amplimer carries out biotin labeling.
2. Manganic pyrophosphate complex initiation method detects a test kit for CYP3A4 gene type, and it is characterized in that, the pleomorphism site of described CYP3A4 gene test is CYP3A4*1G, and described test kit comprises:
Forward amplimer: 5 '-GGAGGAAATTGATGCAGTTTTACC-3 ';
PCR reaction solution, described PCR reaction solution contains reverse amplimer: 5 '-ACGCTTCTGCCAGTAGCAA-3 ';
Sequencing primer: 5 '-CCCTCCTTCTCCATGTA-3 ';
Wherein, 5 ' end of described forward amplimer carries out biotin labeling.
3. test kit according to claim 2, is characterized in that, described test kit also comprises:
CYP3A4*1G positive reference substance 1, its wild homozygote plasmid of CYP3A4*1G for being inserted with nucleotide sequence shown in SEQIDNO.5;
CYP3A4*1G positive reference substance 2, its plasmid mixture formed with the CYP3A4*1G no mutant homozygote plasmid being inserted with nucleotide sequence shown in SEQIDNO.6 for the wild homozygote plasmid of described CYP3A4*1G;
CYP3A4*1G positive reference substance 3, it is for being inserted with the CYP3A4*1G no mutant homozygote plasmid of nucleotide sequence shown in SEQIDNO.6;
Wherein, plasmid vector is pMD18-T plasmid.
4. test kit according to claim 3, is characterized in that, the number ratio of CYP3A4*1G no mutant homozygote plasmid described in described CYP3A4*1G positive reference substance 2 and the wild homozygote plasmid of described CYP3A4*1G is 1:1.
5. test kit according to claim 2, is characterized in that, described test kit also comprises: quality control product and blank product, and the sequence of described quality control product is: TAYGGTTTGCA.
6. test kit according to claim 5, is characterized in that, described blank product are water.
7. the application of primer pair according to claim 1 in the reagent for the preparation of detection CYP3A4 gene type.
8. the application of test kit according to claim 2 in the reagent for the preparation of detection CYP3A4 gene type.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510672628.0A CN105154568A (en) | 2015-05-14 | 2015-10-18 | Primer pair and kit for detecting CYP3A4 genotyping by pyrosequencing |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510243376X | 2015-05-14 | ||
| CN201510243376 | 2015-05-14 | ||
| CN201510672628.0A CN105154568A (en) | 2015-05-14 | 2015-10-18 | Primer pair and kit for detecting CYP3A4 genotyping by pyrosequencing |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105154568A true CN105154568A (en) | 2015-12-16 |
Family
ID=54795610
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510672628.0A Pending CN105154568A (en) | 2015-05-14 | 2015-10-18 | Primer pair and kit for detecting CYP3A4 genotyping by pyrosequencing |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105154568A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105274190A (en) * | 2014-07-22 | 2016-01-27 | 复旦大学附属华山医院 | HRM method for detecting genetic polymorphism of CYP3A4*1G and MDR1C1236T |
| CN106086231A (en) * | 2016-08-30 | 2016-11-09 | 长沙三济生物科技有限公司 | The Pyrosequencing primer of qualitative detection STAT4 gene type to and test kit |
| CN107586838A (en) * | 2017-10-25 | 2018-01-16 | 长沙三济生物科技有限公司 | For detecting the primer pair and kit of fentanyl medication related gene polymorphism |
| CN107893114A (en) * | 2017-12-29 | 2018-04-10 | 韩林志 | For primer pair, kit and the method for instructing fentanyl class medicine personalized medicine related gene to detect |
| CN110172517A (en) * | 2019-04-23 | 2019-08-27 | 南通大学 | For detecting the primer pair and kit of people's hypoxemia tolerance related gene polymorphism |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102277443A (en) * | 2011-09-16 | 2011-12-14 | 协和干细胞基因工程有限公司 | Kit for detecting tacrolimus and cyclosporine A individual medicine administration associated single nucleotide polymorphism (SNP) loci and amplification method and detection method |
| CN102719555A (en) * | 2012-07-19 | 2012-10-10 | 韩勇 | Pyrophosphoric acid sequencing kit for detecting CYP3A4*4 genotyping |
-
2015
- 2015-10-18 CN CN201510672628.0A patent/CN105154568A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102277443A (en) * | 2011-09-16 | 2011-12-14 | 协和干细胞基因工程有限公司 | Kit for detecting tacrolimus and cyclosporine A individual medicine administration associated single nucleotide polymorphism (SNP) loci and amplification method and detection method |
| CN102719555A (en) * | 2012-07-19 | 2012-10-10 | 韩勇 | Pyrophosphoric acid sequencing kit for detecting CYP3A4*4 genotyping |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105274190A (en) * | 2014-07-22 | 2016-01-27 | 复旦大学附属华山医院 | HRM method for detecting genetic polymorphism of CYP3A4*1G and MDR1C1236T |
| CN106086231A (en) * | 2016-08-30 | 2016-11-09 | 长沙三济生物科技有限公司 | The Pyrosequencing primer of qualitative detection STAT4 gene type to and test kit |
| CN107586838A (en) * | 2017-10-25 | 2018-01-16 | 长沙三济生物科技有限公司 | For detecting the primer pair and kit of fentanyl medication related gene polymorphism |
| CN107893114A (en) * | 2017-12-29 | 2018-04-10 | 韩林志 | For primer pair, kit and the method for instructing fentanyl class medicine personalized medicine related gene to detect |
| CN110172517A (en) * | 2019-04-23 | 2019-08-27 | 南通大学 | For detecting the primer pair and kit of people's hypoxemia tolerance related gene polymorphism |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105154568A (en) | Primer pair and kit for detecting CYP3A4 genotyping by pyrosequencing | |
| Vannucchi et al. | A quantitative assay for JAK2V617F mutation in myeloproliferative disorders by ARMS-PCR and capillary electrophoresis | |
| KR100789731B1 (en) | 2 617 Methods primers and kits for quantitative detection of JAK2 V617F mutants using pyrosequencing | |
| CN105368826A (en) | Primer pair for detecting CYP2C9 genetic typing through pyrosequencing method and kit | |
| CN105154569A (en) | Primer pair and kit for detecting VKORC1 (vitamin K epoxide reductase complex subunit 1) genotyping by pyrosequencing | |
| CN102534005A (en) | Fluorescent polymerase chain reaction (PCR) kit for detecting CYP2C19 genotypes | |
| CN110938682A (en) | CYP2C19 gene polymorphism detection kit and application thereof | |
| CN102912013A (en) | Sequencing primer for qualitative detection of cytochrome oxidase CYP2C19 genetic typing and kit of sequencing primer | |
| CN102899407B (en) | Sequencing primer for qualitative detection of TPMT genetic typing and kit thereof | |
| CN105177159A (en) | Primer pair and kit for detecting ALDH2 (Aldehyde Dehydrogenase 2) genotype with pyrosequencing method | |
| CN105039513A (en) | Method and primer for detection of non-alcoholic fatty liver disease-correlated target gene polymorphism, as well as kit | |
| CN113151440A (en) | Kit for predicting aspirin curative effect and adverse reaction, detection method and application thereof | |
| JP2010535501A (en) | Methods to identify individuals at risk of thiopurine drug resistance and thiopurine drug intolerance | |
| KR101176194B1 (en) | Method of judging risk for onset of drug induced granulocytopenia | |
| CN103540676B (en) | Kit for detecting mutations of A-G at 1555th site and C-T at 1494th site of mitochondrial gene | |
| CN105018490A (en) | Primer pairs, probes and kit for detecting polymorphism of human MTHFR gene | |
| CN113249463A (en) | Gene detection kit for angiotensin II receptor inhibitor medication and detection method and application thereof | |
| CN108949929A (en) | For detecting the product and its methods and applications of MTHFR and MTRR gene pleiomorphism simultaneously | |
| KR101312480B1 (en) | Novel snp marker for discriminating number of rib of pig and use thereof | |
| CN102899408B (en) | Sequencing primer for qualitative detection of KRAS genetic typing and kit thereof | |
| CN102899406B (en) | Sequencing primer for qualitative detection of genetic typing of uridinediphosphoglucuronate glucuronosyltransferase 1A1 and kit thereof | |
| CN102719555B (en) | Pyrophosphoric acid sequencing kit for detecting CYP3A4*4 genotyping | |
| CN105176991A (en) | Primer pair and kit for detecting CYP3A5 genotype with pyrosequencing method | |
| CN107586837A (en) | For detecting the primer pair and kit of hyperpietic's folic acid metabolism related gene polymorphism | |
| KR101141185B1 (en) | Marker for detecting the proposed efficacy of treatment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151216 |
|
| RJ01 | Rejection of invention patent application after publication |