CN105153290B - Schistosoma japonicum SjCTRL recombinant antigen protein and its preparation method and application - Google Patents
Schistosoma japonicum SjCTRL recombinant antigen protein and its preparation method and application Download PDFInfo
- Publication number
- CN105153290B CN105153290B CN201510519076.XA CN201510519076A CN105153290B CN 105153290 B CN105153290 B CN 105153290B CN 201510519076 A CN201510519076 A CN 201510519076A CN 105153290 B CN105153290 B CN 105153290B
- Authority
- CN
- China
- Prior art keywords
- sjctrl
- schistosoma japonicum
- recombinant
- protein
- antigen protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43536—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms
- C07K14/43559—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms from trematodes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0003—Invertebrate antigens
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Veterinary Medicine (AREA)
- Gastroenterology & Hepatology (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of Schistosoma japonicum SjCTRL recombinant antigen protein (chymotrypsin-like protease, SjCTRL), the albumen with the same function that there is the albumen of amino acid sequence shown in SEQ ID NO.2 or formed by the substitution, deletion or insertion of the one or more amino acid of albumen generation.Furthermore, the invention also discloses the preparation methods of the recombinant antigen protein, the expression and purity of the amplification of gene order, the building of recombinant plasmid and the identification for removing transmembrane structure, recombinant protein including Schistosoma japonicum chymotrypsin-like recombinant protein and etc.；Have evaluated immune protective efficiency of the recombinant antigen protein in the infection of mouse anti-schistosome.Tentatively verify the recombinant antigen protein can reduce to a certain extent infection Schistosoma japonicum C57BL/6 mouse at borer population and liver worm's ovum number, can be used as potential anti-schistosome vaccine target spot.
Description
Technical field
The present invention relates to molecules, RESEARCH ON CELL-BIOLOGY field, and in particular to Schistosoma japonicum chymotrypsin-like weight
Group antigen protein (chymotrypsin-like protease, SjCTRL) and preparation method thereof.Moreover, it relates to should
The purposes of Schistosoma japonicum SjCTRL recombinant antigen protein.
Background technique
Snail fever (schistosomiasis) is a kind of parasitic zoonoses (parasitic zoonoses),
It is the second largest parasitic disease for being only second to malaria in the world, in global 76 countries and regions prevalences, is distributed mainly on Asia, it is non-
Continent and Latin America, compromised number 600,000,000, number of the infected are more than 200,000,000.China was once that more serious state is endangered by Schistosoma japonicum
One of family, was once popular in 12 provinces on the south the Changjiang river, patient is more than 12,000,000.Only have Schistosoma japonicum prevalence in China, it is main at present
It is distributed in Jiangsu based on Marshland endemic regions, Anhui, Jiangxi, Hubei, 5 province of Hunan and based on hilly endemic area Endemic Area
Sichuan, 2 province of Yunnan.It shows that schistosomiasis in China epidemic situation further declines according to epidemic situation data in 2013, but realizes " whole nation prevention
Control schistosomiasis medium-term and long-term plans outline (2004-2015) " target still has certain pressure；The epidemic situation of attainment areas has been still
And it is unstable, it also needs to continue to reinforce preventing and controlling, and carry out more effective monitoring.Controlling for Schistosoma japonicum at present
Treat and also stay in the applications of chemicals, with antischistosomal drug study on mechanism deepen continuously and molecular biology and
The introducing of gene technology will be further explained to blood fluke physiological metabolism, gene and with the physiopathologic relationship of host, some
Bilharzial lethal gene and weak metabolism link and target molecule will be found, thus preferably to play the drug effect of drug and subtracting
The generation of few toxicity provides theoretical guarantee.
Mono- unknown function albumen of Schistosoma japonicum SjCTRL is the new protein sequence of Schistosoma japonicum.The present invention passes through PCR
Schistosoma japonicum SjCTRL gene is amplified, and recombinantly expresses this gene in Escherichia coli, obtains the weight that size is about 24kDa
Histone confirms that gained recombinant protein can reduce the C57BL/6 of infection Schistosoma japonicum to a certain extent through animal protection test
Mouse at borer population and liver worm's ovum number, be potential vaccine candidate target, so as to complete the present invention.
Before making the present invention, there are no go out to now refer to Schistosoma japonicum SjCTRL recombinant antigen protein of the present invention and its be used for
Prepare the open report of anti schistosoma vaccine.
Summary of the invention
One of the technical problem to be solved in the present invention is to provide a kind of Schistosoma japonicum SjCTRL recombinant antigen protein.
The second technical problem to be solved by the present invention is to provide a pair for the amplification of Schistosoma japonicum SjCTRL gene PCR
Specific primer.
The third technical problem to be solved by the present invention is to provide the preparation of the Schistosoma japonicum SjCTRL recombinant antigen protein
Method.
The four of the technical problem to be solved in the present invention are to provide the Schistosoma japonicum SjCTRL recombinant antigen protein and are preparing
Application in anti schistosoma vaccine.
The present invention screened from Schistosoma japonicum full-length genome database one it is new with reported Schistosoma mansoni
Serine protease SmSP5 (GeneBank accession number AHI46409.1) nucleotide sequence similarity is 79%, protein sequence phase
There is 72% Schistosoma japonicum serine protease gene like property, it is annotated to be named as Schistosoma japonicum chymotrypsin-like egg
White gene (S.japonicum chymotrypsin-like protease, abbreviation SjCTRL gene).SmSP5 albumen is in fluke
A new branch is in guiding principle serine stretch protein S1 family system chadogram, the branch is between bilharzial cercaria elastin laminin
Between enzyme and the trypsase of other families of S1, chymotrypsin, and there is no relevant document report its can be used as resist it is graceful
The bilharzial potential vaccine target spot of family name.
