CN105154338A - Tabasheer separated fungus acremonium cavaraeanum and application thereof in ergot sterone production - Google Patents
Tabasheer separated fungus acremonium cavaraeanum and application thereof in ergot sterone production Download PDFInfo
- Publication number
- CN105154338A CN105154338A CN201510601408.9A CN201510601408A CN105154338A CN 105154338 A CN105154338 A CN 105154338A CN 201510601408 A CN201510601408 A CN 201510601408A CN 105154338 A CN105154338 A CN 105154338A
- Authority
- CN
- China
- Prior art keywords
- ergot sterone
- sterone
- ergot
- strain
- solid fermentation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses tabasheer separated fungus acremonium cavaraeanum and an application thereof in ergot sterone production. The serial number of a strain of the acremonium cavaraeanum is CA01, and the preservation number of the strain of the acremonium cavaraeanum is CGMCC No.10816. The strain is obtained by being separated from tabasheer sporocarp, leavening obtained through a solid fermentation method is dried and smashed and is digested through an organic solvent, silica gel column chromatography isolation is carried out, recrystallization is carried out in methyl alcohol to obtain a target product, namely, yellow-green crystals (carbinol), the molecular weight is 392, the molecular formula is C28H40O, blue fluorescence is shown under a 365 nm ultraviolet lamp, analysis proves that ergot sterone is produced, and the green crystals are pure ergot sterone through testing. The acremonium cavaraeanum strain CA01 and the method for obtaining ergot sterone through solid fermentation can be provided for expanded industrial production.
Description
Technical field
The present invention relates to Microbial resources and utilize field, relate to the production method of ergot sterone natural active product in microorganism medicinal industry, be exactly specifically a fungal strain bottle raw top spore mould (Acremoniumcavaraeanum) and produce the solid fermentation method of ergot sterone compound.
Background technology
Ergot sterone is mainly distributed in multiple medicinal fungi and medicinal plant, and separation and purification is more from the research of hypha,hyphae, sporophore and fermented liquid.The document such as (1991) such as Chen Ruoyun obtaining ergot sterone from fungi obtains ergot sterone from red Ganoderma lucidum spore liposoluble part separation.Xiang Chen etc. (2011) obtain 23g medicinal extract with chloroform/methanol (1:1, v/v) lixiviate from silvery white from the sporophore of pleat umbrella, and final separation obtains 21.5mg ergot sterone, and yield is about 0.93 ‰.Gao Jinming etc. (2002) are separated and obtain ergot sterone from wild fungus Paxillus panuoides sporophore.Leeetal (2005) isolates ergot sterone from sclerotia, and find that it is to HT-29 (colorectal carcinoma), HeLa cell 229 (cervical cancer), Hep3B cell (liver cancer), and AGS (cancer of the stomach) has certain cytotoxic activity.Li Xiangmin etc. (2009) extract obtained fat-soluble ingredient application silica gel column chromatography, reversed-phase silica gel chromatography, sephadex chromatography and high performance liquid phase to Ganoderma spore and partly prepare isochromatic spectrum technology separation purifying acquisition ergot sterone.The document such as (2005) such as Liu Hongbing obtaining ergot sterone from plant utilizes the technology separation such as the column chromatography such as SephadexLH-20 and silica gel and recrystallization to ergot sterone from the stem skin of Tokyo Chinese ash.Cui Ying etc. (2007) obtain 7mg ergot sterone with 95% alcohol steep from 10Kg A.chinensis Planch. root.Wang Zhongzhao etc. (2011) obtain 123g medicinal extract with sherwood oil and ethyl acetate lixiviate from the stem and bark of semi-ma ngrove, obtain 6.7mg ergot sterone by a series of separation means.In addition, some are also had to obtain the report of ergot sterone by liquid fermenting, as the lixiviate from the fermented hypha of mangrove endogeny eumycete Penicilliumsp. such as Li Xiang (2007) obtains 37g medicinal extract, final separation obtains 23mg ergot sterone, and yield is about 0.62 ‰.Ox rues (2013) obtains 6.6g medicinal extract with ethyl acetate lixiviate from the fermented liquid of 18L great Pi umbrella, and final separation obtains 7.8mg ergot sterone, and yield is about 1.18 ‰.Deng Huiying etc. (2011) are separated and obtain ergot sterone from the fermented liquid of extra large lotus endogenetic fungus Pestalotiopsisclavispora.Li Zhuanzhuan etc. (2014) are separated to ergot sterone from the fermented liquid of striped plan dish stey Pestalotopsisvirgatula.Patent about ergot sterone has: CN103816163A: find that the ergot sterone be separated to from the liquid fermentation liquid and sporophore of phelliuns igniarius has anti-avian influenza activity.CN103864874A: isolate ergot sterone from Phellinus sporophore, and have studied it and preparing the application in antitumor drug.CN103044511A: the method for separating ergot sterone from phellinus liteus fermentation liquid.CN103265597A: have studied the method preparing ergot sterone from Rhizoma Polygoni Cuspidati.CN101785776A: have studied the application of ergot sterone in preparation treatment chronic renal failure medicine.CN101596201A: have studied ergot sterone and preparing the application in diuretic.CN103265596A: have studied ergot sterone for making the application of chemical sensor material and finishing material, its chemical sensor fluorescence property made is excellent.
At present, there is not yet the open file obtaining ergot sterone about solid fermentation.This patent utilizes tabasheer to be separated the mould CA01 solid fermentation of fungi bottle raw top spore and produces ergot sterone, drastically increases productive rate, yield up to 1.89 ‰, the output in bibliographical information.And can be used for expanding production.
Summary of the invention
The invention discloses a kind of tabasheer and be separated fungi bottle raw top spore mould (Acremoniumcavaraeanum) CA01, and obtained the method for ergot sterone by solid fermentation, comprise acquisition and the fermentation of bacterial strain.First tabasheer sporophore is gathered, tissue isolation is adopted to be separated fungal bacterial strain after surface sterilization, solid fermentation is carried out to the bacterial strain producing ergot sterone, then fermentation material dried, pulverize, use organic solvent lixiviate, carry out separation and purification through means such as decompression post, normal pressure silica gel column etc., then in methyl alcohol, recrystallization obtains target product, detects its purity by HPLC at 350nm place.This compound is yellow-green crystal (methyl alcohol), molecular weight: 392, molecular formula: C
28h
40o, aobvious blue-fluorescence under 365nm ultraviolet lamp.。
Technical solution of the present invention will further illustrate.
One fungal strain bottle raw top spore mould (Acremoniumcavaraeanum), this strain number is CA01, is separated from tabasheer sporophore, and bacterial strain preserving number is CGMCCNo.10816.
The invention also discloses the mould CA01 bacterial strain of bottle raw top spore and produce the application in ergot sterone.
Spore mould CA01 bacterial strain in bottle raw top produces a method for ergot sterone, is that the mould CA01 bacterial strain of bottle raw top spore produces ergot sterone by solid fermentation.
The solid culture based formulas of solid fermentation is: rice 93 ~ 98% (wt), analysis for soybean powder 3 ~ 5% (wt), fish meal 1 ~ 2% (wt), KH
2pO
40.5 ~ 1% (wt), CaCO
30.5 ~ 1% (wt), NaCl0.5 ~ 1% (wt); PH6.0 ~ 7.0 of substratum.The rice of 93 ~ 98% soaks the analysis for soybean powder that 2 ~ 5h adds 3 ~ 5%, the fish meal of 1 ~ 2% in clear water, the KH of 0.5 ~ 1%
2pO
4, the CaCO of 0.5 ~ 1%
3, the NaCl of 0.5 ~ 1%, pH is adjusted to 6.0 ~ 7.0, sterilizing 2 times at 121 DEG C, and twice sterilizing interval time is 48h, obtains solid fermentation material; The seed culture fluid of the mould CA01 of bottle raw top spore is inoculated in solid fermentation material, solid fermentation material is cultivated 10 ~ 18 days at 25 ~ 28 DEG C, gather in the crops after fermentation material fully reddens, dry in 30 ~ 55 DEG C of baking ovens and pulverize, obtaining the extraction of dry thing for ergot sterone.
The concrete steps being separated separating ergot sterone the solid fermentation thing of fungi CA01 from tabasheer are as follows:
(1) solid fermentation of CA01: cultivated 6 days on PDA flat board by CA01 bacterial strain, is transferred in PDA liquid nutrient medium afterwards, shakes cultivation 4 days at 28 DEG C.Seed culture fluid is inoculated in solid fermentation substratum.The formula of solid fermentation substratum is rice 93 ~ 98%, analysis for soybean powder 3 ~ 5%, fish meal 1 ~ 2%, KH
2pO
40.5 ~ 1%, CaCO
30.5 ~ 1%, NaCl0.5 ~ 1%, pH6.0 ~ 7.0, sterilizing 2 times at 121 DEG C (twice sterilizing interval time be 48h).Solid culture is cultivated about 10 ~ 18 days (every day observes and mixes) at 28 DEG C; Gather in the crops after substratum fully reddens, dry in 30 ~ 55 DEG C of baking ovens and pulverize for subsequent use.
(2) extraction of solid fermentation thing: the dry tunning pulverized is added CH by 1:2 ~ 1:5w/v
2cl
2carry out lixiviate 3 times.At reduced pressure conditions organic solvent is volatilized, obtain medicinal extract.
(3) reduce pressure the post rough segmentation section of drawing: medicinal extract and silica gel 1:1w/w are mixed dry method loading, are elutriant with petroleum ether-ethyl acetate, from sherwood oil: ethyl acetate=60:1, be followed successively by 55:1,50:1 ... 1:1.By TLC point plate, contain the component of blue-fluorescence under merging ultraviolet lamp, concentrating under reduced pressure obtains the runic thing containing ergot sterone.
(4) silicagel column separation and purification: by a small amount of petroleum ether dissolution of above-mentioned runic thing, wet method loading, used silica gel 200-300 order, adopt sherwood oil: ethyl acetate gradient, be followed successively by 100:1,90:1 ... 1:1, by TLC point plate, contain the component of blue-fluorescence under merging ultraviolet lamp, concentrating under reduced pressure obtains ergot sterone crude product.
(5) crystallization purifying: be dissolved in methyl alcohol by above-mentioned ergot sterone crude product, after organic membrane filtration, leaves standstill crystallization under room temperature condition.
(6) purity detecting: detect its purity at 365nm wavelength place by HPLC.
Compared with prior art, the invention provides a strain newly has bacterial strain to obtain ergot sterone for solid fermentation; A new way is provided for obtaining ergot sterone in a large number.
Bacterial strain CA01 of the present invention is preserved in (address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, China Committee for Culture Collection of Microorganisms's common micro-organisms center on May 18th, 2015, Institute of Microorganism, Academia Sinica), Classification And Nomenclature is bottle raw top spore mould (Acremoniumcavaraeanum), and deposit number is CGMCCNo.10816.
Embodiment
Embodiment 1 tabasheer is separated the acquisition of fungi bottle raw top spore mould (Acremoniumcavaraeanum) CA01
Select fresh tabasheer sporophore, adopt tissue isolation, surface is rinsed by fresh tabasheer sporophore clear water, dry rear use 75% alcohol and carry out surface sterilization, then by sterile razor blade, sporophore is cut into the fritter of about 3mm × 3mm × 3mm, then sterilize 30 seconds in the alcohol of 75%, then after using aseptic water washing 3 ~ 4 times, tissue block is placed on had PDA substratum flat board on, 3 ~ 4 tissue block put into by each flat board, are placed in 28 DEG C of incubators and cultivate.
Treat tissue block has mycelia grow, be transferred on new PDA flat board, for subsequent use by being saved in test tube slant after fungi repeatedly purifying, label is CA01, CA02 respectively ... CA67.
Embodiment 2 screens the bacterial strain producing ergot sterone
67 fungal strains obtained are inoculated in PDA liquid nutrient medium respectively, at 28 DEG C, shake (130rpm/min) cultivate 4 days, filter out mycelia afterwards, fermented liquid dichloromethane extraction.By TLC point plate, observe with or without blue fluorescent substance under ultraviolet lamp.According to the selection result, will the bacterial strain CA01 of blue fluorescent substance be produced as experimental strain.
The micro-morphology of embodiment 3 bottles raw top spore mould (Acremoniumcavaraeanum) CA01 bacterial strain and Molecular Identification
The micro-morphology of CA01 bacterial strain: on PDA substratum, the mycelia initial stage is in white, dense, and after 6 ~ 7 days, the mycelia of bacterium colony central authorities turns yellow, and the radial slight crack of central authorities to surrounding appears in bacterium colony.This strain growth is slow, and diffusion area is less.Growth after 3 ~ 4 days bacterial strain start to secrete red-purple pigment, and the velocity of diffusion of pigment much larger than
The velocity of diffusion of mycelia.Also drop-wise red-purple pigment can be secreted on bacterium colony after 5 ~ 7 days.100 times of oily Microscopic observation conidiums are smooth, and oval, be chain on sporophore top, size is 3.2 ~ 4 μm × 1.2 ~ 2 μm.
Molecular biology identification: utilize universal primer ITS-4:TCCTCCGCTTATTGATATGC (SEQIDNO.2) and ITS-5:GGAAGTAAAAGTCGTAACAAGG (SEQIDNO.3) amplification to obtain the PCR primer of length between 500 ~ 750bp.PCR primer is sent to order-checking, shown in the following SEQIDNO.1 of result.Following sequence is carried out BLAST comparison in the total storehouse of NCBI nucleotide sequence, this sequence of result and bottle life push up the similarity of spore mould (Acremoniumcavaraeanum) bacterial strain up to 99%, therefore can determine that this bacterial strain is the Acremoniumcavaraeanum on imperfect fungi, Moniliales (Moniliales), Moniliaceae (Moniliaceae), grape spore race (Botrytideae), the top mould genus of spore (AcremoniumLk.exFr.), Chinese called after bottle raw top spore is mould.
The determination of the best solid fermentation formula of embodiment 4 bottles raw top spore mould (Acremoniumcavaraeanum) CA01
Bottle raw top spore mould (Acremoniumcavaraeanum) bacterial strain is cultivated 6 days on PDA flat board at 28 DEG C, then by 6 1cm
2bacterium block together with culture medium inoculated in the 250mL triangular flask containing 100mLPDA liquid nutrient medium, at 28 DEG C shake (130rpm/min) cultivate 4 days as seed culture fluid.The seed culture fluid being in logarithmic phase is inoculated in solid fermentation substratum.
The formula of solid fermentation substratum is:
200g rice adds 6g (3%) analysis for soybean powder, 2g (1%) fish meal, 1g (0.5%) KH
2pO
4, 1g (0.5%) CaCO-
3, 1g (0.5%) NaCl, pH are adjusted to 6.8, sterilizing 2 times at 121 DEG C (twice sterilizing interval time be 48h).The consumption of this formula is the amount in every bag of mushroom fermentation bag (9cm × 35cm).
200g millet adds 6g (3%) analysis for soybean powder, 2g (1%) fish meal, 1g (0.5%) KH
2pO
4, 1g (0.5%) CaCO-
3, 1g (0.5%) NaCl, pH are adjusted to 6.8, sterilizing 2 times at 121 DEG C (twice sterilizing interval time be 48h).The consumption of this formula is the amount in every bag of mushroom fermentation bag (9cm × 35cm).
200g large Meccah 6g (3%) analysis for soybean powder, 2g (1%) fish meal, 1g (0.5%) KH
2pO
4, 1g (0.5%) CaCO-
3, 1g (0.5%) NaCl, pH are adjusted to 6.8, sterilizing 2 times at 121 DEG C (twice sterilizing interval time be 48h).The consumption of this formula is the amount in every bag of mushroom fermentation bag (9cm × 35cm).
200g little Meccah 6g (3%) analysis for soybean powder, 2g (1%) fish meal, 1g (0.5%) KH
2pO
4, 1g (0.5%) CaCO-
3, 1g (0.5%) NaCl, pH are adjusted to 6.8, sterilizing 2 times at 121 DEG C (twice sterilizing interval time be 48h).The consumption of this formula is the amount in every bag of mushroom fermentation bag (9cm × 35cm).
200g Semen Maydis grit adds 6g (3%) analysis for soybean powder, 2g (1%) fish meal, 1g (0.5%) KH
2pO
4, 1g (0.5%) CaCO-
3, 1g (0.5%) NaCl, pH are adjusted to 6.8, sterilizing 2 times at 121 DEG C (twice sterilizing interval time be 48h).The consumption of this formula is the amount in every bag of mushroom fermentation bag (9cm × 35cm).
Solid culture is cultivated (every day observes and mixes) at 28 DEG C; Gather in the crops after substratum fully reddens, dry in 50 DEG C of baking ovens and pulverize, saving backup.
Take the fermentation material 5g after rice, millet, barley, wheat, Semen Maydis grit five kinds pulverizing respectively, use 10mLCH
2cl
2lixiviate 12h, by TLC point plate, observes and to produce with or without blue fluorescent substance and to record its brightness under ultraviolet lamp.It is maximum that result shows the blue fluorescent substance amount selecting rice to obtain as solid fermentation.
The extraction of embodiment 5 bottles raw top spore mould (Acremoniumcavaraeanum) CA01 ergot sterone and purifying
By the rice fermentation material 1800g CH of pulverizing
2cl
2lixiviate, fermented product and CH
2cl
21:2w/v ratio adds, each lixiviate 24 hours, lixiviate 3 times, merges vat liquor, is volatilized by organic solvent at reduced pressure conditions, obtains medicinal extract 18g.18g medicinal extract and 18g silica gel 1:1w/w are mixed, dry method loading, used silica gel 200 ~ 300 order, take petroleum ether-ethyl acetate as elutriant, from sherwood oil: ethyl acetate=100:1, be followed successively by 95:1,90:1 ... 1:1, each gradient is about about 600mL.By TLC point plate, find that the solution under 50:1,45:1,40:1,35:1,30:1,25:1,20:1 wash-out has the material sending out blue-fluorescence under ultraviolet lamp, merge the elutriant of 50:1 ~ 20:1, concentrating under reduced pressure obtains the runic thing 0.234g containing ergot sterone.Afterwards, by a small amount of petroleum ether dissolution of above-mentioned runic thing, wet method loading, used silica gel 200-300 order, adopts sherwood oil: ethyl acetate gradient, is followed successively by 100:1,90:1 ... 1:1, each gradient is about 200mL, by TLC point plate, contain the component of blue-fluorescence under merging ultraviolet lamp, concentrating under reduced pressure obtains ergot sterone crude product 54mg.Ergot sterone crude product is dissolved in methyl alcohol again, after organic membrane filtration, under room temperature condition, leaves standstill crystallization.Grow to after a certain size until crystal, remove mother liquor, repeatedly rinse plane of crystal with methyl alcohol, after washing away impurity, kept dry ergot sterone crystal 34mg altogether, yield is about 1.89 ‰.
Embodiment 6 ergot sterone crystal purity detects
By ergot sterone crystal, be dissolved in methyl alcohol, after crossing organic filter membrane, detect its purity by HPLC at 365nm wavelength place, moving phase is 100% methyl alcohol, and the purity that general recrystallization obtains is more than 95%.Ergot sterone as needed purity higher obtains by preparation liquid phase, and determined wavelength 365nm, 280nm, 254nm, moving phase is 100%
Methyl alcohol, flow velocity 3mL/min, elution time is 20min, and target product appearance time is about 16min, and this step can obtain the ergot sterone that purity is 100%, is about 31mg, and yield is 1.72 ‰.
Embodiment 7 ergot sterone wave spectrum analysis
EI-MSm/z:807.6143([2M+Na]
+).IR(KBr)ν
max2073,2869,1635,1591,1459,968cm
-1,
1H-NMR(400MHz,CDCl
3):δ0.84(3H,d,J＝4Hz,H3-26),0.86(3H,d,J＝4Hz,H3-27),0.94(3H,d,J＝4Hz,H3-28),0.97(3H,s,H3-18),1.01(3H,s,H3-19),1.07(3H,d,J＝8Hz,H3-21),1.28(1H,m,H-17),1.32(1H,m,H-12),1.47(1H,m,H-24),1.52(1H,m,H-16),1.61(1H,m,H-11),1.72(1H,m,H-11),1.81(1H,m,H-16),1.85(1H,m,H-2),1.89(1H,m,H-25),2.05(1H,m,H-1),2.13(2H,m,H-9,12),2.18(1H,m,H-20),2.37(2H,m,H-2,15),2.49(1H,m,H-15),2.55(1H,m,H-1),5.22(1H,dd,J＝20,28Hz,H-22),5.24(1H,dd,J＝24,32Hz,H-23),5.8(1H,s,H-4),6.03(1H,d,J＝8Hz,H-6),6.61(1H,d,J＝8Hz,H-7)。
13c-NMR (100MHz, CDCl
3): δ 16.640 (q, C-19), 17.630 (q, C-28), 18.946 (q, C-18), 18.980 (t, C-11), 19.656 (q, C-26), 19.975 (q, C-27), 21.217 (q, C-21), 25.360 (t, C-15), 27.705 (t, C-16), 33.081 (d, C-24), 34.110 (t, C-1), 34.135 (t, C-2), 35.591 (t, C-12), 36.757 (s, C-10), 39.271 (d, C-20), 42.868 (d, C-25), 43.985 (s, C-13), 44.327 (d, C-9), 55.699 (d, C-17), 122.983 (d, C-4), 124.413 (d, C-6), 124.456 (s, C-8), 132.532 (d, C-23), 134.006 (d, C-7), 134.994 (d, C-22), 156.078 (s, C-14), 164.373 (s, C-5), 199.480 (s, C-3). this compound is yellow-green crystal (methyl alcohol), molecular weight: 392, molecular formula: C
28h
40o, aobvious blue-fluorescence under 365nm ultraviolet lamp.
Claims (5)
1. a strain bottle raw top spore mould (Acremoniumcavaraeanum), this strain number is CA01, is separated from tabasheer sporophore, and bacterial strain preserving number is CGMCCNo:10816.
2. the mould CA01 bacterial strain of bottle according to claim 1 raw top spore is producing the application in ergot sterone.
3. produce a method for ergot sterone with the mould CA01 bacterial strain of bottle according to claim 1 raw top spore, it is characterized in that, the mould CA01 bacterial strain of bottle raw top spore produces ergot sterone by solid fermentation.
4. method according to claim 3, is characterized in that, the solid culture based formulas of solid fermentation by weight: rice 93 ~ 98%, analysis for soybean powder 3 ~ 5%, fish meal 1 ~ 2%, KH
2pO
40.5 ~ 1%, CaCO
30.5 ~ 1%, NaCl0.5 ~ 1%; PH6.0 ~ 7.0 of substratum.
5. method according to claim 3, is characterized in that, the rice of 93 ~ 98% soaks the analysis for soybean powder that 2 ~ 5h adds 3 ~ 5%, the fish meal of 1 ~ 2% in clear water, the KH of 0.5 ~ 1%
2pO
4, the CaCO of 0.5 ~ 1%
3, the NaCl of 0.5 ~ 1%, pH is adjusted to 6.0 ~ 7.0, sterilizing 2 times at 121 DEG C, and twice sterilizing interval time is 48h, obtains solid fermentation material; The seed culture fluid of the mould CA01 of bottle raw top spore is inoculated in solid fermentation material, solid fermentation material is cultivated 10 ~ 18 days at 25 ~ 28 DEG C, gather in the crops after fermentation material fully reddens, dry in 30 ~ 55 DEG C of baking ovens and pulverize, obtaining the extraction of dry thing for ergot sterone.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510601408.9A CN105154338B (en) | 2015-09-18 | 2015-09-18 | The raw acremonium of tabasheer separation fungi bottle and its application in ergot sterone is produced |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510601408.9A CN105154338B (en) | 2015-09-18 | 2015-09-18 | The raw acremonium of tabasheer separation fungi bottle and its application in ergot sterone is produced |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105154338A true CN105154338A (en) | 2015-12-16 |
| CN105154338B CN105154338B (en) | 2018-04-24 |
Family
ID=54795390
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510601408.9A Expired - Fee Related CN105154338B (en) | 2015-09-18 | 2015-09-18 | The raw acremonium of tabasheer separation fungi bottle and its application in ergot sterone is produced |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105154338B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112626149A (en) * | 2021-02-07 | 2021-04-09 | 青岛农业大学 | Application of phellinus igniarius fermentation broth polysaccharide in anti-avian influenza virus medicine |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS4821482B1 (en) * | 1963-02-08 | 1973-06-29 | ||
| CN103044511A (en) * | 2012-12-15 | 2013-04-17 | 青岛农业大学 | Technology for separating ergosterone from Phellinus |
| CN103816163A (en) * | 2013-09-06 | 2014-05-28 | 青岛农业大学 | Application of ergot sterone in phellinus igniarius to resisting H5N1 avian influenza virus |
| CN103864874A (en) * | 2014-01-17 | 2014-06-18 | 六安市丹皇生物科技有限责任公司 | Phellinus igniarius monomer component ergot ketosteroid and preparation method and application thereof in preparation of anti-tumor drugs |
-
2015
- 2015-09-18 CN CN201510601408.9A patent/CN105154338B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS4821482B1 (en) * | 1963-02-08 | 1973-06-29 | ||
| CN103044511A (en) * | 2012-12-15 | 2013-04-17 | 青岛农业大学 | Technology for separating ergosterone from Phellinus |
| CN103816163A (en) * | 2013-09-06 | 2014-05-28 | 青岛农业大学 | Application of ergot sterone in phellinus igniarius to resisting H5N1 avian influenza virus |
| CN103864874A (en) * | 2014-01-17 | 2014-06-18 | 六安市丹皇生物科技有限责任公司 | Phellinus igniarius monomer component ergot ketosteroid and preparation method and application thereof in preparation of anti-tumor drugs |
Non-Patent Citations (2)
| Title |
|---|
| NORMAN D. DAVIS等: "Steroid Metabolites of Acremonium coenophialum an Endophyte of Tall Fescue", 《JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY》 * |
| 范英: "竹黄及其分离真菌的遗传多样性分析", 《万方数据库》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112626149A (en) * | 2021-02-07 | 2021-04-09 | 青岛农业大学 | Application of phellinus igniarius fermentation broth polysaccharide in anti-avian influenza virus medicine |
| CN112626149B (en) * | 2021-02-07 | 2022-04-12 | 青岛农业大学 | Application of phellinus igniarius fermentation broth polysaccharide in anti-avian influenza virus medicine |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105154338B (en) | 2018-04-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102168022B (en) | Endophytic fungus Penicillium ateckii from plant Chinese Umbrellaleaf rhizome and application thereof | |
| CN100384982C (en) | Antrodia camphorata mycelium fermented extract and application thereof | |
| CN103468585B (en) | Monascus strain and application thereof in preparing functional monascus | |
| CN101760496A (en) | Biological dehydrogenation preparation method of steroid drug intermediate | |
| CN101445784B (en) | Eupenicillium brefeldianum variety ZJB082702 and application thereof in preparation of Brefeldin A by fermentation | |
| CN108467337A (en) | A kind of sesquiterpene alcohols compound and its preparation and application | |
| CN106010980B (en) | A kind of endogenetic fungus Brazil class shell roundlet spore bacterial strain and its application | |
| CN104694401A (en) | Penicillium verrucosum LPPV001 and method for producing ergosterol peroxide by same | |
| CN104726347A (en) | Penicillium vulpinum fungi strain and method for preparing levo 7-hydroxyl butylphthalide employing fungi strain | |
| CN107189949A (en) | Rhizopus oryzae LJH3 and the application in bioconversion Sophoricoside prepares genistein | |
| CN103724290B (en) | Cyclopeptide compound clavatustide A as well as producing strain, preparation method and application thereof | |
| CN101603011B (en) | Method for preparing epipodophyllotoxin diglucoside and special strain used thereby | |
| CN108640956A (en) | A method of preparing flavonoid glycoside from tea seed | |
| CN104876945A (en) | Alkaloid dimer, preparation method thereof and application of alkaloid dimer as antiviral agent | |
| CN102277304B (en) | Aspergillus aculeatus bacterial strain and method for preparing 5,7,8,4'-tetrahydroxyisoflavone by using same | |
| CN107099464A (en) | A kind of sclerotium aspergillus and its method for preparing penicillic acid | |
| CN102417883A (en) | Screening of new strain capable of producing camptothecin and method for preparing camptothecin | |
| CN105154338A (en) | Tabasheer separated fungus acremonium cavaraeanum and application thereof in ergot sterone production | |
| CN101575576A (en) | Aspergillus fumigatus and application thereof | |
| CN106282032B (en) | Penicillium citrinum LB and the application in phillygenol is prepared in bioconversion forsythin | |
| CN103641791B (en) | Cyclopeptide compound clavatustide B, and preparation method and application thereof | |
| CN102584615A (en) | Alkaloid compound as well as preparation method and application thereof | |
| CN103820330B (en) | One strain variable color aspergillus and preparing the application in podophyllotoxin list glucoside and podophyllotoxin | |
| CN101701193B (en) | Method for preparing podophyllotoxin and/or astragaloside and special bacterial strain thereof | |
| CN104694607A (en) | Method for preparing beta-carotin by solid fermentation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180424 Termination date: 20200918 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |