CN105132282A - Campylobacter jejuni immune PCR detection kit - Google Patents
Campylobacter jejuni immune PCR detection kit Download PDFInfo
- Publication number
- CN105132282A CN105132282A CN201510573624.7A CN201510573624A CN105132282A CN 105132282 A CN105132282 A CN 105132282A CN 201510573624 A CN201510573624 A CN 201510573624A CN 105132282 A CN105132282 A CN 105132282A
- Authority
- CN
- China
- Prior art keywords
- campylobacter jejuni
- pcr
- test kit
- detection kit
- monoclonal antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6804—Nucleic acid analysis using immunogens
Abstract
The invention discloses a specific antibody-coated PCR reaction tube and immune PCR detection kit for detecting campylobacter jejuni. A monoclonal antibody which can specifically enrich the campylobacter jejuni in samples pre-coats the PCR reaction tube. The detection kit has the advantages that the detection kit can fast, accurately and sensitively detect the campylobacter jejuni from the samples such as food, the sensitivity of the detection kit can reach 103-104cfu/ml, and the sensitivity of the detection kit is 10-100 times higher than that of conventional PCR; the detection kit organically and integrally combines immunology and molecular biology methods, enrichment and detection of the campylobacter jejuni in the samples can be realized in one PCR tube, and the detection kit is simple to operate, low in cost, fast in detection and accurate in result.
Description
Technical field
The invention belongs to biotechnology and field of immunology, be specifically related to a kind of immuno-PCR detection kit detecting campylobacter jejuni.
Background technology
Campylobacter jejuni (campylobacterjejunienteritis) is that Butzler in 1973 etc. separate in Feces of Patients With Diarrhea, has been familiar with one of its Main Pathogenic Bacteria for mankind's diarrhoea at present.The sickness rate of campylobacter jejuni enteritis exceedes bacillary dysentery in developed country, and in developing country, sickness rate is almost equal to bacillary dysentery.This bacterium is as important food-borne pathogens, along with food enter enteron aisle after containing breeding rapidly under micro amount of oxygen environment, main infringement jejunum, ileum and colon, invasion and attack intestinal mucosa, cause hyperemia and heamorrhagic lesions, observe some bacterial strain in recent years and can produce similar cholera enterotoxin, cause liquid secretion in enteric cavity to increase.The detection of current campylobacter jejuni depends on the biochemical identification of GB defined, and its shortcoming is that complex operation, sense cycle are longer, cannot adapt to a large amount of sample examinations.
Immunology detection is quick, accurate, the most stable rapid detection means occurred in recent years; but there is no the rapid detection product that can apply to detect practice both at home and abroad at present; this patent is detect target with campylobacter jejuni, and technology required for protection relates to campylobacter jejuni rapid detection product.
Summary of the invention
The object of this invention is to provide a kind of PCR reaction tubes for detecting campylobacter jejuni.
Another object of the present invention is to provide a kind of immuno-PCR detection kit for detecting campylobacter jejuni.
A first aspect of the present invention there is provided a kind of PCR reaction tubes for detecting campylobacter jejuni, and described PCR reaction tubes comprises:
Immuno-PCR pipe; With
Be coated in the anti-campylobacter jejuni monoclonal antibody of described immuno-PCR pipe inboard wall of tube body, described anti-campylobacter jejuni monoclonal antibody is by mouse hybridoma cell system 4C9E1G7H3, CGMCCNo.8457 or 3G2D8H3G9, CGMCCNo.8766 produce.
A second aspect of the present invention there is provided a kind of detection kit, and described test kit contains described PCR reaction tubes.
In a preference, described test kit also containing container a, is equipped with described PCR reaction tubes in described container a.
In another preference, described test kit is also containing damping fluid, dNTP, Taq DNA polymerase, ddH
2o, primer, positive control and negative control.
In another preference, described primer comprises forward primer and reverse primer.
In another preference, described positive control is the campylobacter jejuni bacterium liquid of deactivation, and described negative control is the brucella broth of sterilizing.
The details of all respects of the present invention is able to detailed description by chapters and sections subsequently.By hereafter and the description of claim, feature of the present invention, object and advantage will be more obvious.
Accompanying drawing explanation
Fig. 1 is use flow process and the schematic diagram of test kit of the present invention.
Fig. 2 is campylobacter jejuni Direct PCR gradient dilution detectability result of study.
Wherein, M:1000bpDNAladder; N: negative control; The bacterial concentration that 1-8 swimming lane is corresponding is: 1.67 × 10
8~ 1.67 × 10cfu/mL.
Fig. 3 is that campylobacter jejuni immuno-PCR detection kit detects campylobacter jejuni gradient dilution detectability result of study.
Wherein, M:1000bpDNAladder; N: negative control; The bacterial concentration that 1-8 swimming lane is corresponding is: 1.67 × 10
8~ 1.67 × 10cfu/mL.
Fig. 4 is the specific result of detection kit.