The present invention carries out PCR amplification to Schistosoma japonicum SjCTRL gene using Protocols in Molecular Biology, and purifying amplification produces
Products therefrom, plasmid vector pET-28a (+), are carried out digestion, recycling by object respectively, and connection is built into SjCTRL gene protokaryon table
Recombinant plasmid pET-28a (+)-SjCTRL reached extracts recombinant plasmid by transformation and selection, identifies through PCR, sequencing and digestion
After confirmation, conversion is expressed into host cell colibacillus；The higher clone of expression quantity is taken, fermentation prepares thallus, identification recombination
The dissolubility of albumen；The recombinant protein of expression is dissolved in denaturant, is purified with Ni-NTA agarose affinity column, final
To the recombinant protein SjCTRL of purifying, the body outer clone expression and purifying of SjCTRL gene are completed.
In order to solve the above-mentioned technical problem, the present invention is achieved through the following technical solutions:
First aspect of the present invention is to provide a kind of Schistosoma japonicum SjCTRL recombinant antigen protein, with SEQ ID
The albumen of amino acid sequence shown in NO.2 or the shape by the substitution, deletion or insertion of the one or more amino acid of albumen generation
At albumen with the same function；The Schistosoma japonicum SjCTRL recombinant antigen protein is prepared with the following method:
1) amplification (the transmembrane structure part of removal prediction) of Schistosoma japonicum SjCTRL gene order: design SEQ ID
Nucleotide sequence shown in nucleotide sequence shown in NO:3 or its complementary strand and SEQ ID NO:4 or its complementary strand are primer,
PCR amplification is carried out by template of cDNA containing Schistosoma japonicum；Gained PCR product is through agarose gel electrophoresis, and recovery purifying；
2) building and identification of Schistosoma japonicum SjCTRL recombinant plasmid；
3) it by the recombinant plasmid transformed in host cell, and is expressed in host cell, the recombinant protein expressed；
4) recombinant protein of purifying expression is carried out with Ni-NTA agarose affinity column.
There is provided a pair of specificity for the amplification of Schistosoma japonicum SjCTRL gene PCR to draw for the second aspect of the present invention
Object (the transmembrane structure part of removal prediction), sequence are that (single underscore indicates protection base, and double underline is respectively BamH I
I restriction enzyme site of restriction enzyme site and Xho):
Upstream: 5 '-CG AATTTAGAATATCGTATACAAAATGGTT-3 ' (as shown in SEQ ID NO:3)
Or its complementary strand；
Downstream: 5 '-CC TCAACCACTGCCTGCTATTG-3 ' (as shown in SEQ ID NO:4) or its complementation
Chain.
Third aspect of the present invention provides a kind of preparation method of Schistosoma japonicum SjCTRL recombinant antigen protein, including
Following steps:
1) amplification (the transmembrane structure part of removal prediction, with round pcr from day of Schistosoma japonicum SjCTRL gene order
The DNA fragmentation of SjCTRL is obtained in japonicum cDNA): nucleotide sequence or its complementary strand shown in design SEQ ID NO:3
It is primer with nucleotide sequence shown in SEQ ID NO:4 or its complementary strand, carries out PCR by template of cDNA containing Schistosoma japonicum
Amplification；Gained PCR product is through agarose gel electrophoresis, and recovery purifying；
2) building and identification of Schistosoma japonicum SjCTRL recombinant plasmid: pET-28a (+) vector construction Schistosoma japonicum is used
SjCTRL recombinant expression plasmid pET-28a (+)-SjCTRL；
3) it by pET-28a (+)-SjCTRL recombinant plasmid transformed in host cell, and expresses, obtains in host cell
The recombinant protein SjCTRL of expression；
4) with the Schistosoma japonicum SjCTRL recombinant protein of the affine column purification expression of Ni-NTA agarose.
As currently preferred technical solution, the amplification of step 1) Schistosoma japonicum SjCTRL gene order, specifically:
Using the cDNA clone containing Schistosoma japonicum SjCTRL gene order as template, SEQ ID NO.3(CG
AATTTAGAATATCGTATACAAAATGGTT) or its complementary strand be 5 ' primers, SEQ ID NO.4 (CC
TCAACCACTGCCTGCTATTG) or its complementary strand is 3 ' primers, carries out PCR amplification, gained PCR product is through Ago-Gel electricity
Swimming is usedPlastic recovery kit (Gel Extraction Kit) recovery purifying.The PCR amplification
Reaction condition is 95 DEG C of initial denaturation 5min；94 DEG C of denaturation 1min, 55 DEG C of annealing 1min, 72 DEG C of extension 1min, 35 recycle, and 72 DEG C
Extend 10min；Finally it is stored in 4 DEG C.
As currently preferred technical solution, step 2) building can express Schistosoma japonicum SjCTRL in host cell
Recombinant plasmid pET-28a (+)-SjCTRL of encoding gene, specifically:
The resulting PCR product segment of step 1) and plasmid vector pET-28a (+) are used into restriction enzyme BamH I respectively
Double digestion, and recovery purifying are carried out with Xho I；It is carried out according to the concentration of target gene fragment and carrier endonuclease bamhi after purification
Connection, is built into recombinant plasmid pET-28a (+)-SjCTRL of SjCTRL encoding gene prokaryotic expression；This recombinant plasmid is passed through
CaCl2Method is transformed into bacillus coli DH 5 alpha competent cell, is coated on after culture on the agar plate of LB containing kanamycins, chooses at random
The bacterium colony on above-mentioned plate is taken, thallus is collected after culture, extracts contained recombinant plasmid in thallus, carries out PCR identification, sequencing mirror
It is fixed.
As currently preferred technical solution, step 3) recombinant plasmid pET-28a (+)-SjCTRL is in colibacillus (place
Chief cell) in expression, specifically: step 2) is extracted by gained pET-28a (+)-SjCTRL recombinant plasmid turn as calcium conversion
It dissolves into e. coli bl21 (DE3), is coated on after culture on the LB agar plate containing kanamycins.The above-mentioned plate of random picking
On bacterium colony, culture bacterium solution is added inducer (IPTG) and continues to cultivate to logarithmic growth phase.Dodecyl sodium sulfate-polypropylene
Acrylamide gel electrophoresis (SDS-PAGE) identifies inducing expression as a result, directly with whole cell electrophoresis showed.
As currently preferred technical solution, step 4) purifies Schistosoma japonicum SjCTRL recombinant protein, specifically: it takes
The expression higher strain that freezes of Schistosoma japonicum SjCTRL recombinant protein amount lines on the LB agar plate containing kanamycins, trains
After supporting overnight, the colony inoculation on the random above-mentioned plate of picking is to equally containing the fluid nutrient medium of kanamycins, culture bacterium solution
To logarithmic growth phase, inducer (IPTG) is added and continues to cultivate, finally collects thallus；Protein Extraction agent is added in above-mentioned thallus
Bacterium is cracked, supernatant and precipitating are retained after centrifugation, by SDS-PAGE electroresis appraisal result.According to the above results, denaturant is used
Cracking gained precipitating, precipitating are dissolved in denaturant, carry out recovery purifying with Ni-NTA agarose affinity column, SDS-PAGE examines purifying
As a result.
The 4th aspect of the present invention provides a kind of Schistosoma japonicum SjCTRL recombinant antigen protein and is preparing anti-Japanese blood
Application in fluke vaccine, the Schistosoma japonicum SjCTRL recombinant antigen protein have amino acid sequence shown in SEQ ID NO.2
By the albumen substitution, deletion or insertion of one or more amino acid occur for the albumen of column and what is formed has identical function
Albumen.
The C57BL/6 mouse of 12 4~6 week old is divided into 2 groups by the present invention at random, the SjCTRL weight of experimental group purifying
Emulsion dorsal sc multi-point injection is made after histone (25 μ g) and Freund's complete adjuvant mixed in equal amounts, with purifying after 2 weeks
SjCTRL recombinant protein (25 μ g) and the subcutaneous 3 points of injections of incomplete Freund's adjuvant (50 μ l/ are only) mixing and emulsifying back part, after 4 weeks
Only use purifying protein booster immunization 1 time.Adjuvant control group is with adjuvant immunity (50 μ l/ only).Two groups of mouse respectively attack by abdomen after 6 weeks
Hit infection (40 ± 2) schistosoma japonicum cercariae.It cuts open within the 35th day after challenge infection and kills mouse, adult is collected in aorta pectoralis perfusion,
Calculate liver worm reduction rate.It takes every rat liver to weigh, the homogenate of 5ml physiological saline tissue is added, is disappeared with 5ml 10%KOH in 37 DEG C
Change 6h, takes microscopy whole worm's ovum number after 20 μ l smears.It is counted using double-blind study, everyone opens smear by microscopy 3, calculates every gram of every mouse
The average value and egg reduction rate of excrement worm's ovum number.Worm reduction rate (percentage)=[1-(the average every mouse of protein immunization group obtains into borer population
The average every mouse of mesh/adjuvant control group obtains into borer population)] × 100%, liver egg reduction rate (percentage)=[1-(protein immunization
Worm's ovum number/adjuvant control group contained by the average every gram of liver of group is averaged worm's ovum number contained by every gram of liver)] × 100%.Through above-mentioned day
The verifying of the animal protection test of japonicum SjCTRL recombinant protein, Schistosoma japonicum SjCTRL recombinant antigen egg of the invention
Cercaria challenge infection is used after white immune C57BL/6 mouse, can get 25.4% worm reduction rate and 80% liver egg reduction rate.Animal protection
Property test result show that the albumen can be used as potential anti-schistosome vaccine target spot, the significant effect especially in terms of egg reduction rate, tool
The significance for thering is control schistosomiasis to propagate.
Detailed description of the invention
Fig. 1 is the amplification schematic diagram of Schistosoma japonicum SjCTRL gene order in embodiment 1.In Fig. 1, M:DNA points
Sub- amount standard；1:SjCTRL.
Fig. 2 is Schistosoma japonicum SjCTRL gene recombination plasmid bacterium colony PCR qualification result schematic diagram in embodiment 3.Fig. 2
In, M:DNA molecular weight standard；1-4:SjCTRL；Transformed BL21 E. coli clones PCR amplification, 1-4 expression randomly select
4 bacterium colonies, be successfully connected conversion.
Fig. 3 is the SDS-PAGE analysis result schematic diagram of Schistosoma japonicum SjCTRL in embodiment 4.In Fig. 3, M: albumen point
Sub- amount standard；1: not inducing the full bacterium of control；2: non-induced precipitation 3~5: the full bacterium of 4h (1mM/L IPTG), supernatant are heavy after induction
It forms sediment.
Fig. 4 is the SDS-PAGE analysis result signal of Schistosoma japonicum SjCTRL recombinant protein purification effect in embodiment 5
Figure.In Fig. 4, M: Protein Marker；The full bacterial lysate of pET-28a/SjCTRL after 1:IPTG induction；2: affinity purification is worn
Liquid out；3: SjCTRL recombinant protein after purification.
Specific embodiment
Following embodiment is only illustrative of the invention and is not intended to limit the scope of the invention.It is not specified in embodiment specific
The experimental method of condition, usually according to normal condition, or according to the normal condition proposed by manufacturer.
Main agents are as shown in table 1:
Table 1
Key instrument equipment is as shown in table 2:
Table 2
| PCR instrument | U.S. Bio-Rad |
| Protein electrophoresis instrument | U.S. Bio-Rad |
| Table-type high-speed refrigerated centrifuge | German Eppendorf |
| High speed freezing centrifuge (CR22F) | Hitachi, Japan |
| Milli-Q pure water system | U.S. Millipore |
Test material:
Schistosoma japonicum cDNA, host strain E. coli DH5 α, BL21 (DE3), plasmid pET-28a (+), by China
Prevention of parasitic diseases control in disease prevention and control center's is provided.
The clone of 1 Schistosoma japonicum SjCTRL gene of embodiment
The amplification and purifying of 1.1 SjCTRL genetic fragments:
1.1.1 according to the sequence of SjCTRL gene (Genbank FN317561.1) (sequence as shown in SEQ ID NO.1),
It is as follows using 5.0 software design a pair of specific primer of Primer Premier:
PF:5′-CG AATTTAGAATATCGTATACAAAATGGTT-3 ' (as shown in SEQ ID NO.3)；
PR:5′-CC TCAACCACTGCCTGCTATTG-3 ' (as shown in SEQ ID NO.4)；
Single underscore be upstream and downstream primer protectiveness base, double underline is the BamH I restriction enzyme site of upstream primer
With the Xho I restriction enzyme site of downstream primer.Specific primer is synthesized by Invitrogen (Shanghai) Trading Co., Ltd..
1.1.2 using Schistosoma japonicum cDNA as template, PCR reaction is carried out, expands SjCTRL gene, reaction system is as follows:
Reaction condition:
With 1.2% Ago-Gel (GoldViewTMNucleic acid dye) electrophoresis detection PCR product, see whether that there are purposes
Band, as a result as shown in Figure 1, M:DNA molecular weight standard, 1:SjCTRL.PCR reaction the results show that there is one at about 663bp
Clearly band is consistent with the size of expected segment, shows successfully to amplify SjCTRL gene from cDNA.
1.1.3 the purification and recovery of PCR product (AxyGEN companyPlastic recovery kit)
1) after electrophoresis, DNA target fragment is cut down from Ago-Gel with clean, sharp blade.
2) glue of cutting is added in EP pipe of having weighed, then the two is weighed, weight subtracts each other to obtain net weight twice.
3) 300 μ l Buffer DE-A are added according to every 100mg (about 100 μ l) gel, are heated after mixing with 75 DEG C,
Interruption mixing (every 2-3min), until blob of viscose is completely melt (6-7min)；
4) the Buffer DE-B for adding 0.5 Buffer DE-A volume, is uniformly mixed.When isolated DNA fragmentation is less than
When 400bp, the isopropanol of 1 gel volume is added；
5) mixed liquor for drawing previous step, is transferred in DNA preparation pipe (being placed in 2ml centrifuge tube), 12,000 × g centrifugation
1min abandons filtrate；
6) pipe will be prepared and puts back into 2ml centrifuge tube, added 500 μ l Buffer W1,12,000 × g to be centrifuged 30s, abandon filtrate；
7) pipe will be prepared and puts back into 2ml centrifuge tube, added 700 μ l Buffer W2,12,000 × g to be centrifuged 30s, abandon filtrate；Together
Quadrat method washed once with 700 μ l Buffer W2, and 12,000 × g is centrifuged 1min；
8) pipe will be prepared to put back into 2ml centrifuge tube, 12,000 × g is centrifuged 1min；
9) pipe will be prepared to be placed in clean 1.5ml centrifuge tube, adds 25-30 μ l Elution preparing film center
Buffer (65 DEG C of preheating) or deionized water, are stored at room temperature 1min, and 12,000 × g is centrifuged 1min.
10) recovery efficiency is detected with agarose gel electrophoresis, and estimates the concentration of DNA fragmentation.
The building of embodiment 2 SjCTRL gene recombination plasmid pET-28a (+)-SjCTRL
2.1 PCR product double digestions and recycling
The PCR target fragment of recycling is stayed overnight in 37 DEG C of water-bath double digestions, endonuclease reaction system is as follows:
Digestion products carry out 1.2% Ago-Gel (GoldViewTMNucleic acid dye) electrophoresis, cuts purpose band, again
DNA molecular is recycled, way of recycling is stored in -20 DEG C with 1.1.3 in embodiment 1, recovery product.
The preparation (AxyPrep Plasmid Miniprep Kit) of 2.2 pET-28a (+) empty plasmids
Single bacterium of the picking containing pET-28a (+) plasmid falls within 5ml LB training on LB plate (kanamycins containing 50 μ g/ml)
It supports in base (kanamycins containing 50 μ g/ml), 37 DEG C of overnight incubations.Next day takes 1ml culture solution to be transferred in 1.5ml centrifuge tube, protects
4 DEG C are stored in as strain.It by remaining culture solution in 5000rpm, is centrifuged 10 minutes, abandons supernatant.It has been added with 250 μ l
The Buffer S1 of RNaseA1 be resuspended bacterial precipitation (suspending needs uniformly, should not there are small fungus blocks, otherwise will affect splitting for thallus
Solution).250 μ l Buffer S2 are added, mildly but fully spin upside down mixing 6 times, until forming bright solution.It is added
400 μ l Buffer S3 spin upside down mildly and fully mixing 10 times, are stored at room temperature 2 minutes, and 14000rpm is centrifuged 10 minutes
(if still having suspended matter, be centrifuged again after being gently mixed by inversion 3 minutes).Supernatant after centrifugation is transferred to and is prepared in pipe,
It is placed in 2ml centrifuge tube, 1400rpm is centrifuged 1 minute.Filtrate is transferred again into preparation pipe to repeat to combine one in the same way
It is secondary.Filtrate is abandoned, pipe will be prepared and put back into former centrifuge tube, 500 μ l Buffer W1 are added and are washed, 14000rpm centrifugation 1
Minute.Filtrate is abandoned, pipe will be prepared and put back into former centrifuge tube, 700 μ l Buffer W2 are added and (the anhydrous of proper volume have been added
Ethyl alcohol), 14000rpm is centrifuged 1 minute, abandons filtrate；It washed once again with 700 μ l Buffer W2 in the same way, abandon filter
Liquid.Pipe will be prepared to put back into 2ml centrifuge tube, 14000rpm is centrifuged 1 minute.Pipe will be prepared and move into new 1.5ml centrifuge tube,
The film center for preparing pipe adds 20 μ l eluents (eluent is heated to 65 DEG C in advance, and elution efficiency can be improved), is stored at room temperature 1 point
Clock；14000rpm is centrifuged 1 minute and is eluted.Eluent is rejoined and prepares periosteum center, is stored at room temperature 1 minute,
14000rpm is centrifuged 1 minute eluted dna again.Eluent is placed in -20 DEG C of preservations, is detected with agarose gel electrophoresis extracted
Plasmid DNA.(referring to AxyPrep Plasmid Miniprep Kit operation manual)
The double digestion of 2.3 pET-28a empty plasmids
Digestion with restriction enzyme pET-28a (+) empty plasmid is added, 37 DEG C of water-baths are stayed overnight, and reaction system is as follows:
Digestion products carry out 1% Ago-Gel (GoldViewTMNucleic acid dye) electrophoresis, cuts target fragment and is recycled
Purifying, way of recycling are stored in -20 DEG C with 1.1.3 in embodiment 1, sample.
The building of 2.4 recombinant plasmids
Exogenous genetic fragment after the recovery and expression vector segment are attached according to the ratio of 3:1 (molar ratio), even
Junctor system is as follows:
Reaction system connects overnight in 16 DEG C of water-baths, constructs pET-28a (+)-SjCTRL recombinant plasmid.
The identification of 3 Schistosoma japonicum SjCTRL expression vector of embodiment
3.1 connection product Transformed E .coli DH5 α competent cells
Connection product in the 2.4 of embodiment 2 is gently mixed with E.coli DH5 α competent cell, ice bath 30 minutes,
In 42 DEG C water-bath heat shock 1.5 minutes, ice bath 5 minutes again.The SOC culture medium of 900 μ l is added under aseptic condition into culture tube,
37 DEG C, 200rpm, shaken cultivation 1 hour.By cultured bacterium solution in 3500rpm, it is centrifuged 3 minutes, discards most of supernatant, stay
Thallus is resuspended in about 100 μ l culture mediums.Re-suspension liquid is spread evenly across on LB plate (kanamycins containing 50 μ g/ml), 37 DEG C are fallen
Overnight incubation is set, bacterium colony growing state is observed.
The PCR of 3.2 recombinant plasmids is identified
Single bacterium colony on random picking plate carries out bacterium colony PCR identification, and PCR product is detected through agarose gel electrophoresis
(result is successfully connected conversion as shown in Fig. 2, 4 bacterium colonies that 1-4 expression randomly selects in Fig. 2), identifies by PCR and shows
There is purpose band at estimated molecular size range, shows the insertion for having exogenous genetic fragment.
The sequencing of 3.3 recombinant plasmids is identified
Select the single colonie of amplifiable purpose band out that Invitrogen trade Co., Ltd is sent to be sequenced, to examine insertion
Whether the sequence of segment is correct.Sequencing analysis the result shows that insertion exogenous genetic fragment sequence it is correct, construction of recombinant plasmid at
Function.
Expression and identification of the recombinant plasmid of 4 Schistosoma japonicum SjCTRL of embodiment in E.coli
The inducing expression of 4.1 pET-28a (+)-SjCTRL recombinant plasmids
1) take 1 μ l that correct pET-28a (+)-SjCTRL recombinant plasmid transformed E.coli BL21 (DE3) competence is sequenced
Cell, method for transformation is the same as 3.1 in embodiment 3.
2) next day is inoculated in the LB culture medium of 5ml (containing containing 50 μ respectively at 6 single colonies of random picking each on each plate
The kanamycins of g/ml), 37 DEG C, 200rpm, shaken cultivation to OD600=0.6.
3) 1ml bacterium solution is taken out as strain, further takes out 2ml bacterium solution and IPTG is not added as control, remaining 2ml bacterium solution is added
The IPTG of final concentration of 1mM is induced, and 37 DEG C, 250rpm, continues culture 4 hours.
4) by cultured bacterium solution in 4 DEG C, 5000rpm is centrifuged 10 minutes collection thallus, discards supernatant.
4.2 SDS-PAGE identifies induced product
200 1 × PBS of μ l are separately added into induction pipe and control tube, and bacterial sediment is resuspended.Respectively from induction pipe and control
The re-suspension liquid of 5 μ l is taken out in pipe, 2 × SDS-PAGE sample-loading buffer, 5 μ l is added, and is boiled 5 minutes and is denaturalized in 100 DEG C after mixing.
It is separately added into the sample of 8 μ l in each loading hole, carries out SDS-PAGE analysis, separation gel 12%, concentration glue is 5%.Gel
Formula is as shown in table 3 below:
Table 3
The voltage that concentration glue is arranged is 80V, and the voltage of separation gel is that 100V carries out electrophoresis.Glass is escaped to bromophenol blue indicator
Power supply is closed when glass plate lower edge.It removes gel dyeing liquor to dye 2 hours, then is decolourized with destainer, until protein band is clear
It is clear visible.
As shown in figure 3, by pET-28a (+)-SjCTRL recombinant plasmid transformed E.coli BL21 (DE3) competent cell,
There is the obvious band of expression that molecular weight is about 24kDa in thallus before relatively inducing after IPTG inducing expression, that is, is purpose base
Because of the product with His tag amalgamation and expression, size is consistent with theoretical Mr.
The identification of 4.3 recombinant protein dissolubilities
It will have determined that E.coli BL21 (DE3) strain that can express recombinant protein is inoculated into 100ml LB culture medium (containing 50
The kanamycins of μ g/ml) in, 37 DEG C, 200rpm is cultivated to OD600=0.6.The bacterium solution of culture is taken out into 1ml as strain, separately
Take 2ml as control.IPTG to final concentration of 1mM is added into remaining bacterium solution, 37 DEG C, 200rpm continues culture 4 hours.
Bacterium solution after induction 4 DEG C, is centrifuged 10 minutes through 5000rpm, abandons supernatant to the greatest extent, be added 5ml's into bacterial sediment
BugBuster Protein Extraction agent (Novagen) sufficiently suspends after precipitating, suspension is transferred in centrifuge tube, is placed on shaking table,
Lysis at room temperature thallus 1 hour.By bacterial lysate in 4 DEG C, 10000rpm is centrifuged 10 minutes, takes supernatant to be stored in another clean
In centrifuge tube, picking precipitates on a small quantity to be resuspended with the PBS of proper volume.The supernatant precipitating re-suspension liquid for taking out 5 μ l respectively makees SDS-
PAGE analysis, identifies the dissolubility of recombinant protein.Electrophoresis result (Fig. 3) shows that recombinant protein is predominantly located in precipitating, forms packet
Contain body.
The purifying of 5 Schistosoma japonicum SjCTRL recombinant protein of embodiment
The purifying of 5.1 recombinant proteins
1) a large amount of preparation expression recombinant protein thallus
The fresh bacterium solution of 30mL is taken, is inoculated into the LB culture medium of that resistance of 1L card, 37 DEG C, 220r/min shaken cultivation is extremely
OD600 value 0.6 or so, is added the IPTG of 1mM, continues to cultivate 6h, 8000g, 4 centrifugation 30min, collects thallus.Bacterium after collection
Body is resuspended with the lysate of 20mL, is placed in -80 DEG C and is frozen.
2) carrying out ultrasonic bacteria breaking deposits -80 DEG C of refrigerators and takes out thallus, and after thallus thawing, piping and druming is uniform, ultrasonic disruption cell.It is super
Acoustical power is 160W, and ultrasound opens 2s, and ultrasound closes 2s, ultrasonic number 150 times.Cellular lysate liquid 15000g after ultrasound, 4 DEG C of centrifugations
30min takes precipitating.
3) inclusion body is handled
80mL inclusion body cleaning solution is added into precipitating, is placed on magnetic stirring apparatus, washing precipitating 2h is sufficiently stirred, then
15000g, 30min, 4 DEG C are collected by centrifugation precipitating.The sufficiently dissolution inclusion body of 10mL extracting solution I, at room temperature, magnetic agitation mistake is added
Night, last 15000g, 30min, 4 DEG C was collected by centrifugation supernatant to being completely dissolved.Take supernatant with 1:10 ratio rapid dilution in pre-cooling
Gradient dilution liquid in, ice bath place 10min.Then precipitating is collected by centrifugation for 15000g, 30min, 4 DEG C.It is added in extracting solution II
Magnetic agitation dissolves 2h or so, and 15000g, 30min, 10 DEG C are collected by centrifugation supernatant.
Protein purification is carried out in AKTA protein purification instrument (GE company) using Histrap FF prepacked column, equilibrium liquid (at
Point same lysate) after 5 column volumes of balance nickel affinity column, upper protein sample is successively rinsed after end of the sample with equilibrium liquid and is removed
Foreign protein is used eluent A, B, C or D instead and is successively rinsed, detect egg wait be pierced by liquid after being pierced by and can't detect albumen in liquid
Bai Shi should collect sample, its purity of SDS-PAGE electrophoresis detection immediately.Pillar subsequent rinse removes the albumen of remaining, through 0.2M
It is rinsed, is finally rinsed again with 20% ethanol solution, 4 DEG C of long-term preservations with deionized water again after NaOH washing.Purification result is such as
Shown in Fig. 4.
The measurement of 5.2 recombinant protein concentration
Using the concentration of Bradford quantification of protein kit (Tiangeng) measurement recombinant protein, grasped to specifications
Make.Key step includes:
Coomassie Brillant Blue solution is first being balanced to room temperature before and is mildly being mixed by inversion, and preheats spectrophotometer.By 0,
5,10,15,20,25,30 μ l bovine serum albumin(BSA) (BSA) standard solution (1mg/ml) are added separately in centrifuge tube, and PBS is added to mend
Enough to 75 μ l.The recombinant protein that proper volume purifies is added in centrifuge tube, and supplies 75 μ l with PBS.Into each centrifuge tube
1425 μ l Coomassie Brillant Blue solutions are added, mixes, is stored at room temperature 10 minutes.With the light absorption value at spectrophotometric determination 595nm,
And record reading.Using the absorbance value without BSA sample as blank control, standard curve is drawn, the egg of sample to be tested is calculated
White concentration.If obtained protein concentration exceeds the range of standard curve, after according to circumstances sample is diluted or is concentrated again
Measurement.It is 1.215mg/ml according to the concentration that the dilution of table 4 and recombinant protein calculates SjCTRL recombinant protein after purification.
Each pipe solution reaction system for drawing standard curve is as shown in table 4 below:
Table 4
The animal protection experiment of 6 Schistosoma japonicum SjCTRL recombinant protein of embodiment
The Immunoprotection test of 6.1 recombinant proteins
1) experimental group
4-6 weeks C57BL/6 female mice is divided into A protein immunization group (6), two groups of B adjuvant control group (6).
2) it is immunized
Mouse is divided at 3 points respectively at 0,2,4 week back or subcutaneous abdomen and is immunized.
Before immune: emulsification: ice-bath ultrasonic after adjuvant is mixed with albumen, until emulsifier dropwise addition is not dissipated in the water surface at oil droplet shape
It opens.
A recombinant protein immune group (6):
(0d) is immunized for the first time: recombinant protein (25 μ g in, 50 μ l 8M urea)+50 μ l Freund's complete adjuvants
Second immune (14d): recombinant protein (25 μ g in, 50 μ l 8M urea)+50 μ l incomplete Freund's adjuvants
(28d) is immunized in third time: recombinant protein (25 μ g in, 50 μ l 8M urea)+50 μ l PBS
B adjuvant control group (6):
(0d) is immunized for the first time: 50 μ l 8M urea+50 μ l Freund's complete adjuvants
Second immune (14d): 50 μ l 8M urea+50 μ l incomplete Freund's adjuvants
(28d) is immunized in third time: 50 μ l 8M urea+50 μ l PBS
3) it infects
It is immune after two weeks in third time, miracidium infection attack is carried out to the mouse after immune, miracidium infection amount is every small
Mouse 40 (± 2) head.
4) adult, egg count
After miracidium infection is attacked 35 days, cuts open and kill the collection that mouse carries out Schistosoma japonicum.
Schistosoma japonicum adult counts: collecting Schistosoma japonicum all in every mouse body, and carries out counting statistics.
Egg count in mouse liver: taking every rat liver to weigh, and the homogenate of 5ml physiological saline tissue is added, uses 5ml
10%KOH takes microscopy whole worm's ovum number after 20 μ l smears in 37 DEG C of digestion 6h.It is counted using double-blind study, everyone opens painting by microscopy 3
Piece calculates the average value and egg reduction rate of every gram of excrement worm's ovum number of every mouse.
Calculation method
Worm reduction rate (percentage)=[(it is average that the average every mouse of protein immunization group obtains adult number/adjuvant control group to 1-
Every mouse obtains into borer population)] × 100%
Liver egg reduction rate (percentage)=[(protein immunization group is averaged worm's ovum number/adjuvant control group contained by every gram of liver 1-
Worm's ovum number contained by average every gram of liver)] × 100%
Table 5 is the result chart of Schistosoma japonicum SjCTRL recombinant protein animal protection test in embodiment 6.
5 Schistosoma japonicum SjCTRL protein immunization mouse of table
Table1 Effect of immunization with SjCTRL in mice
* EPG is every gram of liver worm's ovum number.EPG:Number of eggs per gram liver.
The verifying of animal protection test through above-mentioned Schistosoma japonicum SjCTRL recombinant protein, Schistosoma japonicum of the invention
SjCTRL recombinant antigen protein be immunized mouse can reduce infection Schistosoma japonicum at borer population and liver worm's ovum number, especially subtracting
Significant effect in terms of ovum rate, can be used as potential anti-schistosome vaccine target spot, is used to prepare anti schistosoma vaccine.
Claims (8)
1. a kind of Schistosoma japonicum SjCTRL recombinant antigen protein, which is characterized in that its amino acid sequence is SEQ ID NO.2 institute
Show；The Schistosoma japonicum SjCTRL recombinant protein is prepared with the following method:
1) amplification of Schistosoma japonicum SjCTRL gene order: nucleotide sequence shown in design SEQ ID NO:3 or its complementation
Nucleotide sequence shown in chain and SEQ ID NO:4 or its complementary strand are primer, are template progress PCR using Schistosoma japonicum cDNA
Amplification；Gained PCR product is through agarose gel electrophoresis, and recovery purifying；
2) building and identification of Schistosoma japonicum SjCTRL gene recombination plasmid；
3) it by the recombinant plasmid transformed in host cell, and is expressed in host cell, the recombinant protein expressed；
4) recombinant protein of the affine column purification expression of Ni-NTA agarose.
2. specific primer of a pair for the amplification of Schistosoma japonicum SjCTRL gene PCR, sequence are as follows:
Upstream:(such as SEQ ID NO:3
It is shown) or its complementary strand；
Downstream:(as shown in SEQ ID NO:4) or its mutually
Mend chain.
3. a kind of preparation method of Schistosoma japonicum SjCTRL recombinant antigen protein as described in claim 1, which is characterized in that
Include the following steps:
1) amplification of Schistosoma japonicum SjCTRL gene order: nucleotide sequence shown in design SEQ ID NO:3 or its complementation
Nucleotide sequence shown in chain and SEQ ID NO:4 or its complementary strand are primer, using cDNA containing Schistosoma japonicum as template progress
PCR amplification；Gained PCR product is through agarose gel electrophoresis, and recovery purifying；
2) building and identification of Schistosoma japonicum SjCTRL gene recombination plasmid；
3) it by the recombinant plasmid transformed in host cell, and is expressed in host cell, the recombinant protein expressed；
4) recombinant protein of the affine column purification expression of Ni-NTA agarose.
4. the preparation method of Schistosoma japonicum SjCTRL recombinant antigen protein as claimed in claim 3, which is characterized in that step
1) in, the reaction condition of the PCR amplification are as follows: 95 DEG C of initial denaturation 5min；94 DEG C of denaturation 1min, 55 DEG C of annealing 1min, 72 DEG C are prolonged
Stretch 1min, 35 circulations, 72 DEG C of extension 10min；Finally it is stored in 4 DEG C.
5. the preparation method of Schistosoma japonicum SjCTRL recombinant antigen protein as claimed in claim 3, which is characterized in that step
2) specifically: the resulting PCR product segment of step 1) and plasmid vector pET-28a (+) are used into restriction enzyme BamH respectively
I and Xho I carries out double digestion, and recovery purifying；According to the concentration of target gene fragment and carrier endonuclease bamhi after purification into
Row connection, is built into recombinant plasmid pET-28a (+)-SjCTRL of SjCTRL encoding gene prokaryotic expression；This recombinant plasmid is led to
Cross CaCl2Method is transformed into bacillus coli DH 5 alpha competent cell, is coated on the agar plate of LB containing kanamycins after culture, at random
Bacterium colony on the above-mentioned plate of picking collects thallus after culture, extract contained recombinant plasmid in thallus, carries out PCR identification, sequencing mirror
It is fixed.
6. the preparation method of Schistosoma japonicum SjCTRL recombinant antigen protein as claimed in claim 5, which is characterized in that step
3) specifically: step 2) sequencing is identified that errorless pET-28a (+)-SjCTRL recombinant plasmid transformed enters large intestine by calcium conversion
In bacillus BL21 (DE3), it is coated on after culture on the LB agar plate containing kanamycins；Bacterium on the above-mentioned plate of random picking
It falls, culture Escherichia coli to logarithmic growth phase, inducer is added and continues to cultivate；SDS-PAGE electroresis appraisal inducing expression as a result,
Directly with whole cell electrophoresis showed.
7. the preparation method of Schistosoma japonicum SjCTRL recombinant antigen protein as claimed in claim 3, which is characterized in that step
4) specifically: the expression higher strain that freezes of Schistosoma japonicum recombinant protein SjCTRL amount is taken to line the LB fine jade containing kanamycins
On rouge plate, after overnight incubation, the colony inoculation on the random above-mentioned plate of picking is to equally containing the Liquid Culture of kanamycins
Base, culture bacterium solution to logarithmic growth phase are added inducer and continue to cultivate, finally collect thallus；Albumen is added in above-mentioned thallus
Extractant cracks bacterium, supernatant and precipitating is retained after centrifugation, by SDS-PAGE electroresis appraisal result；According to the above results, use
Denaturant cracking gained precipitating, is purified, SDS-PAGE examines purification result with Ni-NTA agarose affinity column.
8. a kind of Schistosoma japonicum SjCTRL recombinant antigen protein is preparing the application in anti schistosoma vaccine, the Japan
The amino acid sequence of blood fluke SjCTRL recombinant antigen protein is shown in SEQ ID NO.2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510519076.XA CN105153290B (en) | 2015-08-21 | 2015-08-21 | Schistosoma japonicum SjCTRL recombinant antigen protein and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510519076.XA CN105153290B (en) | 2015-08-21 | 2015-08-21 | Schistosoma japonicum SjCTRL recombinant antigen protein and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105153290A CN105153290A (en) | 2015-12-16 |
| CN105153290B true CN105153290B (en) | 2019-03-15 |
Family
ID=54794371
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510519076.XA Active CN105153290B (en) | 2015-08-21 | 2015-08-21 | Schistosoma japonicum SjCTRL recombinant antigen protein and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105153290B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106520813A (en) * | 2016-11-28 | 2017-03-22 | 杨自标 | Synthetic method for vaccine used for preventing Schistosoma japonicum |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011005593A2 (en) * | 2009-06-23 | 2011-01-13 | Texas Tech University System | Schistosomiasis vaccine compositions and methods of use |
| CN103374567A (en) * | 2012-04-17 | 2013-10-30 | 中国疾病预防控制中心寄生虫病预防控制所 | Schistosoma japonicum calcium-binding EF-hand domain containing protein (SjEFCAB) recombinant antigen protein and preparation method and application thereof |
| CN104099309A (en) * | 2013-04-15 | 2014-10-15 | 中国农业科学院上海兽医研究所 | Schistosoma japonicum recombinant antigen, and preparation method and application thereof |
| CN104306994A (en) * | 2014-10-27 | 2015-01-28 | 江苏省血吸虫病防治研究所 | Japanese schistosomiasis vaccine combined immunizing method and application of Japanese schistosomiasis vaccine |
| CN104630172A (en) * | 2014-11-06 | 2015-05-20 | 南京大学 | Mutant of schistosoma japonicum glutathione-S-transferase and application thereof |
-
2015
- 2015-08-21 CN CN201510519076.XA patent/CN105153290B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011005593A2 (en) * | 2009-06-23 | 2011-01-13 | Texas Tech University System | Schistosomiasis vaccine compositions and methods of use |
| CN103374567A (en) * | 2012-04-17 | 2013-10-30 | 中国疾病预防控制中心寄生虫病预防控制所 | Schistosoma japonicum calcium-binding EF-hand domain containing protein (SjEFCAB) recombinant antigen protein and preparation method and application thereof |
| CN104099309A (en) * | 2013-04-15 | 2014-10-15 | 中国农业科学院上海兽医研究所 | Schistosoma japonicum recombinant antigen, and preparation method and application thereof |
| CN104306994A (en) * | 2014-10-27 | 2015-01-28 | 江苏省血吸虫病防治研究所 | Japanese schistosomiasis vaccine combined immunizing method and application of Japanese schistosomiasis vaccine |
| CN104630172A (en) * | 2014-11-06 | 2015-05-20 | 南京大学 | Mutant of schistosoma japonicum glutathione-S-transferase and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Accession：CAX73292，Peptidase S1 and S6，chymotrypsin/Hap，IPR009003 Peptidase，trypsin-like serine and cysteine,domain-containing protein [Schistosoma japonicum];Liu et al.;《Genbank》;20090903;Features和Origin部分 |
| The Schistosoma japonicum genome reveals features of host-parasite interplay;Lei ZHANG et al.;《Nature》;20090716;第460卷;345-352 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105153290A (en) | 2015-12-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102816246B (en) | Human cytomegalo virus immunogen fusion protein as well as preparation method and usage thereof | |
| CN104628865B (en) | A kind of pseudo- mad dog epitope polypeptide recombinant vaccine | |
| CN104761628A (en) | Babesia mocroti Bm7 recombinant antigenic protein, preparation method and purpose thereof | |
| CN109293750B (en) | Pseudomonas aeruginosa vaccine recombinant protein SBP and preparation method and application thereof | |
| CN105617373B (en) | A kind of vaccine composition and its preparation method and application | |
| CN112480227B (en) | Protein for improving pathogenic bacterium resistance of sturgeon and preparation method and application thereof | |
| CN102167735A (en) | Recombinant antigen protein of S.japonicum SjTollip and preparation method and application thereof | |
| CN105797152B (en) | A kind of vaccine composition and its preparation method and application | |
| CN105153290B (en) | Schistosoma japonicum SjCTRL recombinant antigen protein and its preparation method and application | |
| Xie et al. | Characterization of two membrane‐associated protease genes obtained from screening out‐membrane protein genes of Flavobacterium columnare G4 | |
| CN102604993B (en) | Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof | |
| CN110891597B (en) | Composition for preventing and treating poultry synovium infection | |
| CN106008678A (en) | Fusion protein for inhibiting clostridium perfringens infection and related biological material and application thereof | |
| Chen et al. | Development and evaluation of nucleoprotein-based rapid detection test for Siniperca chuatsi rhabdovirus | |
| CN102847168B (en) | The design of a kind of nucleic acid vaccine PV-Fn preventing bovine mastitis and structure thereof | |
| CN106397546B (en) | Artificial recombinant antigen of O-type foot-and-mouth disease virus, preparation and application thereof | |
| CN104152477A (en) | Schistosoma japonicum recombinant antigen SjPDI (schistosoma japonicum protein disulfide isomerase) and preparation method and application thereof | |
| CN1641034B (en) | Method for preparing tetanus toxin recombinant antigen and its use | |
| CN105753949B (en) | A kind of erysipelothrix rhusiopathiae antigen albumen and application | |
| CN114807059A (en) | Novel PCV3 virus strain and PCV3 genetic engineering subunit vaccine | |
| CN112159480B (en) | Chicken infectious bursal disease virus multi-antigen epitope protein and application thereof | |
| CN112279925A (en) | Fusion protein, canine toxoplasma subunit vaccine and vaccine composition thereof | |
| CN103665149A (en) | Schistosoma japonicum katsurada recombinant antigen as well as preparation method and application thereof | |
| CN107827986B (en) | Pig O/Mya98 and O/PanAsia type foot-and-mouth disease gene engineering inactivated vaccine | |
| CN103361364A (en) | Eimeria tenella eIF3d gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |