CN105154347A - Genetic recombination brewer's yeast for degrading fat, construction method and application - Google Patents
Genetic recombination brewer's yeast for degrading fat, construction method and application Download PDFInfo
- Publication number
- CN105154347A CN105154347A CN201510363239.XA CN201510363239A CN105154347A CN 105154347 A CN105154347 A CN 105154347A CN 201510363239 A CN201510363239 A CN 201510363239A CN 105154347 A CN105154347 A CN 105154347A
- Authority
- CN
- China
- Prior art keywords
- saccharomyces cerevisiae
- yeast
- yeast saccharomyces
- brewer
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a genetic recombination brewer's yeast for degrading fat, and also discloses a construction method of the genetic recombination brewer's yeast for degrading fat effectively. The genetic recombination brewer's yeast contains exogenous protease genes. By the genetic recombination brewer's yeast, fat degrading efficiency of yeast cells is improved effectively. The genetic recombination brewer's yeast has features of low cost, biomass reusability and zero secondary pollution, and plays an active driving role in degradation of fat in an environmental area, and large-scale fermentation of lipase and production of biodiesel in an industry area.
Description
Technical field
The invention belongs to technical field of bioengineering, relate to a kind of gene recombination yeast saccharomyces cerevisiae of efficient degradation fat particularly.
The invention still further relates to the construction process of said gene recombinant Saccharomyces cerevisiae.
The invention still further relates to the application of said gene recombinant Saccharomyces cerevisiae in degraded is fatty.
Background technology
Along with the development of Industrial Catalysis technology, lipase now becomes study hotspot as a kind of important biological catalyst.Do not need during the lipase-catalyzed reaction of microbial source that coenzyme, mild condition, energy consumption are low, by product is few, being widely used in the fields such as food-processing, biofuel preparation, Enzyme sensor, is the important sources of industrial lipase.But, there is the problems such as enzyme cost is high, activity is low, stability is low in actual applications, screening and exploitation have new catalytic microbial lipase that is active and high stability becomes current subject matter urgently to be resolved hurrily, and genetic engineering technique is that the solution of this problem and the application transformation of this enzyme provide platform.
Yeast saccharomyces cerevisiae is the common bacterial classification of industrial fermentation, and biological safety is high, and its surface display system can make foreign protein in cell surface great expression.The principle of Cell surface display is adventitia exogenous peptide being fixed on cell with the form of fusion rotein; the polypeptide be expressed can keep relatively independent space structure and biological activity; this technology collection express, purifying and be fixed on one, all have wide practical use in multiple fields such as medicine, food, biofuel, environment protection.So far, whether can improve enzymic activity for the lip gene after codon modify at brewing yeast cell surface display, there is not yet relevant report both at home and abroad.
Summary of the invention
The object of this invention is to provide a kind of gene recombination yeast saccharomyces cerevisiae of efficient degradation fat.
Another object of the present invention is to provide a kind of construction process of said gene recombinant Saccharomyces cerevisiae.
For achieving the above object, the gene recombination yeast saccharomyces cerevisiae of degraded fat provided by the invention, containing Exogenous Lipase gene.
The construction process of said gene recombinant Saccharomyces cerevisiae provided by the invention, step is:
S1, according to yeast saccharomyces cerevisiae codon-bias, transformation lipase gene encoding sequence, synthesizes this gene;
S2, lipase gene is connected with yeast saccharomyces cerevisiae surface display vector pYD1 builds recombinant expression vector;
S3, the recombinant expression vector that above-mentioned structure obtains is transformed in yeast saccharomyces cerevisiae (Saccharomycescerevisiae) EBY100, builds gene recombination yeast saccharomyces cerevisiae.
Gene recombination yeast saccharomyces cerevisiae provided by the invention can be used for a large amount of production high purity lipase, expression amount is high, cost is low, applied range, suitability for industrialized production for lipase provides a kind of novel method, for the aspects such as grease intensive processing, bioenergy preparation, kitchen castoff resource utilization, the exploitation of industrial lipase source provide Technical Reference.
Accompanying drawing explanation
Fig. 1 is expression vector pYD1 plasmid map.
Fig. 2 is recombinant lipase Saccharomyces cerevisiae transformant daughter colony PCR qualification figure.
Embodiment
The technical problem that the present invention solves is to provide a kind of recombinant Saccharomyces cerevisiae of surface display lipase, by cell surface expression lipase, increases the contact area of enzyme-to-substrate, reaches the object improving fat acid decomposition efficiency.Described lipase gene is connected to carrier pYD1 (see Fig. 1), and is transformed in yeast saccharomyces cerevisiae (S.cerevisiae) EBY100.Meanwhile, this enzyme characteristic is analyzed.
For solving the problems of the technologies described above, concrete scheme of the present invention is:
1) according to yeast saccharomyces cerevisiae codon-bias, transformation lipase gene encoding sequence, synthesizes this gene;
2) lipase gene is connected with yeast saccharomyces cerevisiae surface display vector pYD1, builds recombinant expression vector;
3) recombinant expression vector that above-mentioned structure obtains is transformed in yeast saccharomyces cerevisiae (Saccharomycescerevisiae) EBY100, obtains gene recombination yeast saccharomyces cerevisiae.
Be below the specific descriptions of technical solution of the present invention:
The structure of plasmid and gene recombination yeast saccharomyces cerevisiae:
According to the lipase gene encoding sequence announced in Genbank database, after codon modify, carry out full genome synthesis; The cloning lipase gene of synthetic is built surface display expression vector to plasmid pYD1 (purchased from Invitrogen Bioisystech Co., Ltd, article No.: V835-01); By the expression vector transformed saccharomyces cerevisiae EBY100 (MAT α ura3-52trp1leu2 Δ 1his3 Δ 200pep4::HIS3prb1 Δ 1.6Rcan1GAL (pIU211:URA3)) built.PCR method checking positive transformant, primer sequence is: LIP1-GGATCCATGTCTGCTTCTTCT, LIP2-CTCGAGCAAACCCTTAGACTTCA.
The cultivation of yeast saccharomyces cerevisiae:
YPD substratum: for growth, the cultivation of yeast saccharomyces cerevisiae (S.cerevisiae).1% yeast extract (Yeastextract), 2% tryptone (Typtone), 2% glucose (Glucose), 2% agar (Agar) (preparation solid medium), 1.05kg/cm
2, sterilizing 20min under 121.3 DEG C of conditions.During preparation YPD solid medium, for preventing glucose from high temperature coking occurring, not high-temperature sterilization together with agar, and add in substratum after adopting filtration sterilization.
MD minimum medium: for cultivation, the screening of Saccharomyces cerevisiae transformant.0.67%YNB (liquid containing ammonium sulfate, not containing amino acid), 2% glucose (Glucose), 0.01% leucine (Leucine), 0.01% tryptophane (Tryptophan) (adding by test requirements document), 2% agar (Agar) (preparation solid medium), 1.05kg/cm
2, sterilizing 20min under 121.3 DEG C of conditions.Substratum is added after 2% glucose filtration sterilization.
The activation of yeast saccharomyces cerevisiae: use before being in 4 DEG C of yeast saccharomyces cerevisiaes preserved and must first activate.With inoculating needle picking yeast saccharomyces cerevisiae list bacterium colony, at the flat lining out of new YPD, in 30 DEG C of quiescent culture 2d.
Enzymatic property is analyzed:
Use YPD culture medium culturing recombinant Saccharomyces cerevisiae, detect the impact on external source lipase activity such as differential responses pH, temperature, NaCl concentration, inhibitor and denaturing agent, under comparing optimum reaction condition, codon modify is on the impact of recombinase active.
Lipase gene lip, by genetic modification, is proceeded to brewing yeast cell, achieves the displaying of this albumen at cell surface, obtain the gene recombination yeast saccharomyces cerevisiae EBY100-LIP of a high-efficiency degradation lipase by the present invention.Tributyrin (0.5%) flat board detects and shows that this recombinase has Lipase Bio activity, and when inducing 48h, activity is higher.This project bacterium produce the enzymatic property of enzyme: optimal pH is 8.0; Optimal reactive temperature is 55 DEG C; 1MNaCl can stimulate enzyme to live and increase, and below 3.5M keeps more than 70% activity, shows stronger salt-tolerant trait; Have more resistance to ethylenediamine tetraacetic acid (EDTA) (EDTA), sodium lauryl sulphate (SDS), dithiothreitol (DTT) (DTT), relatively weak to imidazoles, urea resistance; Compared with starting strain EBY100, after codon modify, recombinase active improves 27.2%.Above characteristic shows this recombinant lipase salt tolerant, high temperature resistant, to inhibitor and denaturing agent, there is widespread resistance, stronger adaptive faculty is shown to alkaline environment, there is extraordinary market application foreground, can be applicable to the degraded of environmental area lipoid material, or the scale fermentation of industrial circle lipase and production.Construction process provided by the invention is simple, is suitable for stdn.
Below elaborate.
1, aim sequence obtains and expression vector establishment
Obtain lipase gene encoding sequence from Genbank, analyze yeast saccharomyces cerevisiae codon laws of use, usage bias codon replaces rare codon.Meanwhile, introduce BamHI and XhoI two restriction enzyme sites respectively at C end and N end, obtain the lipase gene sequence of transformation:
GGATCCATGTCTGCTTCTTTCTTGAAGTTCCCAATCGTTTTGGTTCACGGTTTGTTGGGTTTCGACAAGATTGGTGGTATTTACCCATACTTCTACGGTATTAAGGAAGCTTTGGAAAAGGCTGGTGCTAAGGTTTACATTGCTACTTTGTCTGCTTTGAACTCTAACGAATTGAGAGGTGAACAATTGTTGGAATTCGTTAGAAAGGTTCAAGCTGAAACTGGTGCTGCTAAGGTTAACTTGATTGGTCACTCTCAAGGTCCATTGGCTTGTAGATACGTTGCTGCTACTCACCCAGAATTGATTGCTTCTGTTACTTCTGTTAACGGTGTTAACCACGGTTCTGAAGTTGCTGACTTGGTTAGATTGGCTTTGACTCCAGGTAGATTGCCAGAATCTATTGCTAACGCTGCTATGTCTGCTTTCGGTCAATTGTTGTCTGCTTTGGCTGGTTCTCCAAGATTGCCACAATCTGGTATTGAAGCTTTGGAAGCTTTGACTTCTGAAGGTGTTGCTGCTTCCAACAACAAGTACCCACAAGGTTTGCCAGCTGAATGGGGTGGTGAAGGTAAGGAATTGGTTAACGGTGTTTACTACTACTCTTGGTCTGGTGTTATTGACTACAACCCATTGCACCAAGGTGCTAACAACTTGGACCCATTGCACGTTGCTATGTTGGCTTTCTCTATTTTGTTCACTAACGAAAGATTCCAAAACGACGGTTTGGTTGGTAGATACTCTTCTCACTTGGGTAAGGTTATTGGTTATGACTACTCTATGGACCACGTTGACGCTATTAACCAATTGGCTGGTGTTGTTGCTAACAACACTGACCCAGTTCAATTGTTCGTTGAACACGTTGCTAGATTGAAGTCTAAGGGTTTGCTCGAG
By above-mentioned sequence, the lipase gene of transformation is synthesized by prompt base (Shanghai) trade Co., Ltd in the English Weihe River, ordinary method is used to be connected on plasmid pYD1 by this gene, obtain recombinant plasmid pYD-lip, prepare bacillus coli DH 5 alpha competent cell, adopt heat shock method by recombinant plasmid transformed in bacillus coli DH 5 alpha, obtain the positive strain containing plasmid pYD-lip ,-80 DEG C save backup.
2, the extraction of recombinant plasmid pYD-lip
Adopt alkaline denaturation, with reference to the operation instruction of the little extraction reagent kit of ordinary plasmids, concrete grammar is as follows:
(1) column equilibration step: the centrifugal 1min of the balance liquid BL adding 500 μ L to (adsorption column puts into collection tube) in adsorption column CP3,12000rpm, outwells the waste liquid in collection tube, is placed back in collection tube by adsorption column.
(2) get the bacterium liquid of 1.5mL incubated overnight, add in centrifuge tube, use conventional desktop whizzer, the centrifugal 1min of 12000rpm, absorbs supernatant as far as possible.
(3) 2 steps are repeated.
(4) in the centrifuge tube leaving bacterial sediment, add 250 μ L solution P1, use vortex oscillator to suspend precipitation.
(5) in centrifuge tube, add 250 μ L solution P2, leniently spin upside down and make the abundant cracking of thalline for 10 times.
(6) in centrifuge tube, add 350 μ L solution P3, gentlely immediately to spin upside down 6-8 time, fully mix, the centrifugal 10min of 12000rpm, now will form precipitation in bottom.
(7) supernatant that previous step is collected is transferred in adsorption column CP3, note not sucking-off precipitation.12000rpm centrifugal 30-60 second, outwell the waste liquid in collection tube, adsorption column CP3 is put into collection tube.
(8) in adsorption column CP3, add 500 μ L protein liquid removal PD, 12000rpm centrifugal 30-60 second, outwell the waste liquid in collection tube, adsorption column CP3 is placed back in collection tube.
(9) in adsorption column CP3, add 600 μ L rinsing liquids PW (adding dehydrated alcohol), 12000rpm centrifugal 30-60 second, outwell the waste liquid in collection tube, adsorption column CP3 is placed back in collection tube.
(10) repeating step 9.
(11) put back in collection tube by adsorption column CP3, the centrifugal 2min of 12000rpm, object is removed by rinsing liquid remaining in adsorption column.
(12) adsorption column CP3 is placed in a clean centrifuge tube, the middle part to adsorption film drips 50-100 μ L elution buffer EB, and room temperature is placed 2min, 12000rpm centrifugal 2min and collected in centrifuge tube by plasmid solution.
3, the preparation of SS-DNA
In the reagent bottle of 250mL, be dissolved in by 1g calf thymus DNA in 100mLTE (10mg/mL), piping and druming is to dissolving completely repeatedly; 4 DEG C are incubated overnight; Use ultrasonication 1min, obtain the DNA fragmentation that mean length is approximately 6kb, use agarose gel electrophoresis identification of dna size, to determine that it meets between 4kb ~ 8kb; Often pipe 25mL divides and is filled in four new centrifuge tubes; Add the phenol that 25mLTE is saturated, 4 DEG C, the centrifugal 5min of 12000rpm, shift supernatant (DNA) respectively to a new centrifuge tube; Add the phenol that 25mLTE is saturated: chloroform: primary isoamyl alcohol (25:24:1), 4 DEG C, the centrifugal 5min of 12000rpm, shift supernatant (DNA) respectively to a new centrifuge tube; Add 25mL chloroform, 4 DEG C, the centrifugal 5min of 12000rpm, shift the large centrifuge tube of supernatant (DNA) to a 250mL respectively; Add the ice ethanol of 95% of NaAc and the 125mL precooling of 5mL3M, pH6.0, precipitation DNA; 4 DEG C, 12000rpm centrifugal 5min precipitation DNA; With the washing with alcohol DNA of 200mL70%, 4 DEG C, 12000rpm continues centrifugal 5min, removes supernatant, dry DNA; DNA is forwarded in the aseptic bottle of a 250mL, add the aseptic TE of 100mL (10mg/mL) dissolving DNA; Boil 20min and make DNA sex change, be then placed on ice rapidly, in case its renaturation.-20 DEG C of preservations.
4, the LiAc/SS-DNA/PEG of yeast saccharomyces cerevisiae transforms
(1) yeast saccharomyces cerevisiae activated (S.cerevisiae) EBY100 bacterial strain 5 single bacterium colonies are chosen in 50mLYPD liquid nutrient medium, 30 DEG C, 170rpm incubated overnight is to OD
600reach about 1.0.
(2) the bacterium liquid of incubated overnight is diluted in new 50mLYPD liquid nutrient medium, makes OD
600be about 0.6, continue to cultivate 3h, to OD
600be about 1.0.
(3) collect thalline with 50mL centrifuge tube, the centrifugal 5min of 2500rpm, abandons supernatant, with the resuspended thalline of 40mL1 × TE.
(4) 2500rpm continues centrifugal 5min, abandons supernatant, and thalline 2mL1 × LiAc/0.5 × TE is resuspended.
(5) 30 DEG C, 80rpm incubation 1h, by the packing of 2mL bacterium liquid re-suspension liquid, often pipe 100 μ L.
(6) in each pipe, add 700 μ L1 × LiAc/40%PEG-3350/1 × TE, SS-DNA and plasmid, mix; 30 DEG C of incubation 30min, after add 88 μ LDMSO, mix.
(7) 42 DEG C of centrifugal 1min of heat shock 7min, 4000rpm, removing supernatant, collects thalline.
(8) with the resuspended thalline of 1mL1 × TE, 4000rpm continues centrifugal 1min, removes supernatant, and thalline is resuspended with 100 μ L1 × TE; Coat SC-U-G selectivity dull and stereotyped, screening transformant.
5, the bacterium colony PCR of Saccharomyces cerevisiae transformant identifies (see Fig. 2)
Picking list bacterium colony from flat board, is diluted in 20 μ LddH
2o, it is dull and stereotyped that part bacterium liquid draws another one penbritin selectivity, and rest part (about 20 μ L) 99.9 DEG C boils 10min, is placed on ice.Then in system, add Ex-Taq, 10 × Ex-TaqBuffer, dNTP and primer, carry out PCR reaction; Utilize 0.8% agarose gel electrophoresis qualification.Bacterium colony PCR reaction system is as follows:
Reaction conditions:
6, recombinase enzymatic property research
1) pH is on the impact of recombinase active
PH is detected on the impact of recombinase active by adding different 100mM damping fluids.Use damping fluid to be: sodium acetate buffer (pH5.0,5.5), phosphoric acid buffer (pH6.0,6.5,7.0), Tris-HCl damping fluid (pH7.5,8.0,8.5,9.0), Tris-glycine damping fluid (pH9.5) and glycine buffer (pH10.0).
2) temperature is on the impact of recombinase active
In the middle of Optimal pH damping fluid, differential responses temperature is set with the impact of detected temperatures on recombinase active.Be set as 25 DEG C, 30 DEG C, 35 DEG C, 40 DEG C, 45 DEG C, 50 DEG C, 55 DEG C, 60 DEG C, 65 DEG C, 70 DEG C respectively.In addition, residual enzyme activity is measured, in order to detect the temperature stability of recombinase by after recombinase at different temperatures (0 DEG C, 15 DEG C, 30 DEG C, 45 DEG C, 60 DEG C, 70 DEG C) water-bath 120min.
3) NaCl is on the impact of recombinase active
By recombinase in the NaCl solution of different concns (0,0.5,1.0,1.5,2.0,2.5,3.0mol/L), after 25 DEG C of insulation 24h, under optimum pH, optimum temperuture condition, measure enzymic activity.
4) inhibitor and denaturing agent are on the impact of recombinase active
Respectively EDTA (0.5,1,5mM), imidazoles (0.5M), Histidine (0.5M), Urea (1M), SDS (0.5%), DTT (1mM) are added bacterium liquid, after mixed room temperature places 30min, measure enzyme and live.
8, recombinant lipase activity determination method
1) tributyrin detects dull and stereotyped preparation.The tributyrin of 0.5% (v/v) is added in solid medium.
2) preparation of crude enzyme liquid
Inducing culture 96h in inducing culture, samples rearmounted 4 DEG C of preservations every 12h, 13000rpm collected by centrifugation somatic cells, after the sterile distilled water washing thalline of equivalent, be laid in after thalline is resuspended in flat board, in freeze drier freeze-drying, obtain full cellular enzymes biological catalyst.Lyophilized powder is placed in airtight bottle, for subsequent use in cryodrying case.
3) dull and stereotyped enzyme activity determination
Transformant is proceeded to tributyorinase biopsy master plate (adding the tributyrin of 0.5% (v/v) in solid medium), cultivate after 2-5 days for 30 DEG C and observe periphery of bacterial colonies hydrolysis circle.
4) p-NP standard curve making:
Take 34.8mg p-NP (pNP) be dissolved in second eyeball and be settled to 50mL, be made into the p-nitrophenyl phenol solution of 5mmol/L.Get 11 clean tube, configure the pNP solution of different concns according to table 1, utilize the OD of solution in each test tube of spectrophotometer measurement
410, calculate pNP concentration and OD
410corresponding relation.
5) sample determination: take 27mg p-nitrophenyl cellobioside (pNPC) and be dissolved in 10mL acetonitrile, be made into the pNPC solution of 10mM, configure reaction solution according to table 2, reaction solution is placed in 40 DEG C of water-bath preheating 5min, add 50uL cell suspension, after reaction 10min, measure OD
410.
By the OD recorded
410obtain pNP concentration according to the pNP concentration calculating formulae discovery that typical curve obtains, thus calculate more alive than enzyme.The enzyme amount of an enzyme unit definition alive needed for per minute release 1umolpNP.
Table 1
Table 2
Claims (3)
1. degrade fat a gene recombination yeast saccharomyces cerevisiae, containing Exogenous Lipase gene.
2. the construction process of gene recombination yeast saccharomyces cerevisiae according to claim 1, step is:
S1, according to yeast saccharomyces cerevisiae codon-bias, transformation lipase gene encoding sequence, synthesizes this gene;
S2, lipase gene is connected with yeast saccharomyces cerevisiae surface display vector pYD1 builds recombinant expression vector;
S3, the recombinant expression vector that above-mentioned structure obtains is transformed in yeast saccharomyces cerevisiae EBY100, builds gene recombination yeast saccharomyces cerevisiae.
3. the gene recombination yeast saccharomyces cerevisiae of claim 1 is applied to the degraded of fat.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510363239.XA CN105154347A (en) | 2015-06-26 | 2015-06-26 | Genetic recombination brewer's yeast for degrading fat, construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510363239.XA CN105154347A (en) | 2015-06-26 | 2015-06-26 | Genetic recombination brewer's yeast for degrading fat, construction method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105154347A true CN105154347A (en) | 2015-12-16 |
Family
ID=54795398
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510363239.XA Pending CN105154347A (en) | 2015-06-26 | 2015-06-26 | Genetic recombination brewer's yeast for degrading fat, construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105154347A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114058526A (en) * | 2021-11-18 | 2022-02-18 | 广西科学院 | Saccharomyces cerevisiae engineering bacterium for displaying alkaline lipase on cell surface as well as preparation method and use method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102242088A (en) * | 2010-05-14 | 2011-11-16 | 浙江大学 | Method for improving lipase activity persistency |
| CN102242089A (en) * | 2010-05-14 | 2011-11-16 | 浙江大学 | Method for improving activity of lipase |
-
2015
- 2015-06-26 CN CN201510363239.XA patent/CN105154347A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102242088A (en) * | 2010-05-14 | 2011-11-16 | 浙江大学 | Method for improving lipase activity persistency |
| CN102242089A (en) * | 2010-05-14 | 2011-11-16 | 浙江大学 | Method for improving activity of lipase |
Non-Patent Citations (3)
| Title |
|---|
| 严慧玲等: "南极假丝酵母脂肪酶A的表面展示及酶学性质", 《微生物学通报》 * |
| 宋燕: "a凝集素表面展示南极假丝酵母脂肪酶及发酵优化", 《中国优秀硕士学位论文全文数据库》 * |
| 郭钦等: "酿酒酵母表面展示表达系统及应用", 《中国生物工程杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114058526A (en) * | 2021-11-18 | 2022-02-18 | 广西科学院 | Saccharomyces cerevisiae engineering bacterium for displaying alkaline lipase on cell surface as well as preparation method and use method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200270595A1 (en) | Glucoamylase variants with altered properties | |
| Carrasco et al. | Screening and characterization of amylase and cellulase activities in psychrotolerant yeasts | |
| da Silva Delabona et al. | Using Amazon forest fungi and agricultural residues as a strategy to produce cellulolytic enzymes | |
| ES2795989T3 (en) | Glucoamylase variants with modified properties | |
| da Silva Delabona et al. | Effect of initial moisture content on two Amazon rainforest Aspergillus strains cultivated on agro-industrial residues: Biomass-degrading enzymes production and characterization | |
| Yeh et al. | A metagenomic approach for the identification and cloning of an endoglucanase from rice straw compost | |
| Yan et al. | A synergetic whole-cell biocatalyst for biodiesel production | |
| Raweesri et al. | α-L-Arabinofuranosidase from Streptomyces sp. PC22: purification, characterization and its synergistic action with xylanolytic enzymes in the degradation of xylan and agricultural residues | |
| Rawat et al. | Generating fermentable sugars from rice straw using functionally active cellulolytic enzymes from Aspergillus niger HO | |
| Liu et al. | A novel low-temperature resistant alkaline lipase from a soda lake fungus strain Fusarium solani N4-2 for detergent formulation | |
| Jung et al. | Cellulolytic enzymes produced by a newly isolated soil fungus Penicillium sp. TG2 with potential for use in cellulosic ethanol production | |
| Lee et al. | Re-utilization of waste glycerol for continuous production of bioethanol by immobilized Enterobacter aerogenes | |
| Mehboob et al. | Exploring thermophilic cellulolytic enzyme production potential of Aspergillus fumigatus by the solid-state fermentation of wheat straw | |
| Li et al. | Efficient expression of maltohexaose‐forming α‐amylase from Bacillus stearothermophilus in Brevibacillus choshinensis SP3 and Its use in maltose production | |
| Monjed et al. | Improved saccharification of Chlorella vulgaris biomass by fungal secreted enzymes for bioethanol production | |
| Finore et al. | Use of agro waste biomass for α-amylase production by Anoxybacillus amylolyticus: purification and properties | |
| Marques et al. | Production and partial characterization of a thermostable, alkaline and organic solvent tolerant lipase from Trichoderma atroviride 676 | |
| Ntaikou et al. | Saccharification of starchy food waste through thermochemical and enzymatic pretreatment, towards enhanced bioethanol production via newly isolated non-conventional yeast strains | |
| Ko et al. | Efficient valorization of food waste oils to renewable biodiesel by a Candida antarctica lipase B mutant that catalyzes the ester synthesis reaction in the presence of water | |
| CN105154347A (en) | Genetic recombination brewer's yeast for degrading fat, construction method and application | |
| CN102329745A (en) | High-stability organic solvent-resistant lipase producing strain and lipase as well as gene and application thereof | |
| Lu et al. | Mining and application of lipase from Clostridium acetobutylicum with higher catalytic activity for butyl butyrate production | |
| CN105154346A (en) | Genetic recombination brewer's yeast for degrading protein, construction method and application | |
| Mitsuya et al. | Continuous saccharification of laminarin by immobilized laminarinase ulam111 followed by ethanol fermentation with a marine-derived yeast | |
| Ashok et al. | An apodictic review on recent approaches in enzyme technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151216 |
|
| RJ01 | Rejection of invention patent application after publication |