Wherein, M:1000bpDNAladder; N: negative control; 1-15 swimming lane is respectively: campylobacter jejuni CICC22937, ATCC29428, ATCC33291, ATCC33560, CICC6071, streptococcus aureus ATCC27660, Salmonella typhimurium ATCC22956, Salmonella enteritidis ATCC13076, Listeria monocytogenes ATCC43251, yersinia entero-colitica ATCC23715, shigella flexneri ATCC12022, bacillus ceylonensis A ATCC25931, shigella dysenteriae ATCC51329, beta hemolytic streptococcus ATCC10373, Enterobacter sakazakii ATCC29004.
Fig. 5 simulates milk sample immuno-PCR test kit detectability result of study of carrying disease germs.
A (1) simulates milk sample Direct PCR detectability result of study of carrying disease germs;
A (2) simulates milk sample immunocapture PCR detection kit detectability result of study of carrying disease germs;
Wherein, M:1000bpDNAladder; N: negative control; No. 1 swimming lane is milk sample (not adding bacterium liquid); The bacterial concentration that 2-8 swimming lane is corresponding is: 1.67 × 10
2~ 1.67 × 10
8cfu/mL.
Fig. 6 is analog band bacteria yoghurt sample immuno-PCR test kit detectability result of study.
B (1) analog band pork sample Direct PCR detectability result of study;
B (2) analog band pork sample immunocapture PCR detection kit detectability result of study;
Wherein, M:1000bpDNAladder; N: negative control; No. 1 swimming lane is yoghurt example (not adding bacterium liquid); The bacterial concentration that 2-8 swimming lane is corresponding is: 1.67 × 10
2~ 1.67 × 10
8cfu/mL.
Embodiment
The research of the present inventor shows, using campylobacter jejuni as immunogen, immunity Balb/c mouse, separation and purification obtains anti-campylobacter jejuni monoclonal antibody 4C9E1G7H3 and 3G2D8H3G9, its antibody titer can reach 1:100000, its can specificity, be combined with campylobacter jejuni efficiently, detection sensitivity reaches 10
5cfu/ml.With singly increase Liszt, hog cholera sramana, mouse typhus sramana, enteritis sramana, Fu Shi will is congratulated, Song Nei Shi will is congratulated, Boydii will is congratulated, enterohemorrhagic Escherichia coli O 157: H7, Enterobacter sakazakii, small intestine Yersinia etc. amount to 91 kinds of equal no cross reactions of pathogenetic bacteria.
On this basis, the present inventor and then pathogenic bacterium immunity enrichment technology and gene level detection technique are effectively combined, namely first by anti-campylobacter jejuni monoclonal antibody of the present invention by the pathogenic bacteria specific immunity enrichment in testing sample, and then carry out pcr amplification, thus provide a kind of can fast, the detection kit of efficient detection food source property campylobacter jejuni.
Antibody
Anti-campylobacter jejuni monoclonal antibody of the present invention can utilize mouse hybridoma cell system 4C9E1G7H3 (CGMCCNo.8457) or 3G2D8H3G9 (CGMCCNo.8766) secretion to produce.The present invention includes the monoclonal antibody of the corresponding aminoacid sequence with anti-campylobacter jejuni monoclonal antibody 4C9E1G7H3 or 3G2D8H3G9, and there is other protein of these chains or protein conjugate and fusion expressed product.Particularly, the present invention includes and have containing hypervariable region (complementary determining region, any protein of light chain CDR) and heavy chain or protein conjugate and fusion expressed product (i.e. immune conjugate and fusion expressed product), as long as this hypervariable region is identical with the hypervariable region of heavy chain with light chain of the present invention or at least 90% homology, preferably at least 95% homology.As is known to the person skilled in the art, immune conjugate and fusion expressed product comprise: that medicine, toxin, cytokine (cytokine), radionuclide, enzyme and other diagnosis or treatment molecule are combined with anti-campylobacter jejuni monoclonal antibody or its fragment and the conjugate that formed.The present invention also comprises the cell surface marker thing or antigen that are combined with anti-campylobacter jejuni monoclonal antibody or its fragment.
For anti-campylobacter jejuni monoclonal antibody heavy of the present invention and sequence of light chain, can measure by ordinary method.Hypervariable region or complementary determining region (complementaritydeterminingregion, the CDR) of anti-campylobacter jejuni monoclonal antibody V chain are interesting especially, because relate to conjugated antigen at least partly in them.Therefore, the present invention includes those and there is the band light chain immunoglobulin of CDR and the molecule of weight chain variable chain, as long as its CDR and anti-campylobacter jejuni monoclonal antibody CDR has the homology of more than 90% (preferably more than 95%).The present invention not only comprises complete monoclonal antibody, also comprises and has immunocompetent antibody fragment, as Fab or (Fab ')
2fragment; Heavy chain of antibody; Light chain of antibody.
Present invention also offers the DNA molecular of above-mentioned immunoglobulin (Ig) or its fragment.The sequence of these DNA moleculars can use routine techniques, utilizes hybridoma cell line 4C9E1G7H3 (CGMCCNo.8457) or 3G2D8H3G9 (CGMCCNo.8766) to obtain.In addition, also the encoding sequence of light chain and heavy chain can be merged, form single-chain antibody.
Once obtain relevant sequence, just relevant sequence can be obtained in large quantity with recombination method.This is normally cloned into carrier, then proceeds to cell, is then separated from the host cell after propagation by ordinary method and obtains relevant sequence.
In addition, also relevant sequence can be synthesized, when especially fragment length is shorter by the method for synthetic.Usually, by first synthesizing multiple small segment, and then carry out connect can obtain the very long fragment of sequence.
At present, the DNA sequence dna of code book invention albumen (or its fragment, or derivatives thereof) can be obtained completely by chemosynthesis.Then this DNA sequence dna can be introduced in the various existing DNA molecular (or as carrier) that in this area, oneself knows and cell.In addition, also by chemosynthesis, sudden change is introduced in protein sequence of the present invention.
The invention still further relates to the carrier comprising above-mentioned suitable DNA sequence dna and suitable promotor or control sequence.These carriers may be used for transforming suitable host cell, with can marking protein.
Host cell can be prokaryotic cell prokaryocyte, as bacterial cell; Or the eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.
Can carry out with routine techniques well known to those skilled in the art with recombinant DNA transformed host cell.When host be prokaryotic organism as campylobacter jejuni time, the competent cell that can absorb DNA can be gathered in the crops at exponential growth after date, uses CaC1
2method process, step used is well-known in this area.Another kind method uses MgC1
2.If needed, transform and also can be undertaken by the method for electroporation.When host is eukaryote, following DNA transfection method can be used: calcium phosphate precipitation, conventional mechanical methods as microinjection, electroporation, liposome packaging etc.
The transformant obtained can be cultivated by ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to host cell used, substratum used in cultivation can be selected from various conventional medium.Cultivate under the condition being suitable for host cell growth.When after host cell growth to suitable cell density, the promotor selected with the induction of suitable method (as temperature transition or chemical induction), cultivates for some time again by cell.
Recombinant polypeptide in the above methods can be expressed or be secreted into extracellular in cell or on cytolemma.If needed, can utilize its physics, the albumen of being recombinated by various separation method abstraction and purification with other characteristic of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation process, combination by protein precipitant process (salting-out method), centrifugal, the broken bacterium of infiltration, supersound process, ultracentrifugation, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
Anti-campylobacter jejuni monoclonal antibody 4C9E1G7H3 and 3G2D8H3G9 of the present invention, its height of tiring (can 1:100000 be reached), campylobacter jejuni can be detected specifically, efficiently, with singly increase Liszt, hog cholera sramana, mouse typhus sramana, enteritis sramana, Fu Shi will is congratulated, Song Nei Shi will is congratulated, Boydii will is congratulated, enterohemorrhagic Escherichia coli O 157: H7, Enterobacter sakazakii, small intestine Yersinia etc. amount to 91 kinds of equal no cross reactions of pathogenetic bacteria, this is maximum innovative point of the present invention.
Detection kit
The present inventor is according to the principle of immuno-PCR, prepare a kind of test kit that can be used for detecting sample jejuni, namely first with anti-campylobacter jejuni monoclonal antibody 4C9E1G7H3 or 3G2D8H3G9 of the present invention by the immunity enrichment specifically of the pathogenic bacteria in testing sample, and then carry out pcr amplification, to improve sensitivity and the specificity of detection.
Specifically, first the present invention there is provided a kind of PCR reaction tubes for detecting campylobacter jejuni, it comprises immuno-PCR pipe and is coated in the anti-campylobacter jejuni monoclonal antibody 4C9E1G7H3 or 3G2D8H3G9 of described immuno-PCR pipe inboard wall of tube body, described anti-campylobacter jejuni monoclonal antibody 4C9E1G7H3 and 3G2D8H3G9 is respectively by mouse hybridoma cell system 4C9E1G7H3, CGMCCNo.8457 or 3G2D8H3G9, CGMCCNo.8766 secrete generation.
On this basis, the present invention and then provide a kind of campylobacter jejuni immuno-PCR detection kit, it contains the above-mentioned PCR reaction tubes for detecting campylobacter jejuni;
As optimal way of the present invention, container a is also mounted with in described test kit, described container a can be valve bag or other forms of container, and the PCR reaction tubes being coated with anti-campylobacter jejuni monoclonal antibody 4C9E1G7H3 or 3G2D8H3G9 of the present invention is wherein housed.
In addition, in order to make test kit of the present invention more convenient when detecting, preferably some other auxiliary reagent is also comprised in described test kit of the present invention, described auxiliary reagent is conventional some reagent used in immuno-PCR detection kit, and the characteristic of these reagent and their compound method are all well-known to those skilled in the art.Described reagent is (but being not limited to) such as: damping fluid (10 × PCRBuffer), dNTP, Taq DNA polymerase, ddH
2the Standard PCR reaction reagents such as O (sterilizing distilled water), primer.10 × PCRBuffer, dNTP, Taq DNA polymerase, ddH
2o is same with the Reagent evaluation used in conventional immuno-PCR detection kit.Meanwhile, in order to eliminate false positive and false negative, also can Quality Control (contrast) being set in PCR testing process, namely in test kit of the present invention, also including negative control and positive control etc.Preferably, described positive control solution is the campylobacter jejuni bacterium liquid of deactivation, and negative control solution is the brucella broth (Brucellabroth) of sterilizing.As well known to the skilled person, mentioned reagent and solution can be loaded in EP pipe or reagent bottle respectively.
In addition, in described test kit, also working instructions can be comprised, for illustration of the using method of the reagent wherein loaded.
Beneficial effect of the present invention: campylobacter jejuni immuno-PCR detection kit of the present invention integrates that pathogenic bacteria is concentrated, specific antibody identification and pcr amplification, have that detected result accuracy is high, high specificity, highly sensitive and detect the advantages such as quick, easy to use, compensate for the deficiency that the time-consuming effort of existing food-borne pathogens detection technique, sensitivity are low.
Campylobacter jejuni immuno-PCR detection kit of the present invention is applicable to the numerous areas such as bacterial strain Rapid identification, food borne pathogens in food detection, is particularly useful for the rapid detection of micro-pathogenic agent in sample.Quality supervision department, import and export sanitary authority etc. can be supplied for detecting the campylobacter jejuni in food sample.
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as people such as Sambrook, molecular cloning: lab guide (NewYork:ColdSpringHarborLaboratoryPress, 1989) condition described in, or according to the condition that manufacturer advises.Unless otherwise indicated, otherwise per-cent and number calculate by weight.
Unless otherwise defined, all specialties used in literary composition and scientific words and one skilled in the art the same meaning be familiar with.In addition, any method similar or impartial to described content and material all can be applicable in the present invention.The use that better implementation method described in literary composition and material only present a demonstration.
The preparation of the anti-campylobacter jejuni monoclonal antibody 4C9E1G7H3 and 3G2D8H3G9 of embodiment 1.
One, the preparation of immunogen and positive criteria product
Campylobacter jejuni (CICC22937) is seeded on brucella broth, and 37 DEG C, 150r/min vibration anaerobic condition cultivation 17h, counting, adds 0.3% formaldehyde solution room temperature deactivation 1 day.Campylobacter jejuni (CICCNo.22937) concentration to 5 × 10 are adjusted with physiological saline
9cfu/ml is as immunogen; Adjusting concentration with physiological saline is 10
8cfu/ml is as positive control standard substance, and brucella broth is negative control standard substance.
Two, the preparation of monoclonal antibody
1, laboratory animal: select 38 week ages, about body weight 20g, female Balb/c mouse are laboratory animal.
2, immunization method: every mouse peritoneal injection 0.2ml immunogen, at interval of 2 weeks with same dosage booster shots once.
3, take a blood sample: from tail vein blood sampling after 3 booster immunizations, adopt indirect non-competing euzymelinked immunosorbent assay (ELISA) to measure antiserum titre.Wait to tire and no longer rise, abdominal injection same amount immunogen, conventionally carried out cytogamy after 3 days.
4, cytogamy: get that immune mouse spleen cell and SP2/0 myeloma cell are conventional under 50%PEG effect merges, is inoculated in 96 well culture plates respectively, is placed in 37 DEG C, 5%CO
2incubator is cultivated.
5, filtering hybridoma: adopt indirect non-competing euzymelinked immunosorbent assay (ELISA), the hybridoma in screening strong positive hole, transfers them to 24 well culture plates.
6, clone cultivates and antibody preparation: carry out colonized culture with limiting dilution assay.When Growth of Cells is to when to be paved with at the bottom of hole 1/10, then detect with same method, strong positive hole is cloned, 3-4 time so repeatedly, until positive rate reaches 100% again.By hybridoma enlarged culturing, be injected in through the pretreated Balb/c mouse peritoneal of paraffin oil, every 2 × 10
6individual hybridoma, 7 ~ 10 days mouse web portion protuberances, living body puncture extracts ascites.
Three, monoclonal antibody-purified and qualification
After ascites is first slightly carried with caprylic acid-ammonium, then purify with ProteinGSepharose affinity chromatography; Antibody after purifying measures with indirect elisa method and tires (see table 1) after doubling dilution; Use SDS-PAGE purity assay again, 5% spacer gel, 10% separation gel, 120V voltage, bottom electrophoresis to glue, gel Coomassie Brilliant Blue dyes, Labworks image acquisition and analysis software observations after decolouring.
Table 1. liang strain antibody titer measurement result (OD
450)
The CHARACTERISTICS IDENTIFICATION of embodiment 2. monoclonal antibody 4C9E1G7H3 and 3G2D8H3G9
One, monoclonal antibody subgroup identification
1, antigen coated: with 0.01MPBS bag by goat against murine two anti-igg+A+M, every hole 50 μ l, 4 DEG C of bags are spent the night, and discard liquid in hole next day, wash plate 3 times.
2, close: every hole adds 1%BSA200 μ l, close for 4 DEG C and spend the night.Next day pats dry plank and does not wash plate.
3, monoclonal antibody hybridoma cell supernatant is added, each sample 8 micropores, every hole 50 μ l.37 DEG C, hatch 1h.
4, after washing plate 4 times, the rabbit anti-mouse igg 1, IgG2a, IgG2b, IgG3, IgA, IgM, κ, λ, 37 DEG C adding specific combination respectively hatches 1h.
5, after washing plate 4 times, every hole adds horseradish peroxidase-labeled anti-rabbit two anti-igg (H+L) of having diluted, and 37 DEG C, hatches 30min.
6, after washing plate 4 times, 100 μ l substrate nitrite ions are added, 37 DEG C, lucifuge colour developing 10min.Result is read under 450nm wavelength.
As shown in table 2, H3 belongs to IgG2a subclass, and G9 belongs to IgG1 subclass.
Table 2. liang strain monoclonal antibody subgroup identification result
Two, monoclonal antibody cross reaction test
1, antigen coated: by 96 kind 10
8the pathogenic bacterium of cfu/ml bacterial concentration join in enzyme plate, and each pathogenic bacterium add 3 each holes, and every hole 100 μ l, wraps and spent the night by 4 DEG C.
2, close: after washing plate 3 times, every hole adds 3%BSA200 μ l, hatches 2h for 37 DEG C.
3, plate is washed 3 times.Every hole adds the monoclonal antibody 100 μ l diluted, and hatches 1h for 37 degrees Celsius.
4, plate is washed 3 times.Adding the goat against murine two of having diluted resists in all micropores, and every hole 100 μ l, hatches 1h for 37 degrees Celsius.
5, plate is washed 4 times.Add substrate nitrite ion, 37 DEG C, lucifuge colour developing 15min.Result is read under 450nm wavelength.
Table 3. liang strain monoclonal antibody cross reaction detected result
The preparation of embodiment 3PCR reaction tubes
The concrete method for coating of the PCR reaction tubes for detecting campylobacter jejuni of the present invention is as follows:
1, be buffered liquid dilution anti-campylobacter jejuni monoclonal antibody 4C9E1G7H3 or 3G2D8H3G9 to 1:300 of the present invention doubly with bag, antibody concentration is 10 μ g/mL, by the monoclonal antibody of having diluted often pipe 50uL add in immuno-PCR pipe, 4 DEG C of bag quilts that spend the night;
2, wrapping the formula being buffered liquid (CarbonateCoatingbuffer (1 ×)) is: anhydrous sodium carbonate Na
2cO
31.59g, sodium bicarbonate NaHCO
32.93g, sodiumazide NaN
30.2g, is dissolved in 1000ml distilled water, adjusts pH to 9.6,4 DEG C of preservations.
The preparation of embodiment 4 campylobacter jejuni immuno-PCR detection kit
Prepare campylobacter jejuni immuno-PCR detection kit of the present invention, it contains:
PCR reaction tubes prepared by embodiment 3, loads in valve bag; EP pipe load 10 × PCRBuffer mono-manages, dNTP mono-manages, Taq DNA polymerase one is managed, ddH
2o mono-manages, forward primer one is managed, reverse primer one pipe; Positive control one bottle, negative control one bottle that reagent bottle loads.
10 × PCRBuffer loading amount is 300uL; The concentration of dNTP is 2.5mmol/L, and loading amount is 150uL; Taq DNA polymerase concentration is 5U/L, and loading amount is 60uL; Design of primers is for campylobacter jejuni VS1 gene, and forward primer is gatatgtatgattttatcttg, and concentration is 10umol/L; Loading amount is 150uL; Reverse primer is gaatgaaattttagaatgggg, and concentration is 10umol/L, and loading amount is 150uL, amplified production 358bp.
Positive control is the campylobacter jejuni bacterium liquid of deactivation, and negative control is the brucella broth (Brucellabroth) of sterilizing.
The use flow process of detection kit of the present invention and schematic diagram are see Fig. 1.
Embodiment 5 gradient dilution campylobacter jejuni pure bacterium liquid Direct PCR research experiment (Fig. 2)
Campylobacter jejuni reference culture CICC22937 then by stroke-physiological saline solution successively 10 times of dilutions of successively decreasing, is labeled as 10 after cultivating 18h successively
-1, 10
-2, 10
-3, 10
-4, 10
-5, 10
-6, 10
-7, with 10
-5, 10
-6, 10
-7the bacterium liquid of gradient carries out plate count.The original bacterial concentration of enumeration is 1.67 × 10
9cfu/mL, dilutes original bacteria liquid successively, and bacterial concentration gradient is: 1.67 × 10
8~ 1.78 × 10cfu/mL.The each 5uL of bacterium liquid getting each gradient adds in detection PCR pipe of the present invention, and then add 10 × PCRBuffer5uL in test kit of the present invention, dNTP2uL, forward primer 2uL, reverse primer 2uL, Taq DNA polymerase 1uL, ddH2O supply volume to 50uL.The amplification condition of PCR is 95 DEG C of 5min; 35 circulation (95 DEG C of 15s; 55 DEG C of 30s; 72 DEG C of 1min), 72 DEG C of 5min, 4 DEG C of preservations.The PCR primer of the getting 10uL agarose gel electrophoresis of 1.5% detects target stripe and gel imaging analysis.
As shown in Figure 2, in figure, the visible specific targets band of No. 1-4, swimming lane occurs result of implementation, and clip size is 358bp, and can see that brightness weakens successively.5-8 swimming lane and negative control have no specific band.Experimental result shows, and the sensitivity that campylobacter jejuni pure bacterium liquid Direct PCR detects is 1.67 × 10
5cfu/mL.
This test kit of the pure bacterium liquid of embodiment 6 gradient dilution campylobacter jejuni detects IC-PCR research experiment (Fig. 3)
Get the campylobacter jejuni CICC22937 bacterium liquid (1.67 × 10 of gradient dilution
8~ 1.67 × 10cfu/mL) each 200uL adds in the detection PCR pipe in this test kit, be positioned over 37 DEG C and hatch 2h, then carefully suck bacterium liquid with pipettor, wash three times with PBST, aseptic filter paper is detained dry raffinate, then in PCR pipe, add 10 × PCRBuffer5uL in test kit of the present invention, dNTP2uL, forward primer 2uL, reverse primer 2uL, Taq DNA polymerase 1uL, ddH2O supply volume to 50uL.The amplification condition of PCR is 95 DEG C of 5min; 35 circulation (95 DEG C of 15s; 55 DEG C of 30s; 72 DEG C of 1min), 72 DEG C of 5min, 4 DEG C of preservations.The PCR primer of the getting 10uL agarose gel electrophoresis of 1.5% detects target stripe and gel imaging analysis.
As shown in Figure 3, in figure, the visible specific targets band of No. 1-7, swimming lane occurs result of implementation, and clip size is 358bp, and can see that brightness weakens successively.8 swimming lanes and negative control have no specific band.Experimental result shows, and the sensitivity that campylobacter jejuni immuno-PCR detection kit detects campylobacter jejuni pure bacterium liquid detectability is 1.67 × 10
2cfu/mL.
Embodiment 7 test kits are to campylobacter jejuni and non-campylobacter jejuni cross reaction experiment (Fig. 4)
Strains tested has: campylobacter jejuni CICC22937, ATCC29428, ATCC33291, ATCC33560, CICC6071, streptococcus aureus ATCC27660, Shu Shi salmonella typhi ATCC22956, Salmonella enteritidis ATCC13076, Listeria monocytogenes ATCC43251, yersinia entero-colitica ATCC23715, shigella flexneri ATCC12022, bacillus ceylonensis A ATCC25931, shigella dysenteriae ATCC51329, beta hemolytic streptococcus ATCC10373, Enterobacter sakazakii ATCC29004.Respectively getting strains tested 200ul adds in the detection PCR pipe of this test kit, be positioned over 37 DEG C and hatch 2h, then carefully suck bacterium liquid with pipettor, wash three times with PBST, aseptic filter paper is detained dry raffinate, then in PCR pipe, add 10 × PCRBuffer5uL in test kit of the present invention, dNTP2uL, forward primer 2uL, reverse primer 2uL, Taq DNA polymerase 1uL, ddH2O supply volume to 50uL.The amplification condition of PCR is 95 DEG C of 5min; 35 circulation (95 DEG C of 15s; 55 DEG C of 30s; 72 DEG C of 1min), 72 DEG C of 5min, 4 DEG C of preservations.The PCR primer of the getting 10uL agarose gel electrophoresis of 1.5% detects target stripe and gel imaging analysis.
Result of implementation as shown in Figure 4, only has the swimming lane of campylobacter jejuni to occur object band (358bp) in figure, other 10 strain control strains all do not have object band to occur, illustrate that this test kit has good specificity.
Embodiment 8 gradient dilution simulates the campylobacter jejuni Direct PCR research experiment (Fig. 5, Fig. 6) that carries disease germs
According to GB GB4789.9-2014 " food microbiological analysis campylobacter jejuni ", take food sample 25g (mL), respectively to adding 225mL brucella broth in each sample, homogeneous 2 ~ 3min on slap type homogenizer, as food homogenate, then to the pure bacterium liquid of campylobacter jejuni of homogenate artificial contamination different concns gradient, the food homogenate jejuni bacterial concentration of artificial contamination is followed successively by: 1.67 × 10
8~ 1.67 × 10
2cfu/mL.The each 5uL of food homogenate getting the artificial contamination of different gradient adds in the detection PCR pipe of this test kit, then adds 10 × PCRBuffer5uL in test kit of the present invention, dNTP2uL, forward primer 2uL, reverse primer 2uL, Taq DNA polymerase 1uL, ddH2O supply volume to 50uL.The amplification condition of PCR is 95 DEG C of 5min; 35 circulation (95 DEG C of 15s; 55 DEG C of 30s; 72 DEG C of 1min), 72 DEG C of 5min, 4 DEG C of preservations.The PCR primer of the getting 10uL agarose gel electrophoresis of 1.5% detects target stripe and gel imaging analysis.
Result of implementation, as shown in the A (1) in Fig. 5, Fig. 6, B (1), can find out that from result the carry disease germs sensitivity of campylobacter jejuni Direct PCR of food samples simulation can reach 1.67 × 10
5~ 1.67 × 10
6cfu/mL.
Embodiment 9 campylobacter jejuni immuno-capture PCR test kit sensitivity experiment (Fig. 5, Fig. 6)
According to GB GB4789.9-2014 " food microbiological analysis campylobacter jejuni ", taking food sample 25g (mL) joins in 225mL physiological saline, homogeneous 2 ~ 3min on slap type homogenizer, as food homogenate, then to the pure bacterium liquid of campylobacter jejuni of homogenate artificial contamination different concns gradient, the food homogenate jejuni bacterial concentration of artificial contamination is followed successively by: 1.67 × 10
8~ 1.67 × 10
2cfu/mL.The each 200uL of food homogenate getting the artificial contamination of different gradient adds in the detection PCR pipe of this test kit, be positioned over 37 DEG C and hatch 2h, then carefully suck bacterium liquid with pipettor, wash three times with PBST, aseptic filter paper is detained dry raffinate, then in PCR pipe, add 10 × PCRBuffer5uL in test kit of the present invention, dNTP2uL, forward primer 2uL, reverse primer 2uL, Taq DNA polymerase 1uL, ddH2O supply volume to 50uL.The amplification condition of PCR is 95 DEG C of 5min; 35 circulation (95 DEG C of 15s; 55 DEG C of 30s; 72 DEG C of 1min), 72 DEG C of 5min, 4 DEG C of preservations.The PCR primer of the getting 10uL agarose gel electrophoresis of 1.5% detects target stripe and gel imaging analysis.The results detailed in Fig. 5, Fig. 6.
Result of implementation as shown in the A (2) in Fig. 5, Fig. 6, B (2), as can be seen from result: campylobacter jejuni immuno-PCR detection kit research food samples is simulated the sensitivity of carrying disease germs and can be reached 1.67 × 10
3~ 1.67 × 10
4cfu/mL.
The preservation of biomaterial
Produce and be preserved in (No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC) through the hybridoma cell strain 3G2D8H3G9 of the campylobacter jejuni monoclonal antibody of above-mentioned qualification on January 9th, 2014, Institute of Microorganism, Academia Sinica, postcode: 100101), Classification And Nomenclature is " anti-campylobacter jejuni hybridoma ", and preserving number is CGMCCNo.8766.
Produce and be preserved in (No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC) through the hybridoma cell strain 4C9E1G7H3 of the Vibrio parahemolyticus monoclonal antibody of above-mentioned qualification on November 15th, 2013, Institute of Microorganism, Academia Sinica, postcode: 100101), Classification And Nomenclature is " anti-campylobacter jejuni hybridoma ", and preserving number is CGMCCNo.8457.
The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Sequence table
Claims (6)
1. for detecting a PCR reaction tubes for campylobacter jejuni, it is characterized in that, described PCR reaction tubes comprises:
Immuno-PCR pipe; With
Be coated in the anti-campylobacter jejuni monoclonal antibody of described immuno-PCR pipe inboard wall of tube body, described anti-campylobacter jejuni monoclonal antibody is by mouse hybridoma cell system 4C9E1G7H3, CGMCCNo.8457 or 3G2D8H3G9, CGMCCNo.8766 produce.
2. a detection kit, is characterized in that, described test kit is containing, for example PCR reaction tubes according to claim 1.
3. test kit as claimed in claim 2, is characterized in that, described test kit also containing container a, is equipped with PCR reaction tubes as claimed in claim 1 in described container a.
4. test kit as claimed in claim 2, is characterized in that, described test kit is also containing damping fluid, dNTP, Taq DNA polymerase, ddH
2o, primer, positive control and negative control.
5. test kit as claimed in claim 4, it is characterized in that, described primer comprises forward primer and reverse primer.
6. test kit as claimed in claim 4, it is characterized in that, described positive control is the campylobacter jejuni bacterium liquid of deactivation, and described negative control is the brucella broth of sterilizing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510573624.7A CN105132282B (en) | 2015-09-10 | 2015-09-10 | Campylobacter jejuni immuno-PCR detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510573624.7A CN105132282B (en) | 2015-09-10 | 2015-09-10 | Campylobacter jejuni immuno-PCR detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105132282A true CN105132282A (en) | 2015-12-09 |
| CN105132282B CN105132282B (en) | 2017-06-16 |
Family
ID=54717858
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510573624.7A Active CN105132282B (en) | 2015-09-10 | 2015-09-10 | Campylobacter jejuni immuno-PCR detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105132282B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112080571A (en) * | 2020-09-22 | 2020-12-15 | 扬州大学 | Campylobacter jejuni detection kit and method based on CRISPR-Cas12b system |
| CN116640830A (en) * | 2023-05-04 | 2023-08-25 | 河北国高生物科技有限公司 | immuno-PCR working solution and preparation method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1598544A (en) * | 2004-08-13 | 2005-03-23 | 汕头大学 | Method for detecting jejunum arcuation bacterial |
| US20070238138A1 (en) * | 2006-04-11 | 2007-10-11 | Royds Robert B | Consumer food testing device |
| CN101362801A (en) * | 2008-05-26 | 2009-02-11 | 北京庄笛浩禾生物医学科技有限公司 | Rapid detection test strip for detecting campylobacter jejuni specific antigen |
| CN103820549A (en) * | 2014-02-25 | 2014-05-28 | 上海理工大学 | Salmonella choleraesuis immune PCR detection kit |
-
2015
- 2015-09-10 CN CN201510573624.7A patent/CN105132282B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1598544A (en) * | 2004-08-13 | 2005-03-23 | 汕头大学 | Method for detecting jejunum arcuation bacterial |
| US20070238138A1 (en) * | 2006-04-11 | 2007-10-11 | Royds Robert B | Consumer food testing device |
| CN101362801A (en) * | 2008-05-26 | 2009-02-11 | 北京庄笛浩禾生物医学科技有限公司 | Rapid detection test strip for detecting campylobacter jejuni specific antigen |
| CN103820549A (en) * | 2014-02-25 | 2014-05-28 | 上海理工大学 | Salmonella choleraesuis immune PCR detection kit |
Non-Patent Citations (1)
| Title |
|---|
| 欧瑜 等: "空肠弯曲菌表面蛋白特异性多表位抗原的设计、表达与鉴定", 《药物生物技术》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112080571A (en) * | 2020-09-22 | 2020-12-15 | 扬州大学 | Campylobacter jejuni detection kit and method based on CRISPR-Cas12b system |
| CN112080571B (en) * | 2020-09-22 | 2022-11-11 | 扬州大学 | Campylobacter jejuni detection kit and method based on CRISPR-Cas12b system |
| CN116640830A (en) * | 2023-05-04 | 2023-08-25 | 河北国高生物科技有限公司 | immuno-PCR working solution and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105132282B (en) | 2017-06-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104316690B (en) | Vibrio parahemolyticus immune colloid gold Rapid detection test strip | |
| CN104360065B (en) | Vibrio parahemolyticus enzyme-linked immunologic detecting kit | |
| CN103792361B (en) | Enzyme-linked immunosorbent assay kit of enterohemorrhagic E.col O157:H7 | |
| CN105132282A (en) | Campylobacter jejuni immune PCR detection kit | |
| CN103820549B (en) | Salmonella choleraesuis immune PCR detection kit | |
| CN103823062B (en) | Salmonella choleraesuls enzyme-linked immunologic detecting kit | |
| CN103940995B (en) | Listeria monocytogenes enzyme-linked immunologic detecting kit | |
| CN103837684A (en) | Antibody reagent for rapidly detecting salmonellas and detection method thereof | |
| CN103937898B (en) | Listeria monocytogenes immuno-PCR detection kit | |
| CN103792362B (en) | Enterohemorrhagic Escherichia coli O 157: H7 immune colloid gold Rapid detection test strip | |
| CN103823060B (en) | Enterohemorrhagic Escherichia coli O 157: H7 immuno-PCR detection kit | |
| CN105223362B (en) | Campylobacter jejuni enzyme-linked immunologic detecting kit | |
| CN103866033B (en) | Staphylococcus aureus immune PCR (polymerase chain reaction) detection kit | |
| CN103941011B (en) | Detect method and the monoclonal antibody thereof of listeria monocytogenes | |
| CN103777017B (en) | Detect method and the monoclonal antibody thereof of enterohemorrhagic Escherichia coli O 157: H7 | |
| CN104360066B (en) | Detect method and the monoclonal antibody thereof of vibrio parahemolyticus | |
| CN103941012B (en) | Listeria immune colloid gold Rapid detection test strip | |
| CN105137075B (en) | Campylobacter jejuni immune colloid gold Rapid detection test strip | |
| CN105223363B (en) | The method of detection campylobacter jejuni and monoclonal antibody thereof | |
| CN103823063B (en) | Detect method and the monoclonal antibody thereof of Salmonella choleraesuls | |
| Guttikonda et al. | Monospecific and bispecific antibodies against E. coli O157 for diagnostics | |
| CN104357565A (en) | Immune PCR kit for detecting bibrio parahemolyticus | |
| CN103941006B (en) | Salmonella choleraesuls immune colloid gold Rapid detection test strip | |
| CN205038219U (en) | Quick test paper strip of crooked bacterial immunity colloidal gold of jejunum | |
| CN103869074B (en) | Enzyme-linked immunoassay kit for staphylococcus aureus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant |