CN105154480A - Preparation method of vitamin A midbody - Google Patents

Preparation method of vitamin A midbody Download PDF

Info

Publication number
CN105154480A
CN105154480A CN201510642321.6A CN201510642321A CN105154480A CN 105154480 A CN105154480 A CN 105154480A CN 201510642321 A CN201510642321 A CN 201510642321A CN 105154480 A CN105154480 A CN 105154480A
Authority
CN
China
Prior art keywords
aspergillus oryzae
vitamin
preparation
dimethyl
lipase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510642321.6A
Other languages
Chinese (zh)
Inventor
汪钊
郑建永
王升帆
皮士卿
彭后辉
章银军
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University of Technology ZJUT
Zhejiang Medicine Co Ltd Xinchang Pharmaceutical Factory
Original Assignee
Zhejiang University of Technology ZJUT
Zhejiang Medicine Co Ltd Xinchang Pharmaceutical Factory
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University of Technology ZJUT, Zhejiang Medicine Co Ltd Xinchang Pharmaceutical Factory filed Critical Zhejiang University of Technology ZJUT
Priority to CN201510642321.6A priority Critical patent/CN105154480A/en
Publication of CN105154480A publication Critical patent/CN105154480A/en
Pending legal-status Critical Current

Links

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/584—Recycling of catalysts

Abstract

The invention discloses a preparation method of a vitamin A midbody,namely 3, 7-dimethyl-9-(2', 6', 6'-trimethyl-1-cyclohexene) base-2,4,7-triene-1,6-diol-1-acetic ester, and the preparation method comprises the steps of filtering a culture solution obtained through fermentation cultivation of aspergillus oryzae WZ007, treating dry thallus obtained by drying filter cakes as a catalyst, treating 3, 7-dimethyl-9-(2', 6', 6'-trimethyl-1-cyclohexene) base-2,4,7-triene-1,6-diol as a reaction substrate, treating an organic solvent solution of an acylating agent as a reaction medium, conducting reaction under the conditions of 30-50 DEG C and 200 rpm, after the reaction is ended, filtering reaction liquid, recycling the filter cakes and the catalyst, wherein filtrate is mixed liquor containing the vitamin A midbody, conducting separation and purification on the mixed liquor, and obtaining the vitamin A midbody. According to the preparation method of the vitamin A midbody, the area selection rate of used enzyme reaches 99.5%, the reaction conversion rate is as high as 100%, the catalyst can be recycled, the downstream separation is simple, energy consumption is low, production cost is greatly lowered, environmental pollution is little, and the preparation method is suitable for industrial production.

Description

A kind of preparation method of vitamin A intermediate
(1) technical field
The present invention relates to a kind of preparation method of vitamin A intermediate; in particular to one with intermediate I (3; 7-dimethyl-9-(2 '; 6 '; 6 '-trimethylammonium-1-tetrahydrobenzene) base-2; 4; 7-triolefin-1,6-glycol) be reaction substrate, under the effect of lipase, carry out regioselective acylation Reactive Synthesis intermediate II (3; 7-dimethyl-9-(2 '; 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2,4; 7-triolefin-1,6-glycol-1-acetic ester) method.
(2) background technology
Vitamin A (vitaminA) [CAS:68-26-8], also known as Vogan-Neu, is a unsaturated monohydroxy-alcohol with alicyclic ring, comprises retinol1, A2 two kinds.Vitamin A is the nutrient substance of the warm and fine enhancement eyesight of protection eye, has enhancing development, the functions such as booster immunization ability and scavenging free radicals.Hypovitaminosis A can cause nyctalopia.Vitamin A is only present in animal food, and A1 is present in the liver of Mammals and saltwater fish, and A2 is present in the liver of fresh-water fishes.Although vitamin A can obtain from animal tissues, resource-constrained, complex steps, cost is high.Therefore current vitamin A obtains mainly through the method for chemosynthesis.Wherein RocheC14+C6 synthesis technique is for adopt route the most widely in the world.Vitamin A intermediate II is the important intermediate in this technological line, is obtained by vitamin A intermediate I acetylize.Vitamin A intermediate II is again through bromo, and debrominate is reset and obtained.
Use aceticanhydride or acyl chlorides to make acylating agent in US3671575, utilize pyridines, amine organic bases carries out acylation reaction as catalyzer.There is organic bases and carry out pickling after the reaction in the method, alkalizes and dewater and the step such as fractionation by distillation, and process is complicated and there is a large amount of energy consumptions and waste water.
EP0802261 utilizes the commercial enzyme catalysis vitamin A intermediate I acetylize synthesise vitamins A intermediate II such as lipasePLC, lipasePLG, LipozymeIM-20, chirazymeL-2, and reaction conditions is gentle, and transformation efficiency is high.But commercial enzyme is expensive, less stable, causes production cost higher.
(3) summary of the invention
The present invention seeks to the deficiency in order to solve aforesaid method; by screening yielding lipase microorganism; provide a kind of lipase of Cheap highly effective, with vitamin A intermediate I for reaction substrate, under the effect of lipase, carry out the method that regioselectivity acetylize obtains vitamin A intermediate II.
The technical solution used in the present invention is:
The invention provides a kind of vitamin A intermediate 3, 7-dimethyl-9-(2 ', 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2, 4, 7-triolefin-1, the preparation method of 6-glycol-1-acetic ester (II), described method is: filter with the nutrient solution that aspergillus oryzae (Aspergillusoryzae) WZ007 obtains through fermentation culture, the dry mycelium that filtration cakes torrefaction obtains is catalyzer, with 3, 7-dimethyl-9-(2 ', 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2, 4, 7-triolefin-1, 6-glycol is reaction substrate, with the organic solvent solution of acylating agent for reaction medium, at 30 ~ 50 DEG C, carry out under 200rpm condition reacting (more preferably 30 ~ 50 DEG C of conversion 1-48 hour, most preferably 6 ~ 24 hours, esterification yield is 90 ~ 100%), after reaction terminates, by reacting liquid filtering, filter cake reclaims catalyzer, filtrate is containing vitamin A intermediate 3, 7-dimethyl-9-(2 ', 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2, 4, 7-triolefin-1, the mixed solution of 6-glycol-1-acetic ester, separation and purification after mixing, obtain 3, 7-dimethyl-9-(2 ', 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2, 4, 7-triolefin-1, 6-glycol-1-acetic ester (II), described acylating agent is one of following: vinyl acetate, methylvinyl acetate, diacetyl oxide or ethyl acetate.
Further, substrate consumption counts 50 ~ 200g/L reaction medium with reaction medium volume, and catalyst charge counts 10 ~ 50g/L reaction medium with reaction medium volume, and in the organic solvent solution of described acylating agent, acylating agent volumetric concentration is 1 ~ 40%.
Further, organic solvent is one of following: normal hexane, hexanaphthene, methyl tertiary butyl ether, toluene, benzene, ether or chloroform, more preferably normal hexane, hexanaphthene, methyl tertiary butyl ether.
Further, described catalyzer can also for obtaining dry mycelium from aspergillus oryzae (Aspergillusoryzae) WZ007 the aspergillus oryzae WZ007 lipase immobilization enzyme extracting the thick enzyme of aspergillus oryzae WZ007 lipase or the thick enzyme of aspergillus oryzae WZ007 lipase and prepare through fermentation culture.
Further, described dry mycelium is prepared as follows: (1) slant culture: aspergillus oryzae WZ007 is seeded to slant medium, cultivates 3 days, as slant activation seed for 30 DEG C; Slant medium final concentration forms: NaNO 30.1 ~ 0.3%, K 2hPO 40.1 ~ 0.2%, KCl0.3 ~ 0.7%, FeSO 40.001 ~ 0.002%, MgSO 40.04 ~ 0.06%, sucrose 2 ~ 5%, agar 1.5 ~ 2.0%, solvent is deionized water, pH nature; Preferred slant medium final concentration composition: NaNO 30.2%, K 2hPO 40.1%, KCl0.5%, FeSO 40.001%, MgSO 40.05%, sucrose 3%, agar 1.5%, solvent is deionized water, pH nature;
(2) fermentation culture: inclined-plane seed is seeded to liquid state fermentation substratum, 30 ~ 37 DEG C, shaking speed 150 ~ 200r/min cultivate 2 ~ 3 days, filter, obtain mycelium, 0 DEG C of lyophilize 24h, obtain dry mycelium; Liquid state fermentation substratum final concentration consists of: glucose 2 ~ 6%, peptone 2 ~ 5%, sucrose 1 ~ 6%, urea 0.3 ~ 0.9%, NaCl0.4 ~ 0.8%, K 2hPO 40.2 ~ 0.5%, MgSO 40.1 ~ 0.3%, (NH 4) 2sO 40.4 ~ 0.8%, solvent is deionized water, pH nature; Preferred liquid state fermentation substratum final concentration consists of: glucose 20g/L, peptone 20g/L, sucrose 10g/L, urea 3g/L, NaCl5g/L, K 2hPO 42g/L, MgSO 41g/L, (NH 4) 2sO 45g/L, solvent is deionized water, pH nature.
Further, the preparation method of the thick enzyme of aspergillus oryzae WZ007 lipase is: by aspergillus oryzae WZ007 through the dry mycelium pH value that fermentation culture obtains be 7.0 phosphoric acid buffers suspend (damping fluid consumption can by dry mycelium suspend mix, damping fluid volumetric usage is generally 5ml/g dry mycelium) after suspension carry out the fragmentation (condition of preferred ultrasonication: 30KHz, 60 ~ 80W, 60min), centrifugal, get supernatant liquor to add ammonium sulfate to 60% saturation ratio and precipitate, centrifugal, get precipitation be immersed in pH value be 7.0 phosphoric acid buffers (damping fluid consumption can will precipitation submergence, preferred buffer consumption is 2ml/g precipitation) in, after-20 ~ 0 DEG C of lyophilize, obtain aspergillus oryzae WZ007 lyophozyme powder, be the thick enzyme of aspergillus oryzae WZ007 lipase, the add-on of described ammonium sulfate counts 0.5 ~ 0.6g/ml with supernatant volume.
Further, aspergillus oryzae WZ007 immobilized lipase preparation method is: the dry mycelium pH value obtained after fermentation culture by aspergillus oryzae WZ007 is that the suspension after 7.0 phosphoric acid buffers suspend carries out fragmentation, centrifugal, get supernatant liquor to add ammonium sulfate to 60% saturation ratio and precipitate, centrifugal, getting precipitation, to be immersed in pH value be in 7.0 phosphoric acid buffers, after-20 ~ 0 DEG C of lyophilize, obtain aspergillus oryzae WZ007 lyophozyme powder, be the thick enzyme of lipase; Thick for lipase enzyme being added pH value is that in 7.0 phosphoric acid buffers, (thick for lipase enzyme can mix by damping fluid consumption, preferred buffer consumption is the thick enzyme of 4ml/g), add diatomite again, 100 ~ 200rpm shaking table filters after stirring 6h, after getting the cleaning of precipitation distilled water, obtain aspergillus oryzae WZ007 immobilized lipase; Described diatomite and the thick enzyme mass ratio of lipase are 1 ~ 5:1.
Further; the method of mixed solution separation and purification is: after reaction terminates, reacting liquid filtering is removed lipase, and filtrate decompression is distilled to absence of liquid and flows out except desolventizing and acylating agent; enriched material is dry; obtain 3,7-dimethyl-9-(2 ', 6 '; 6 '-trimethylammonium-1-tetrahydrobenzene) base-2; 4,7-triolefin-1,6-glycol-1-acetic ester.
Aspergillus oryzae of the present invention (Aspergillusoryzae) WZ007, is preserved in China typical culture collection center, deposit number CCTCCNo:M206105, preservation date on October 8th, 2006, open in ZL200610154832.4 application.Obtain zymin for enzymatic clarification intermediate II after the process such as described aspergillus oryzae WZ007 is obtained by screening in soil, obtains thalline by fermentation, dry, an esterification yield is 90-100%, refines and obtains highly purified product.
The 18SrDNA sequence of aspergillus oryzae WZ007 of the present invention is as follows, and size is 595bp:
TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA。
U is 1 enzyme activity unit, 1 described enzyme activity unit is the amount that the per minute measured under defined terms catalyzes and synthesizes the lipase of 1 μm of ol amount of intermediate II, described prescribed condition is: get 0.1g dry mycelium or 0.01g lyophozyme powder (or immobilized enzyme) and 0.5g intermediate I, add the hexane solution of 10ml containing 10% (volume ratio) vinyl acetate, under 40 DEG C of conditions, stirring in water bath rotating speed 200rpm, after reaction 30min, cross and filter biological catalyst, extract reaction solution and measure with efficient liquid phase chromatographic analysis (HPLC) intermediate II transforming and obtain.The organic solvent of every energy solubilizing reaction substrate intermediate I or product II is all within protection scope of the present invention.
In the present invention, matter percentage concentration is quality concentration of volume percent, and something concentration 1% represents in every 100mL solution containing this material 1g.
Compared with prior art, beneficial effect of the present invention is mainly reflected in: instant invention overcomes chemical process severe reaction conditions, by product is many, and separating step is many, and energy consumption is large waits deficiency, and commodity enzyme process acetylation catalyst high in cost of production shortcoming.
The regioselectivity strong (regional choice rate reaches 99.5%) of preparation method's enzyme used of intermediate II of the present invention, reaction conversion ratio high (up to 100%), catalyzer can reuse, downstream separation is simple, energy consumption is low, greatly reduce production cost, environmental pollution is little, is applicable to suitability for industrialized production.
(4) embodiment
Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:
Embodiment 1:
Slant culture: aspergillus oryzae (Aspergillusoryzae) WZ007 (deposit number CCTCCNo.M206105) is seeded to slant medium, cultivates 3 days, as slant activation seed for 30 DEG C.Slant medium final concentration forms: NaNO 30.2%, K 2hPO 40.1%, KCl0.5%, FeSO 40.001%, MgSO 40.05%, sucrose 3%, agar 1.5%, solvent is deionized water, pH nature, 121 DEG C of sterilizings 20 minutes.
Fermentation culture: inclined-plane seed is seeded to 1L liquid state fermentation substratum, 30 DEG C of shaking speed 200r/m cultivate 48 hours, filter, obtain mycelium 80g weight in wet base, 0 DEG C of lyophilize 24h, obtain dry mycelium 20g.Liquid state fermentation substratum final concentration consists of: glucose 20g/L, peptone 20g/L, sucrose 10g/L, urea 3g/L, NaCl5g/L, K 2hPO 42g/L, MgSO 41g/L, (NH 4) 2sO 45g/L, solvent is deionized water, pH nature, and liquid amount is the bottled liquid 80ml of 500ml triangle, 121 DEG C of sterilizings 20 minutes.
The aspergillus oryzae WZ007 dry mycelium 20g that fermentation culture is obtained, add the suspension after 100ml phosphoric acid buffer (pH value is 7.0) by the cell crushing instrument fragmentation (condition of ultrasonication: 30KHz, 60 ~ 80W, 60min), centrifugal, get supernatant liquor 80ml, after adding ammonium sulfate to 60% saturation ratio precipitation, centrifugal, get precipitation and obtain the thick enzyme 2.5g of lipase, be immersed in 5ml phosphoric acid buffer (pH value is 7.0), after-20 ~ 0 DEG C of lyophilize, obtain aspergillus oryzae WZ007 lyophozyme powder (i.e. the thick enzyme of aspergillus oryzae WZ007 lipase).
The thick enzyme 2.5g of aspergillus oryzae WZ007 lipase obtained above is added in 10ml phosphoric acid buffer (pH value is 7.0), add 5g diatomite again, adsorption of immobilization under 30 DEG C of conditions is carried out to lipase, shaking table filters after stirring 6h, after getting the cleaning of precipitation distilled water, obtain aspergillus oryzae WZ007 lipase immobilization enzyme.
Enzyme activity determination method: get 0.1g dry mycelium and 0.5g intermediate I (3, 7-dimethyl-9-(2 ', 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2, 4, 7-triolefin-1, 6-glycol), add the hexane solution of 10ml containing 10% (volume ratio) vinyl acetate, under 40 DEG C of conditions, stirring in water bath rotating speed 200rpm, after reaction 30min, cross and filter biological catalyst, extract reaction solution and measure with efficient liquid phase chromatographic analysis (HPLC) intermediate II (3 transforming and obtain, 7-dimethyl-9-(2 ', 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2, 4, 7-triolefin-1, 6-glycol-1-acetic ester).Under these conditions, per minute catalyzes and synthesizes the amount of the lipase needed for 1 μm of ol intermediate II, is designated as 1 enzyme activity unit (1U).
The vitality test of aspergillus oryzae WZ007 lyophozyme powder and aspergillus oryzae WZ007 lipase immobilization enzyme is with aspergillus oryzae WZ007 dry mycelium, and the enzyme recording dry mycelium is lived as 20.1U/g, and the enzyme of lyophozyme powder is lived as 430.1U/g, and the enzyme of immobilized enzyme is lived as 52.4U/g.
The HPLC condition determination of intermediate I and intermediate II: column type is ODS post; Moving phase is: acetonitrile: water=8:2 (v/v); Flow velocity is 1mL/min; Determined wavelength 220nm.
Embodiment 2:
The 0.1g aspergillus oryzae WZ007 dry mycelium obtained by embodiment 1 method and 0.5g intermediate I; add 10ml containing in the hexane solution of 10% (volume ratio) vinyl acetate; 30 DEG C, under 200rpm condition; after water-bath 12h; filter; HPLC detection reaction transformation efficiency 99.5% (regional choice rate 99.0%); filtrate underpressure distillation to absence of liquid under 0.1MPa pressure flows out except desolventizing and acylating agent; obtain vitamin-E intermediate II; purity is 97.8%, can be directly used in next step reaction.
Embodiment 3:
The 0.1g aspergillus oryzae WZ007 dry mycelium obtained by embodiment 1 method and 0.5g intermediate I; add 10ml containing in the hexane solution of 10% (volume ratio) different acylating agent; 30 DEG C, under 200rpm condition; water-bath 12h; by reacting liquid filtering; filtrate adopts HPLC detection reaction transformation efficiency, obtains enzymatic conversion and the results are shown in Table 1.
The enzymatic conversion result of the different acylating agent type of table 1
Embodiment 4:
The 0.1g aspergillus oryzae WZ007 dry mycelium obtained by embodiment 1 method and 0.5g intermediate I, add 10ml containing in the different organic solvents solution of 10% (volume ratio) vinyl-acetic ester, 30 DEG C, under 200rpm condition, water-bath 12h, by reacting liquid filtering, filtrate adopts HPLC detection reaction transformation efficiency, obtains enzymatic conversion and the results are shown in Table 1.
The enzymatic conversion result of table 1 different solvents type
Embodiment 5:
The 0.1g aspergillus oryzae WZ007 dry mycelium obtained by embodiment 1 method and 0.5g intermediate I, add 10ml containing in the hexane solution of 10% (volume ratio) vinyl acetate, 30 DEG C, under 200rpm condition, after water-bath 12h, reaction solution after reaction transforms, cross and filter thalline, filtrate adopts HPLC to detect transformation efficiency.New reaction substrate system (0.5g intermediate I is added by filtering the thalline 0.1g obtained, add 10ml containing in the hexane solution of 10% (volume ratio) vinyl acetate, 30 DEG C, under 200rpm condition, water-bath 12h) continue reaction, so repeatedly, reuse 5 times, obtain enzymatic conversion and the results are shown in Table 2.After aspergillus oryzae WZ007 dry mycelium uses 5 times, enzymatic conversion rate does not still obviously decline.
Table 2: enzymatic conversion result in batches repeatedly
Embodiment 6:
The 0.4g aspergillus oryzae WZ007 dry mycelium obtained by embodiment 1 method and 1.0g intermediate I, add 10ml containing in the hexane solution of 10% (volume ratio) vinyl acetate, 30 DEG C, under 200rpm condition, after water-bath 16h, reaction conversion ratio 99.2%.After reaction terminated bacteriological filtration powder, filtrate is flowed out except desolventizing and acylating agent to absence of liquid through underpressure distillation under 0.1MPa pressure, and obtain vitamin-E intermediate II, purity is 97.4%.
Embodiment 7:
The 0.1g aspergillus oryzae WZ007 freeze-dried vaccine powder obtained by embodiment 1 method and 1.0g intermediate I, add 10ml containing in the hexane solution of 10% (volume ratio) vinyl acetate, 30 DEG C, under 200rpm condition, after water-bath 6h, reaction conversion ratio 99.5%.After reaction terminates to filter enzyme powder, filtrate is flowed out except desolventizing and acylating agent to absence of liquid through underpressure distillation under 0.1MPa pressure, and obtain vitamin-E intermediate II, purity is 98.1%.
Embodiment 8:
The 0.2g aspergillus oryzae WZ007 lipase immobilization enzyme obtained by embodiment 1 method and 1.0g intermediate I, add 10ml containing in the hexane solution of 10% (volume ratio) vinyl acetate, 30 DEG C, under 200rpm condition, after water-bath 12h, reaction conversion ratio 99.0%.After reaction terminates to filter immobilized enzyme, filtrate is flowed out except desolventizing and acylating agent to absence of liquid through underpressure distillation under 0.1MPa pressure, and obtain vitamin-E intermediate II, purity is 96.8%.
Embodiment 9:
By embodiment 2 method, replace aspergillus oryzae WZ007 dry mycelium as biological catalyst with the fatty enzyme resting cell of other bacterial classification, other conditions are constant, carry out enzymatic conversion method to intermediate I.The reaction conversion ratio of this reaction and regioselectivity are in table 3.Table 3 result shows, the fungal lipases such as zhizopchin all have certain activity of conversion to substrate.
Table 3: the conversion results of different strain source lipase
The above is only preferred embodiment of the present invention, not does any pro forma restriction to technology contents of the present invention.Every above embodiment is done according to technical spirit of the present invention any simple modification, equivalent variations and modification, all fall into protection scope of the present invention.

Claims (8)

1. a vitamin A intermediate 3, 7-dimethyl-9-(2 ', 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2, 4, 7-triolefin-1, the preparation method of 6-glycol-1-acetic ester, it is characterized in that described method is: filter with the nutrient solution that aspergillus oryzae (Aspergillusoryzae) WZ007 obtains through fermentation culture, the dry mycelium that filtration cakes torrefaction obtains is catalyzer, with 3, 7-dimethyl-9-(2 ', 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2, 4, 7-triolefin-1, 6-glycol is reaction substrate, with the organic solvent solution of acylating agent for reaction medium, at 30 ~ 50 DEG C, react under 200rpm condition, after reaction terminates, by reacting liquid filtering, filter cake reclaims catalyzer, filtrate is containing vitamin A intermediate 3, 7-dimethyl-9-(2 ', 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2, 4, 7-triolefin-1, the mixed solution of 6-glycol-1-acetic ester, by mixed solution separation and purification, obtain 3, 7-dimethyl-9-(2 ', 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2, 4, 7-triolefin-1, 6-glycol-1-acetic ester, described acylating agent is one of following: vinyl acetate, methylvinyl acetate, diacetyl oxide or ethyl acetate.
2. vitamin A intermediate 3 as claimed in claim 1; 7-dimethyl-9-(2 '; 6 '; 6 '-trimethylammonium-1-tetrahydrobenzene) base-2,4,7-triolefin-1; the preparation method of 6-glycol-1-acetic ester; it is characterized in that substrate consumption counts 50 ~ 200g/L reaction medium with reaction medium volume, catalyst charge counts 10 ~ 50g/L reaction medium with reaction medium volume, and in the organic solvent solution of described acylating agent, acylating agent volumetric concentration is 1 ~ 40%.
3. vitamin A intermediate 3 as claimed in claim 1,7-dimethyl-9-(2 ', 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2,4, the preparation method of 7-triolefin-1,6-glycol-1-acetic ester, is characterized in that organic solvent is one of following: normal hexane, hexanaphthene, methyl tertiary butyl ether, toluene, benzene, ether or chloroform.
4. vitamin A intermediate 3 as claimed in claim 1,7-dimethyl-9-(2 ', 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2,4, the preparation method of 7-triolefin-1,6-glycol-1-acetic ester, is characterized in that described catalyzer can also for obtaining dry mycelium from aspergillus oryzae (Aspergillusoryzae) WZ007 the aspergillus oryzae WZ007 lipase immobilization enzyme extracting the thick enzyme of aspergillus oryzae WZ007 lipase or the thick enzyme of aspergillus oryzae WZ007 lipase and prepare through fermentation culture.
5. vitamin A intermediate 3 as claimed in claim 1,7-dimethyl-9-(2 ', 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2,4,7-triolefin-1, the preparation method of 6-glycol-1-acetic ester, it is characterized in that described dry mycelium is prepared as follows: (1) slant culture: aspergillus oryzae WZ007 is seeded to slant medium, 30 ~ 37 DEG C, rotating speed 150 ~ 200r/min cultivate 2 ~ 3 days, as slant activation seed; Slant medium final concentration forms: slant medium final concentration forms: NaNO 30.1 ~ 0.3%, K 2hPO 40.1 ~ 0.2%, KCl0.3 ~ 0.7%, FeSO 40.001 ~ 0.002%, MgSO 40.04 ~ 0.06%, sucrose 2 ~ 5%, agar 1.5 ~ 2.0%, solvent is deionized water, pH nature;
(2) fermentation culture: inclined-plane seed is seeded to liquid state fermentation substratum, 30 DEG C, 200r/min cultivates 48 hours, filters, obtains mycelium, 0 DEG C of lyophilize 24h, obtains dry mycelium; Liquid state fermentation substratum final concentration consists of: glucose 2 ~ 6%, peptone 2 ~ 5%, sucrose 1 ~ 6%, urea 0.3 ~ 0.9%, NaCl0.4 ~ 0.8%, K 2hPO 40.2 ~ 0.5%, MgSO 40.1 ~ 0.3%, (NH 4) 2sO 40.4 ~ 0.8%, solvent is deionized water, pH nature; .
6. vitamin A intermediate 3 as claimed in claim 4, 7-dimethyl-9-(2 ', 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2, 4, 7-triolefin-1, the preparation method of 6-glycol-1-acetic ester, it is characterized in that the preparation method of the thick enzyme of aspergillus oryzae WZ007 lipase is: the dry mycelium pH value obtained after fermentation culture by aspergillus oryzae WZ007 is that the suspension after 7.0 phosphoric acid buffers suspend carries out fragmentation, centrifugal, get supernatant liquor to add ammonium sulfate to 60% saturation ratio and precipitate, centrifugal, getting precipitation, to be immersed in pH value be in 7.0 phosphoric acid buffers, after-20 ~ 0 DEG C of lyophilize, obtain aspergillus oryzae WZ007 lyophozyme powder, be the thick enzyme of aspergillus oryzae WZ007 lipase.
7. vitamin A intermediate 3 as claimed in claim 4, 7-dimethyl-9-(2 ', 6 ', 6 '-trimethylammonium-1-tetrahydrobenzene) base-2, 4, 7-triolefin-1, the preparation method of 6-glycol-1-acetic ester, it is characterized in that aspergillus oryzae WZ007 immobilized lipase preparation method is: the dry mycelium pH value obtained after fermentation culture by aspergillus oryzae WZ007 is that the suspension after 7.0 phosphoric acid buffers suspend carries out fragmentation, centrifugal, get supernatant liquor to add ammonium sulfate to 60% saturation ratio and precipitate, centrifugal, getting precipitation, to be immersed in pH value be in 7.0 phosphoric acid buffers, after-20 ~ 0 DEG C of lyophilize, obtain aspergillus oryzae WZ007 lyophozyme powder, be the thick enzyme of lipase, it is in 7.0 phosphoric acid buffers that thick for lipase enzyme is added pH value, then adds diatomite, and 100 ~ 200rpm shaking table filters after stirring 6h, after getting the cleaning of precipitation distilled water, obtains aspergillus oryzae WZ007 immobilized lipase, described diatomite and the thick enzyme mass ratio of lipase are 1 ~ 5:1.
8. vitamin A intermediate 3 as claimed in claim 1; 7-dimethyl-9-(2 '; 6 '; 6 '-trimethylammonium-1-tetrahydrobenzene) base-2,4,7-triolefin-1; the preparation method of 6-glycol-1-acetic ester; it is characterized in that the method for mixed solution separation and purification is: after reaction terminates, reacting liquid filtering is removed lipase, filtrate decompression distillation is except desolventizing and acylating agent; the enriched material obtained is dry; namely 3,7-dimethyl-9-(2 ', 6 ' is obtained; 6 '-trimethylammonium-1-tetrahydrobenzene) base-2; 4,7-triolefin-1,6-glycol-1-acetic ester.
CN201510642321.6A 2015-09-30 2015-09-30 Preparation method of vitamin A midbody Pending CN105154480A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510642321.6A CN105154480A (en) 2015-09-30 2015-09-30 Preparation method of vitamin A midbody

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510642321.6A CN105154480A (en) 2015-09-30 2015-09-30 Preparation method of vitamin A midbody

Publications (1)

Publication Number Publication Date
CN105154480A true CN105154480A (en) 2015-12-16

Family

ID=54795525

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510642321.6A Pending CN105154480A (en) 2015-09-30 2015-09-30 Preparation method of vitamin A midbody

Country Status (1)

Country Link
CN (1) CN105154480A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116083250A (en) * 2023-01-14 2023-05-09 湖南万全裕湘生物科技有限公司 Aspergillus oryzae strain for producing active lipase, application and fermentation enzyme production method and application

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3671575A (en) * 1970-11-30 1972-06-20 Hoffmann La Roche Process for preparing vitamin a esters
CN1169473A (en) * 1996-04-18 1998-01-07 弗·哈夫曼-拉罗切有限公司 Enzymatic acylation method
CN1313851A (en) * 1998-07-10 2001-09-19 阿方蒂动物营养素股份有限公司 Method for preparing vitamin A
CN1348947A (en) * 2000-10-18 2002-05-15 浙江新和成股份有限公司 Prepn process of vitamin A intermediate

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3671575A (en) * 1970-11-30 1972-06-20 Hoffmann La Roche Process for preparing vitamin a esters
CN1169473A (en) * 1996-04-18 1998-01-07 弗·哈夫曼-拉罗切有限公司 Enzymatic acylation method
CN1313851A (en) * 1998-07-10 2001-09-19 阿方蒂动物营养素股份有限公司 Method for preparing vitamin A
CN1348947A (en) * 2000-10-18 2002-05-15 浙江新和成股份有限公司 Prepn process of vitamin A intermediate

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HONG-DE YAN 等: "Biocatalytic synthesis of short-chain fl avor esters with high substrate", 《CATALYSIS COMMUNICATIONS》 *
禹邦超 等: "《酶工程》", 31 January 2004, 华中师范大学出版社 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116083250A (en) * 2023-01-14 2023-05-09 湖南万全裕湘生物科技有限公司 Aspergillus oryzae strain for producing active lipase, application and fermentation enzyme production method and application

Similar Documents

Publication Publication Date Title
CN102660593B (en) Method for preparing glyceride rich in algal oil n-3 polyunsaturated fatty acid through enzyme process
CN105821088A (en) Method for preparing glyceride rich in EPA and DHA through enzyme catalysis
CN105349587B (en) The method of EPA and DHA content in a kind of raising glyceride type fish oil
CN110331139B (en) Immobilization method of candida antarctica lipase B
JP5967754B2 (en) Usage of yeast extract extraction residue
Sivasankar et al. Characterization of a novel polymeric bioflocculant from marine actinobacterium Streptomyces sp. and its application in recovery of microalgae
CN103756992B (en) A kind of chocolate microbacterium magnetic cell and its preparation method and application
CN102618601B (en) Method for preparing sucrose-6-ethyl ester by using biological fermentation and immobilized enzyme methods
CN105441521A (en) Synthetic method of vitamin A palmitate
CN104046662A (en) Transesterification preparation method for 1,3-dioleic acid-2-triglyceride palmitate
CN101805756B (en) Biological catalysis method for preparing statin medicinal intermediate
CN104673870A (en) Method for synthesizing vitamin A palmitate by using immobilized esterase E.coli BioH as catalyst
CN102994594A (en) Method for producing glycosylated puerarin by using immobilized enzyme
CN102994429B (en) Method for preparing (S)-alpha-ethyl-2-oxyen-1-pyrrolidine acetic acid ester through microorganism catalysis and bacterial strain
CN105154480A (en) Preparation method of vitamin A midbody
CN101205548B (en) Use of saccharomyces cerevisiae in preparation of (S)-(-)-3-chlorine-1-phenylpropanol
CN104498546A (en) Method for preparing octacosanol ester through enzyme catalysis
CN101701243B (en) Method for producing R-mandelic acid and derivates thereof by biocatalysis
CN106636252A (en) Thelephora ganbajun Zang exopolysaccharide, preparation method thereof and application of exopolysaccharide
CN103409478B (en) Method for synthesizing biotin intermediate lactone through chemical enzyme method
CN104774794A (en) Strain capable of producing D-mannose isomerase and method for producing D-mannose isomerase by using same
CN108866144A (en) A method of preparing and purifying astaxanthin
CN108484692A (en) A method of the high efficiency extraction Glucosamine from zymotic fluid
CN107236779A (en) A kind of method that fungi is catalyzed steroidal bioconversion
CN106978452B (en) Method for synthesizing lauric acid monoester kojic acid by biological method

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20151216