CN105087823A - Gene chip for quickly detecting oil extraction functional bacteria in medium and low temperature oil pool and application of gene chip - Google Patents
Gene chip for quickly detecting oil extraction functional bacteria in medium and low temperature oil pool and application of gene chip Download PDFInfo
- Publication number
- CN105087823A CN105087823A CN201510645694.9A CN201510645694A CN105087823A CN 105087823 A CN105087823 A CN 105087823A CN 201510645694 A CN201510645694 A CN 201510645694A CN 105087823 A CN105087823 A CN 105087823A
- Authority
- CN
- China
- Prior art keywords
- probe
- seqidno
- gene
- sequence
- probe sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 75
- 241000894006 Bacteria Species 0.000 title claims abstract description 41
- 238000000605 extraction Methods 0.000 title abstract description 9
- 239000000523 sample Substances 0.000 claims abstract description 165
- 239000004215 Carbon black (E152) Substances 0.000 claims abstract description 21
- 229930195733 hydrocarbon Natural products 0.000 claims abstract description 21
- 150000002430 hydrocarbons Chemical class 0.000 claims abstract description 21
- 230000003647 oxidation Effects 0.000 claims abstract description 14
- 238000007254 oxidation reaction Methods 0.000 claims abstract description 14
- QAOWNCQODCNURD-UHFFFAOYSA-L Sulfate Chemical compound [O-]S([O-])(=O)=O QAOWNCQODCNURD-UHFFFAOYSA-L 0.000 claims abstract description 12
- 230000009467 reduction Effects 0.000 claims abstract description 5
- 238000009826 distribution Methods 0.000 claims abstract description 4
- 238000001514 detection method Methods 0.000 claims description 34
- 238000011084 recovery Methods 0.000 claims description 23
- 240000004808 Saccharomyces cerevisiae Species 0.000 claims description 16
- 230000003321 amplification Effects 0.000 claims description 16
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 12
- 241000589291 Acinetobacter Species 0.000 claims description 9
- 241000193830 Bacillus <bacterium> Species 0.000 claims description 9
- 241000206589 Marinobacter Species 0.000 claims description 9
- 241000190932 Rhodopseudomonas Species 0.000 claims description 9
- 238000013461 design Methods 0.000 claims description 8
- 239000011159 matrix material Substances 0.000 claims description 8
- 229910021653 sulphate ion Inorganic materials 0.000 claims description 8
- 241000588807 Bordetella Species 0.000 claims description 7
- 241001453380 Burkholderia Species 0.000 claims description 7
- 238000003908 quality control method Methods 0.000 claims description 7
- 241000194103 Bacillus pumilus Species 0.000 claims description 6
- 241000589513 Burkholderia cepacia Species 0.000 claims description 6
- 241000589755 Pseudomonas mendocina Species 0.000 claims description 6
- 241000607142 Salmonella Species 0.000 claims description 6
- 239000004577 thatch Substances 0.000 claims description 6
- 241000588624 Acinetobacter calcoaceticus Species 0.000 claims description 5
- 241000122230 Acinetobacter junii Species 0.000 claims description 5
- 241001135518 Acinetobacter lwoffii Species 0.000 claims description 5
- 241000193755 Bacillus cereus Species 0.000 claims description 5
- 241000194108 Bacillus licheniformis Species 0.000 claims description 5
- 241000589518 Comamonas testosteroni Species 0.000 claims description 5
- 241000589517 Pseudomonas aeruginosa Species 0.000 claims description 5
- 241000589540 Pseudomonas fluorescens Species 0.000 claims description 5
- 241000589776 Pseudomonas putida Species 0.000 claims description 5
- 125000003368 amide group Chemical group 0.000 claims description 5
- 230000001580 bacterial effect Effects 0.000 claims description 5
- 101150044508 key gene Proteins 0.000 claims description 5
- 241000233866 Fungi Species 0.000 claims description 4
- 230000015556 catabolic process Effects 0.000 claims description 4
- 238000006731 degradation reaction Methods 0.000 claims description 4
- 101150116515 dsrB gene Proteins 0.000 claims description 4
- 238000002360 preparation method Methods 0.000 claims description 4
- 241000894007 species Species 0.000 claims description 4
- 230000015572 biosynthetic process Effects 0.000 claims description 3
- 230000007613 environmental effect Effects 0.000 claims description 3
- 125000002485 formyl group Chemical class [H]C(*)=O 0.000 claims description 3
- 230000004807 localization Effects 0.000 claims description 3
- 230000004048 modification Effects 0.000 claims description 3
- 238000012986 modification Methods 0.000 claims description 3
- 238000012163 sequencing technique Methods 0.000 claims description 3
- 239000013589 supplement Substances 0.000 claims description 3
- 238000003786 synthesis reaction Methods 0.000 claims description 3
- 108700001094 Plant Genes Proteins 0.000 claims description 2
- 241000511553 bacterium IN6 Species 0.000 claims description 2
- 230000001590 oxidative effect Effects 0.000 claims description 2
- 239000007790 solid phase Substances 0.000 claims description 2
- 101100278592 Desulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / NCIMB 8303 / VKM B-1760 / Hildenborough) dsvB gene Proteins 0.000 claims 3
- 101000836620 Homo sapiens Nucleic acid dioxygenase ALKBH1 Proteins 0.000 claims 3
- 102100027051 Nucleic acid dioxygenase ALKBH1 Human genes 0.000 claims 2
- 108010081498 Cytochrome P-450 CYP4A Proteins 0.000 claims 1
- 230000008859 change Effects 0.000 abstract description 20
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 abstract description 11
- 230000000694 effects Effects 0.000 abstract description 4
- 238000002474 experimental method Methods 0.000 abstract description 4
- 108091028043 Nucleic acid sequence Proteins 0.000 abstract description 2
- 108020004465 16S ribosomal RNA Proteins 0.000 abstract 1
- 239000000463 material Substances 0.000 abstract 1
- 238000011895 specific detection Methods 0.000 abstract 1
- 238000009396 hybridization Methods 0.000 description 28
- 239000012634 fragment Substances 0.000 description 23
- 239000006210 lotion Substances 0.000 description 21
- 238000000034 method Methods 0.000 description 20
- 238000005406 washing Methods 0.000 description 18
- 244000005700 microbiome Species 0.000 description 16
- 239000000047 product Substances 0.000 description 12
- IAZDPXIOMUYVGZ-UHFFFAOYSA-N Dimethylsulphoxide Chemical compound CS(C)=O IAZDPXIOMUYVGZ-UHFFFAOYSA-N 0.000 description 10
- 239000000243 solution Substances 0.000 description 10
- 238000012408 PCR amplification Methods 0.000 description 9
- 238000000137 annealing Methods 0.000 description 9
- 238000004925 denaturation Methods 0.000 description 9
- 230000036425 denaturation Effects 0.000 description 9
- 238000002347 injection Methods 0.000 description 7
- 239000007924 injection Substances 0.000 description 7
- 230000008569 process Effects 0.000 description 7
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 6
- 108020004414 DNA Proteins 0.000 description 5
- 238000010586 diagram Methods 0.000 description 5
- 238000005516 engineering process Methods 0.000 description 5
- 238000004519 manufacturing process Methods 0.000 description 5
- 238000006243 chemical reaction Methods 0.000 description 4
- 230000000813 microbial effect Effects 0.000 description 4
- 239000000843 powder Substances 0.000 description 4
- 235000020681 well water Nutrition 0.000 description 4
- 238000001035 drying Methods 0.000 description 3
- 239000011521 glass Substances 0.000 description 3
- 238000002372 labelling Methods 0.000 description 3
- VNWKTOKETHGBQD-UHFFFAOYSA-N methane Chemical compound C VNWKTOKETHGBQD-UHFFFAOYSA-N 0.000 description 3
- 238000000746 purification Methods 0.000 description 3
- 238000007789 sealing Methods 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 239000002349 well water Substances 0.000 description 3
- 230000004544 DNA amplification Effects 0.000 description 2
- 238000000018 DNA microarray Methods 0.000 description 2
- 241000589516 Pseudomonas Species 0.000 description 2
- 239000002253 acid Substances 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 230000005284 excitation Effects 0.000 description 2
- 239000007850 fluorescent dye Substances 0.000 description 2
- 239000003129 oil well Substances 0.000 description 2
- 239000003208 petroleum Substances 0.000 description 2
- 238000003753 real-time PCR Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 241000972773 Aulopiformes Species 0.000 description 1
- 241000196324 Embryophyta Species 0.000 description 1
- 108010064696 N,O-diacetylmuramidase Proteins 0.000 description 1
- 229910002651 NO3 Inorganic materials 0.000 description 1
- NHNBFGGVMKEFGY-UHFFFAOYSA-N Nitrate Chemical compound [O-][N+]([O-])=O NHNBFGGVMKEFGY-UHFFFAOYSA-N 0.000 description 1
- 238000011529 RT qPCR Methods 0.000 description 1
- 102100036049 T-complex protein 1 subunit gamma Human genes 0.000 description 1
- 230000009471 action Effects 0.000 description 1
- 230000004913 activation Effects 0.000 description 1
- 101150075999 alkB gene Proteins 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000008901 benefit Effects 0.000 description 1
- 239000003876 biosurfactant Substances 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 101150062912 cct3 gene Proteins 0.000 description 1
- 238000004140 cleaning Methods 0.000 description 1
- 108091036078 conserved sequence Proteins 0.000 description 1
- 238000005260 corrosion Methods 0.000 description 1
- 230000007797 corrosion Effects 0.000 description 1
- 238000003935 denaturing gradient gel electrophoresis Methods 0.000 description 1
- 229960001760 dimethyl sulfoxide Drugs 0.000 description 1
- 239000012153 distilled water Substances 0.000 description 1
- 239000003995 emulsifying agent Substances 0.000 description 1
- 230000005966 endogenous activation Effects 0.000 description 1
- 239000004744 fabric Substances 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 238000011068 loading method Methods 0.000 description 1
- 239000012139 lysis buffer Substances 0.000 description 1
- 230000007246 mechanism Effects 0.000 description 1
- -1 methane amide Chemical class 0.000 description 1
- 239000012452 mother liquor Substances 0.000 description 1
- 239000003345 natural gas Substances 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 239000008041 oiling agent Substances 0.000 description 1
- 238000005067 remediation Methods 0.000 description 1
- 235000019515 salmon Nutrition 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 230000035945 sensitivity Effects 0.000 description 1
- 239000009671 shengli Substances 0.000 description 1
- 239000000725 suspension Substances 0.000 description 1
- 239000002699 waste material Substances 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a gene chip for quickly detecting oil extraction functional bacteria in a medium and low temperature oil pool and application of the gene chip, and relates to the gene chip for quickly detecting oil extraction functional bacteria in the medium and low temperature oil pool and the application of the gene chip. The gene chip includes 16 bacteria-targeted 16S rDNA probes, 42 ITS probes and 13 functional gene-targeted probes; the probes can be used for carrying out specific detection on six types of medium and low temperature oil pool oil extraction functional bacteria, 15 types of oil extraction functional bacteria and 2 functional genes; the chip can quickly detect the distribution and change rules of the hydrocarbon oxidation functional bacteria and functional genes for hydrocarbon oxidation and sulfate reduction during the oil extraction process and in environment samples; an applicable sample is an oil development water material which is predicted to contain target DNA sequences. According to the invention, a quick and simple tool for detecting oil pool oil extraction functional bacteria is provided; in addition, technical support is provided for detecting the field experiment effect.
Description
Technical field
The present invention relates to low-temperature reservoir oil recovery function yeast gene chip and uses thereof in a kind of rapid detection, belong to gene chip field and resource environment microbial technology field.
Background technology
Along with Microbial Enhanced Oil Recovery is in the widespread use in the field such as petroleum natural gas exploration and environment remediation, the Testing and appraisal of related microorganisms and colony assay also become important research contents.The conventional molecular ecology method of current oil field microorganism detection has methods such as building clone library, denaturing gradient gel electrophoresis (DGGE), Real-time quantitative PCR.
(1) realtime quantitative inspection
Real-time fluorescence quantitative PCR (real-timefluorescentquantitativepolymerasechainreaction), be add fluorescence dye or fluorescent probe in Standard PCR reaction process, utilize the quantity of specific dna sequence in the change instruction template of fluorescence in PCR process.Real-time fluorescence quantitative PCR reproducible, sensitivity and specificity are also higher, and whole process is consuming time short, from extraction template to interpretation of result, only need 8 hours, and shortcoming is that to detect DNA kind more single.
(2) Clone library analysis
Clone library is by pcr amplification gene order, to be connected and competent cell transforms by gene with carrier, and making gene monoclonal library, then carries out the method for diversity analysis to gene order in library.The method cost is lower, can reflect the polymorphism of group to a certain extent, but detect consuming time, complex operation.
Often complicated operation when above-mentioned molecular ecology method is applied to oil reservoir a large amount of testing, wastes time and energy, is unfavorable for detecting quickly oil reservoir field sample.By contrast, biochip technology has high-throughput, rapid detection, flexibility ratio high, by biochip technology, set up oil field microorganism detection novel method, contribute to microorganisms Changing Pattern and oil pool microorganisms activate between relation, disclose oil recovery function yeast directed activation mechanism, the application for endogenous activation technique provides the theoretical basis of system.
Reservoir endogenous micro-organisms divides by function, mainly comprise hydrocarbon oxidation bacteria, aerobic saprophytic microorganism, anaerobically fermenting bacterium, nitrate reduction bacterium, sulphate reducing bacteria and methanogen etc.Wherein hydrocarbon oxidation bacteria is a ubiquitous class bacterium in reservoir media, is also that microorganism improves very important function yeast in petroleum recovering rate technology, in external source microbe oil production or endogenous microbes recover the oil, all plays keying action.On the contrary, sulphate reducing bacteria can corrosion pipeline, and affecting production safety is need the strict harmful bacteria suppressed in microbe oil production.According to report, the key gene that two quasi-microorganisms play a role is hydrocarbon oxidation fungi degradation hydrocarbon key gene alkB (alkanehydroxylaseB) and sulphate reducing bacteria key function gene dsrB (dissimilatorysulfitereductaseB).The bacterial population that Shengli Oil Field has been developed for higher temperature reservoirs for oil reservoir water body genome 16SrDNA sequence at present detects gene chip, this chip comprises sample and to check order 429 16SrDNA probes that 109 bacteriums detecting belong to, wide coverage, but it is not for higher temperature reservoirs, and strong to the specific aim of functional microorganism.
Summary of the invention
The object of the invention is to provide low-temperature reservoir oil recovery function yeast rapid detection gene chip and using method thereof in one, when making up the operational cost of mentioned microorganism ecotechnology and the existence of existing oil pool microorganisms detection chip, easy not, the shortcoming that specific aim is not strong, chip relates to middle low-temperature reservoir functional microorganism detection probes simultaneously, fill up the blank in this field, functional gene probe in addition on chip makes chip can not only be used for hydrocarbon oxidative function bacterium in rapid detection oil recovery process and environmental sample, can also reflect that hydrocarbon is oxidized, the distribution of sulfate reduction functional gene and Changing Pattern.Apply this chip and can indicate in oil reservoir whether there is common functional microorganism, the major microorganisms structure of preliminary understanding target reservoir, the more important thing is and can the effect of Microbial Enhanced Oil Recovery be used to evaluate to oil well further, for microbial technique research level and field conduct effect improve supplying method basis.
Technical scheme of the present invention is as follows:
Middle low-temperature reservoir oil recovery function yeast rapid detection gene chip, this gene chip is fixed with three class probes on solid phase carrier: the 16SrDNA probe belonged to for low-temperature reservoir oil recovery function bacterium in 6 kinds; For the ITS probe of low-temperature reservoir oil recovery function bacterium kind in 15 kinds; For the probe of 2 kinds of functional genes; The sequence of above probe is as following table 1-table 2:
Table 116SrDNA probe and functional gene alkB and dsrB probe
Table 2ITS probe
The preparation method of above-mentioned middle low-temperature reservoir oil recovery function yeast rapid detection gene chip, comprises the following steps:
1st step, design function bacterium and functional gene specific probe
Detecting the 16SrDNA sequence belonged to derives from from RDPRelase11 database (http://rdp.cme.msu.edu/hierarchy/hb_intro.jsp); Detect the ITS sequence of planting and derive from NCBIGenome database (http://www.ncbi.nlm.nih.gov/genome/? term=), use ITS universal primer to carry out amplification order-checking to detection kind and sibling species ITS gene thereof, sequencing result is sequence as a supplement simultaneously; Functional gene alkB and dsrB sequence derive from Fungene database (http://fungene.cme.msu.edu/).According to collecting sequence, design the genus specific probe group for goal gene, plant specific probe and functional gene specific probe, probe sequence is as shown in SEQIDNO.1-71.Probe for 16SrDNA becomes probe groups with the patten's design of logical "and", and group internal probe integrally improves the specificity of detection.
2nd step, synthesis specific probe
The general structure of probe: NH
2-poly (T)-probe sequence of barcodes, NH
2represent that probe 5 ' is held through amido modified, poly (T)-probe sequence of barcodes length is 40nt; According to the general structure synthesising probing needle of probe;
3rd step, prepare gene chip:
Use BioDotAD5000 chip point sample instrument to be fixed on the slide of aldehyde radicalization modification with the matrix of setting by probe, UV-crosslinked 12 hours, the chip prepared kept in Dark Place; Wherein, often open and chip comprises 8 identical chip matrixes.Chip matrix is by totally 71 probes for 6 bacteriums genus, 15 bacterium kinds and 2 functional genes, and the array that negative Quality Control probe NC and positive quality control probe PC forms and fluorescence localization probe FP form, and each probe arranges three repetitions.
NC is one section of amido modified few core former times acid probe, can not hybridize, can indicate the reliability of chip quality, avoid false positive with the sequence all to be detected in hybridization solution; PC is one section of amido modified few core former times acid probe, can hybridize, for the Quality Control of crossover process, avoid false negative with the conserved sequence in fluorescently-labeled object fragment; FP is the NC probe that 3 ' end is modified through Cy3, can ultraviolet excited fluorescence, is used for position probe position in a matrix;
NC sequence is NH
2-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT;
PC sequence is NH
2-TTTTTTTTTTTTTTTTTGTACACACCGCCCGTCACACCAT.
Invention also provides the using method of above-mentioned middle low-temperature reservoir oil recovery function yeast rapid detection gene chip, comprise the following steps:
1st step, object fragment amplification
Different according to detection target, with sample gene group DNA for template, select the object fragment that different universal primers increases different.
When the 1.1st step, measuring ability Pseudomonas, 16SrDNA full-length gene is divided into fragment 1 (about 800bp) and fragment 2 (about 700bp) two part amplifications, carries out pcr amplification respectively with universal primer 27f/802r and 783f/1492r;
Primer 2 7f sequence is 5 '-AGAGTTTGATCTGGCTCAG-3 ';
Primer 802r sequence is 5 '-GACTACCAGGGTATCTAATCC-3 ';
Primer 783f sequence is 5 '-GGATTAGATACCCTGGTAGTCCA-3 ';
Primer 1492r sequence is 5 '-TACGGCTACCTTGTTACGACTT-3 ';
PCR program is 95 DEG C of denaturations 5 minutes, 94 DEG C of sex change 30 seconds, 55 DEG C of annealing 30 seconds, and 72 DEG C extend 1 minute, sex change to extending circulation 35 times, extension 10 minutes after 72 DEG C; PCR system is as following table 3;
Table 316SrDNA goal gene fragment 1 and fragment 2 amplification system
When the 1.2nd step, measuring ability bacterial classification, ITS fragment uses universal primer 783f/5794r to carry out pcr amplification;
Primer 783f sequence is 5 '-GGATTAGATACCCTGGTAGTCCA-3 ';
Primer 5794r sequence is 5 '-GGTACTTAGATGTTTCAGTTC-3 ';
PCR program is 95 DEG C of denaturations 5 minutes, 94 DEG C of sex change 45 seconds, 50 DEG C of annealing 45 seconds, and 72 DEG C extend 90 seconds, sex change to extending circulation 32 times, extension 10 minutes after 72 DEG C; PCR system is as following table 4;
Table 4ITS goal gene amplification system
When the 1.3rd step, measuring ability gene, functional gene dsrB and alkB carries out pcr amplification with primer dsr1f/dsr4r and alkwf/alkwr respectively;
Primer dsr1f sequence is 5 '-ACSCACTGGAAGCACG-3 ';
Primer dsr4r sequence is 5 '-GTGTAGCAGTTACCGCA-3 ';
Primer alkwf sequence is 5 '-AAYACNGCNCAYGARCTNGGNCAYAA-3 ';
Primer alkwr sequence is 5 '-GCRTGRTGRTCNGARTGNCGYTG-3 ';
Increase PCR program of dsrB is 95 DEG C of denaturations 5 minutes, 94 DEG C of sex change 45 seconds, 55 DEG C of annealing 60 seconds, and 72 DEG C extend 2 minutes, sex change to extending circulation 30 times, extension 10 minutes after 72 DEG C; Increase PCR program of alkB is 95 DEG C of denaturations 5 minutes, 94 DEG C of sex change 30 seconds, 55 DEG C of annealing 50 seconds, and 72 DEG C extend 40 seconds, sex change to extending circulation 30 times, extension 10 minutes after 72 DEG C; PCR system is as following table 5;
Table 5 functional gene dsrB and alkB amplification system
2nd step, PCR primer mark
Pcr amplification pillar purification kit carries out purifying; Labeling process utilizes respective downstream primer to carry out single stranded amplification, mixes Cy3-UTP in system, and increasing the strand obtained can at fluorescence excitation under ultraviolet; The mark program of each target fragment, with the amplification program of target fragment, marks the following table 6 of system;
Table 6 goal gene mark system
3rd step, gene chip hybridization
Marked product 60 DEG C of oven for drying, use hybridization solution back dissolving under lucifuge condition, when detecting 16SrDNA by the marked product back dissolving of fragment 1 and fragment 2 to together with; Back dissolving product point sample, to chip hybridization district, is placed in hybridization storehouse sealing 42 DEG C of reactions 16 hours; After hybridization terminates, in elutriant, carry out wash-out by the order of washing lotion A1.5 minute-washing lotion B1.5 minute-washing lotion C1 minute;
Lotion prescription is as follows:
Washing lotion A:1 × SSC, 10%SDS; Washing lotion B:0.05 × SSC; Washing lotion C:95% ethanol;
After wash-out, chip dried or dry up.
4th step, chip scanning
Use chip scanner scanning chip, use preliminary scan and data scanning to obtain signal, whether there is microorganism to be checked according in fluorescent signal analytic sample.
Gene chip provided by the invention, can be used for distribution and the Changing Pattern of the functional gene such as hydrocarbon oxidation bacteria and hydrocarbon oxidation, sulfate reduction in rapid detection oil recovery process and environmental sample.
The sensing range of the gene chip related in the present invention, except comprising with oil recovery process except closely-related function yeast, is also designed with functional gene probe, is more suitable for the microorganism detection needs of Oil Field experiment.In addition, a large amount of experiments proves, oil recovery function yeast common in middle low-temperature reservoir comprises pseudomonas, genus bacillus, extra large bacillus etc., there is larger difference with high-temperature oil reservoir oil recovery function yeast kind, detects so this chip is more suitable for middle low-temperature reservoir function yeast.
Advantage of the present invention and beneficial effect are:
(1) high specificity: only have the sequence be combined with probe specificity to show fluorescence;
(2) highly sensitive: the To Template DNA that can detect 0.01ng/ μ L, highly sensitive;
(3) be suitable for complex samples to detect: the present invention is directed to low-temperature reservoir design in Xinjiang, be applicable to the sample gene group obtained in natural or simulating oil deposit;
(4) batch sample detects: point has made multiple probe region on individual chip of the present invention, and the integrated some specific probe of different detection level in each district, can detect the different indexs in batch sample and sample simultaneously.
Accompanying drawing explanation
Accompanying drawing 1 is chip probe matrix schematic diagram of the present invention in embodiment 1;
Accompanying drawing 2 is 16SrDNA probe positive findings schematic diagram in embodiment 2; In figure, A-F is respectively acinetobacter, bacillus, Burkholderia, enlightening thatch Bordetella, marinobacter, Rhodopseudomonas positive hybridization result;
Accompanying drawing 3 is ITS probe positive findings schematic diagram in embodiment 2; In figure, A-O is respectively acinetobacter calcoaceticus, Acinetobacter junii, acinetobacter lwoffii, Bacillus cereus, Bacillus licheniformis, bacillus pumilus, subtilis, Burkholderia cepacia, Comamonas testosteroni, Hai Dici Salmonella, Pseudomonas aeruginosa, Pseudomonas fluorescens, pseudomonas mendocina, pseudomonas putida and germ oligotrophy unit cell positive hybridization result;
Accompanying drawing 4 is functional gene positive findings schematic diagram in embodiment 2; In figure, A figure is dsrB gene; It is alkB gene that B schemes-D figure;
Accompanying drawing 5 is oil reservoir water sample detection result schematic diagrams in embodiment 3; In figure, A-C is actual reservoir sample results of hybridization, and A is district's water injection well in six, B be producing well T6180, C is seven West water injection wells.
Embodiment
Below in conjunction with specific embodiment, the present invention is described, should be understood that these embodiments are only for illustration of the present invention, and be not used in the restriction scope of application of the present invention, following experimental technique, if no special instructions, is ordinary method.
The preparation of embodiment 1, middle low-temperature reservoir oil recovery function yeast rapid detection gene chip
1, the determination of sensing range
According to middle low-temperature reservoir common hydrocarbon oxidation bacteria kind, determine that on chip, six detection genus are: acinetobacter, bacillus, Burkholderia, enlightening thatch Bordetella, marinobacter and Rhodopseudomonas;
With reference to common point of fabric of reservoir media hydrocarbon oxidation bacteria, determine that the sensing range of 15 function bacterial classifications on chip is: acinetobacter calcoaceticus, Acinetobacter junii, acinetobacter lwoffii, Bacillus cereus, Bacillus licheniformis, bacillus pumilus, subtilis, Burkholderia cepacia, Comamonas testosteroni, Hai Dici Salmonella, Pseudomonas aeruginosa, Pseudomonas fluorescens, pseudomonas mendocina, pseudomonas putida and germ oligotrophy unit cell;
Hydrocarbon oxidation bacteria is extremely important function yeast in reservoir media, can produce the multiple bio-surfactant for recovering the oil and emulsifying agent.Sulphate reducing bacteria needs the strict harmful bacteria suppressed in microbe oil production.Determine that on chip, functional gene sensing range comprises two genes accordingly: hydrocarbon oxidation fungi degradation hydrocarbon key gene alkB and sulphate reducing bacteria key function gene dsrB.
2, the design of probe
From RDPRelase11 database (http://rdp.cme.msu.edu/hierarchy/hb_intro.jsp), download 16SrDNA type strain sequence (length >1200bp), comprise acinetobacter 22, bacillus 181, Burkholderia 58, enlightening thatch Bordetella 11, marinobacter 26, Rhodopseudomonas 126; Detect for each and belong to design one group of probe, each probe in group is all conservative in belonging to, verified the specificity of these probes by NCBIBlast simultaneously, then these probes are combined in the mode of logical "and" and integrally judge whether a certain detection genus exists, and finally obtains probe SEQIDNO.1-SEQIDNO.16;
Table 716SrDNA probe totally 16
| SEQ ID NO. | 5 '------probe sequence------3 ' |
| 1 | GCTTAACTTG GGAATTGCAT TCGAT |
| 2 | CCGTTGGGGC CTTTGAGGCT TTAGT |
| 3 | CGCTTACCAC GGTGTGGCCG ATGAC |
| 4 | GTAAAGCTCTGTTGTTAGGGAAGAA |
| 5 | TTGACGGTAC CTAACCAGAA AGCCA |
| 6 | TCACACCACG AGAGTTTGCA ACACC |
| 7 | AAGCACTTTT GTCCGGAAAG AAATC |
| 8 | AAGGAGGACG GTCACCACGG TAGGA |
| 9 | CTAGGCTTGA CATATACAGG ACGAC |
| 10 | ATATACAGGA CAGCGGCAGA GATGT |
| 11 | ATGTCGTTTC CCTTGTGGCT TGTAT |
| 12 | TAAGCGAGAT GTGAAAGCCC CGGGC |
| 13 | AACCTGGGAA CGGCATTTCG AACTG |
| 14 | AAGCACTTTA AGTTGGGAGG AAGGG |
| 15 | CTCAACCTGG GAACTGCATC CAAAA |
| 16 | CCCTTGTCCT TAGTTACCAG CACGT |
From NCBIGenome database (http://www.ncbi.nlm.nih.gov/genome/? term=) all ITS sequence that detection is planted and sibling species is relevant are downloaded, use ITS universal primer to carry out amplification order-checking to bacillus pumilus, Burkholderia cepacia, Hai Dici Salmonella and pseudomonas mendocina detection kind and sibling species ITS gene thereof simultaneously, sequencing result is sequence as a supplement, with BioEdit7.1.7, reverse complemental arrangement is carried out to sequence, then with online tool tRNAscan-SE1.21, region sequence between ITS is classified; Detect for each and plant, designing probe in the conserved regions of dissimilar ITS sequence, by the clustal comparison of different strain same kind ITS, screening specific probe, finally obtains probe SEQIDNO.17-SEQIDNO.58;
Table 8ITS probe totally 42
| SEQ ID NO. | 5 '------probe sequence------3 ' |
| 17 | CACGGTATTA AGCATGACCT GACGA |
| 18 | TATTAAGCAT GACCTGACGA AGGCA |
| 19 | GCAACGCTTT GTCCGAGAAT TTAAG |
| 20 | GTCCGAGAAT TTAAGCAAAC AGCTA |
| 21 | CGCAGGCACA CATAGAACGA AGCTT |
| 22 | GATTTATCAC AGTTTCCTGA CCTG |
| 23 | ATCACAGTTT CCTGACCTGA CGAAG |
| 24 | CTGCTCATCA ATATAAGTTT CCGTG |
| 25 | TAAATCCTGC AATTTGTATG GGCCT |
| 26 | AGTTTCCGTG TTTCGTTTTG TTCAG |
| 27 | CTTGCGGTCT TATAGACAGG TGCGT |
| 28 | TCTTATAGAC AGGTGCGTTT GGATC |
| 29 | GACAGGTGCG TTTGGATCTT GTTT |
| 30 | GGAACTTGCA AAAGATCCTA CAACA |
| 31 | GAATGCAATG CAAAGTTCAT CACAC |
| 32 | GCAATGCAAA GTTCATCACA CATAG |
| 33 | GGGTCTTATA AACAGAACGT TCCCT |
| 34 | CAGAACGTTC CCTGTCTTGT TTAGT |
| 35 | GAACGTTCCC TGTCTTGTTT AGTTT |
| 36 | ATCACCTCCT TTCCAGAGCT TCTCG |
| 37 | GTAATTTGGA TAGCGGAAGC GTCTT |
| 38 | ATAGCGGAAG CGTCTTGAGA TGGAC |
| 39 | ATTCACATTA CGGCATAACG CGTGA |
| 40 | CATAACGCGT GAGGTGCAAG ACCTC |
| 41 | AGGTGCAAGA CCTCACCAGT CTTTG |
| 42 | CCACTCAGGC CTACCACTTC TCATG |
| 43 | TATTGGCGAC AGTATGCTGC GAAGT |
| 44 | CATGATGGCT GAAATTTGTC CCTCC |
| 45 | GATTCACTGG TTAGACGATT GGGTC |
| 46 | CAATTGTTGG TGTGCTGCGT GATCC |
| 47 | TTGGTGTGCT GCGTGATCCG ATACG |
| 48 | GAAGCAGCCC GAAATTGGGT CTGTA |
| 49 | TTGTGTGGGA AACGCCTGTA GAAAT |
| 50 | AACGCCTGTA GAAATACGGG GCCAT |
| 51 | AATTGCTTGG TGCAGAAGAT TACGG |
| 52 | GCCTGGTGAG TGCTGATTTC TGGTC |
| 53 | GCAAAATTTG TAGTTCTCAA GACGC |
| 54 | GACGACATCA GCCTGCTGAT GAGCT |
| 55 | AATTTGTGAG TTCTGCTCGA AAGAG |
| 56 | TGTGAGTTCT GCTCGAAAGA GCAAC |
| 57 | CCTGTCGGGC GTCTTCACAA AGTAC |
| 58 | GCCAGGCCGA TGTGAGAGTC CCTTT |
From Fungene database (http://fungene.cme.msu.edu/) download function gene alkB and dsrB sequence, remove and repeat, the sequence that length is inadequate and confidence level is not high, then by clustal comparison and NCBIBlast checking, the probe that over-designed degree is higher, finally obtains probe SEQIDNO.59-SEQIDNO.71.
Table 9 functional gene alkB probe 8 and dsrB probe 5
| SEQ ID NO. | 5 '------probe sequence------3 ' |
| 59 | CAACATCGTY CAYACCCAGG G |
| 60 | CAACATCGTC CACACCCAGG G |
| 61 | CAACATCGTT CATACCCAGG G |
| 62 | CAACATCGTC CATACCCAGG G |
| 63 | CAACATCGTT CACACCCAGG G |
| 64 | GTCAACTACC TCGAGCACTA CGG |
| 65 | GTGAATTACA TCGAGCACTA TGG |
| 66 | GTGAACTATG TCGAGCATTA CGG |
| 67 | GGGCACTTCT ACATCGAGCA CAA |
| 68 | GGCCACTTCT TTATTGAGCA TAA |
| 69 | AACCATTTCC GTATTGAGCA TCC |
| 70 | GGCCACTTCT TCATCGAGCA CAA |
| 71 | AATCACTITC GTATAGAACA TCC |
3, probe synthesis
The general structure of above probe sequence is: NH
2-poly (T)-probe sequence of barcodes, NH
2represent that probe 5 ' is held through amido modified, poly (T)-probe sequence of barcodes length is 40nt.According to the general structure synthesising probing needle of probe.
4, the making of chip
Probe is fixed on the slide of aldehyde radicalization modification with the matrix (accompanying drawing 1) of setting, chip matrix is by totally 71 probes for 6 bacteriums genus, 15 bacterium kinds and 2 functional genes, and the array that negative Quality Control probe NC and positive quality control probe PC forms and fluorescence localization probe FP form.Blank position 50%DMSO in hybridization region covers.Every bar probe points system 3 is parallel.First dilute probe during chip point, the concentration of needs is 1 μ g/ μ L.
Step is as follows:
1. centrifugal 5 minutes of the dry powder of probe effective whizzer 12000rpm normal temperature, by the dry powder of tube wall from the bottom of pipe;
2. in super clean bench, add the ratio of DMSO (DMSO) solution of 20ul50% according to 1OD probe dry powder, mixed by solution vortex, room temperature leaves standstill and probe dry powder is fully dissolved;
3. measure the OD260 of solution with NanoDropOD instrument, then with 50% dimethyl sulphoxide solution to be adjusted to final concentration be 1 μ g/ μ L, be kept at-20 DEG C of refrigerators for subsequent use.
The probe designing in advance and add the 1 μ g/ μ l that 10 μ L have dissolved in the corresponding loading hole of 384 orifice plates is followed during chip manufacturing.The clean slide glass through aldehyde radical process is placed on the Stage microscope of point sample instrument, slide glass specification is 57.5mm × 25.5mm × 1mm (long × wide × high), be divided into 8 point sample districts (5.5mm × 5.5mm), each point sample district comprises 16SrDNA probe processed, ITS probe and functional gene probe respectively.Probe points system uses control software design---the BioDotAxSys of BioDot, arranges point sample program and runs.Point system after UV-crosslinked 12 hours, the chip prepared keeps in Dark Place for subsequent use.
The case that embodiment 2, chip of the present invention and positive are hybridized
1, goal gene pcr amplification
(1) acinetobacter, bacillus, Burkholderia, enlightening thatch Bordetella, marinobacter, each 1 strain positive strain of Rhodopseudomonas carry out 16SrDNA gene amplification, and the primer is 27f/802r and 783f/1492r;
Primer 2 7f sequence is 5 '-AGAGTTTGATCTGGCTCAG-3 ';
Primer 802r sequence is 5 '-GACTACCAGGGTATCTAATCC-3 ';
Primer 783f sequence is 5 '-GGATTAGATACCCTGGTAGTCCA-3 ';
Primer 1492r sequence is 5 '-TACGGCTACCTTGTTACGACTT-3 ';
PCR program is 95 DEG C of denaturations 5 minutes, 94 DEG C of sex change 30 seconds, 55 DEG C of annealing 30 seconds, and 72 DEG C extend 1 minute, sex change to extending circulation 35 times, extension 10 minutes after 72 DEG C; PCR system is as following table;
(2) each 1 strain positive strain of acinetobacter calcoaceticus, Acinetobacter junii, acinetobacter lwoffii, Bacillus cereus, Bacillus licheniformis, bacillus pumilus, subtilis, Burkholderia cepacia, Comamonas testosteroni, Hai Dici Salmonella, Pseudomonas aeruginosa, Pseudomonas fluorescens, pseudomonas mendocina, pseudomonas putida and germ oligotrophy unit cell carries out ITS fragment amplification, and the primer is 783f/5794r;
Primer 783f sequence is 5 '-GGATTAGATACCCTGGTAGTCCA-3 ';
Primer 5794r sequence is 5 '-GGTACTTAGATGTTTCAGTTC-3 ';
PCR program is 95 DEG C of denaturations 5 minutes, 94 DEG C of sex change 45 seconds, 50 DEG C of annealing 45 seconds, and 72 DEG C extend 90 seconds, sex change to extending circulation 32 times, extension 10 minutes after 72 DEG C; PCR system as following table,
(3) the Xinjiang Qi Zhongqu water injection well water sample genome containing hydrocarbon oxidation bacteria and sulphate reducing bacteria gene carries out functional gene dsrB and alkB and increases, and the primer is dsr1f/dsr4r and alkwf/alkwr;
Primer dsr1f sequence is 5 '-ACSCACTGGAAGCACG-3 ';
Primer dsr4r sequence is 5 '-GTGTAGCAGTTACCGCA-3 ';
Primer alkwf sequence is 5 '-AAYACNGCNCAYGARCTNGGNCAYAA-3 ';
Primer alkwr sequence is 5 '-GCRTGRTGRTCNGARTGNCGYTG-3 ';
Increase PCR program of dsrB is 95 DEG C of denaturations 5 minutes, 94 DEG C of sex change 45 seconds, 55 DEG C of annealing 60 seconds, and 72 DEG C extend 2 minutes, sex change to extending circulation 30 times, extension 10 minutes after 72 DEG C; Increase PCR program of alkB is 95 DEG C of denaturations 5 minutes, 94 DEG C of sex change 30 seconds, 55 DEG C of annealing 50 seconds, and 72 DEG C extend 40 seconds, sex change to extending circulation 30 times, extension 10 minutes after 72 DEG C; PCR system is as following table;
2, PCR primer mark
Pcr amplification product raw work SanPrepPCR product pillar purification kit carries out purifying; Each goal gene labeling process utilizes respective downstream primer to carry out single stranded amplification, mixes Cy3-UTP in system; The mark program of each target fragment is with the amplification program of target fragment, and mark system is shown as follows;
(3) gene chip hybridization
Marked product 60 DEG C of oven for drying, use hybridization solution back dissolving under lucifuge condition, when detecting 16SrDNA by the marked product back dissolving of fragment 1 (about 800bp) and fragment 2 (about afterwards 700bp) to together; Back dissolving product point sample, to chip hybridization district, is placed in hybridization storehouse sealing 42 DEG C of reactions 16 hours; After hybridization terminates, in elutriant, carry out wash-out by the order of washing lotion A1.5 minute-washing lotion B1.5 minute-washing lotion C1 minute;
Lotion prescription is as follows:
Washing lotion A:1 × SSC, 10%SDS; Washing lotion B:0.05 × SSC; Washing lotion C:95% ethanol;
After wash-out, chip dried or dry up.
(4) chip scanning
Use chip scanner scanning chip, use preliminary scan and data scanning to obtain signal.16SrDNA probe positive strain hybridization hybrid chip scanning result is as accompanying drawing 2; ITS probe positive strain hybridization hybrid chip scanning result is as accompanying drawing 3; Functional gene dsrB and alkB positive hybridization hybrid chip scanning result are as accompanying drawing 4.Can find out that the hybridization accuracy of probe on chip is good, without obvious non-specific hybridization according to results of hybridization.
Embodiment 3, detect Karamay Oil Fields in Xinjiang's sample by gene chip of the present invention and method.
1, reservoir sample collection
Select district's water injection well, producing well T6180 and seven West water injection wells in six, conventionally sample.
2, reservoir sample nucleic acid preparation
After sample bacteria suspension is centrifugal, by a small amount of PBS buffer solution for cleaning 1 ~ 2 time, adds 1mL (can adjust according to practical situation) lysis buffer, blow and beat resuspended.Add 0.3g granulated glass sphere.Shake 1 minute, ice bath 1 minute, three times repeatedly.Add N,O-Diacetylmuramidase 50 μ L (pre-configured 100mg/mL mother liquor) 37 DEG C effect 1 hour, period mixes several times gently.Add 200 μ L20%SDS solution, 65 DEG C act on 1 hour.Proceed to the little extraction reagent kit (AxyPrep, American) of bacterial genomes afterwards, illustrate according to commercially available reagent box and operate.
3,16SrDNA fragment amplification.
With the sample DNA extracted for template, select primer 2 7f/802r and 783f/1492r to carry out the pcr amplification of 16SrDNA, former and later two segments-segment 1 of 16SrDNA and fragment 2 increase respectively and obtain in a PCR pipe.
Amplification program is: 95 DEG C of denaturations 5 minutes, 94 DEG C of sex change 30 seconds, 55 DEG C of annealing 30 seconds, and 72 DEG C extend 1 minute, sex change to extending circulation 35 times, extension 10 minutes after 72 DEG C.PCR system is as following table.
4, PCR primer mark
Pcr amplification raw work SanPrepPCR product pillar purification kit carries out purifying.Labeling process utilizes respective downstream primer to carry out single stranded amplification, mixes Cy3-UTP in system, and increasing the strand obtained can at fluorescence excitation under ultraviolet.The mark program of target fragment is with the amplification program of target fragment.Mark system is shown as follows.
5, chip hybridization
Marked product 60 DEG C of oven for drying, use hybridization solution back dissolving under lucifuge condition, need when detecting 16SrDNA by the marked product back dissolving of fragment 1 and fragment 2 to together with.Wherein hybridization solution: 6 × SSC, 5 × Denhardt ' ssolution, 20% methane amide, 0.1 μ g/ μ L salmon sperm dna.Back dissolving product point sample is to chip hybridization district, and be placed in hybridization storehouse sealing 42 DEG C of reactions 16 hours, hybridization adds 100 μ L distilled waters bottom storehouse in advance.After hybridization terminates, in elutriant, carry out wash-out by the order of washing lotion A1.5 minute-washing lotion B1.5 minute-washing lotion C1 minute.
Lotion prescription is as follows:
Washing lotion A:1 × SSC, 10%SDS; Washing lotion B:0.05 × SSC; Washing lotion C:95% ethanol;
After wash-out, chip dried or dry up.
6, chip scanning
Use chip scanner scanning chip, use preliminary scan and data scanning to obtain signal.As shown in Figure 5, there is signal in A Zhong Liuzhong district water injection well water sample detection SEQIDNO.1-8 to scanning result, shows containing Rhodopseudomonas, marinobacter, acinetobacter; In B there is signal in producing well T6180 water sample detection SEQIDNO.1-8, SEQIDNO.12-14, shows containing Rhodopseudomonas, marinobacter, acinetobacter and Di Ci Bordetella; In C there is signal in seven West water injection well water sample detection SEQIDNO.1-11, SEQIDNO.15-16, shows containing Rhodopseudomonas, marinobacter, acinetobacter, bacillus and Burkholderia.Chip detection result is consistent with oil well water sample high throughput testing result.
Claims (3)
1. low-temperature reservoir oil recovery function yeast rapid detection gene chip in, is characterized in that this gene chip is fixed with three class probes on solid phase carrier: the 16SrDNA probe belonged to for low-temperature reservoir oil recovery function bacterium in 6 kinds; For the ITS probe of low-temperature reservoir oil recovery function bacterium kind in 15 kinds; For the probe of 2 kinds of functional genes;
In described 6 kinds, low-temperature reservoir oil recovery function bacterium belongs to for acinetobacter, bacillus, Burkholderia, enlightening thatch Bordetella, marinobacter and Rhodopseudomonas; In described 15 kinds, low-temperature reservoir oil recovery function bacterium kind is acinetobacter calcoaceticus, Acinetobacter junii, acinetobacter lwoffii, Bacillus cereus, Bacillus licheniformis, bacillus pumilus, subtilis, Burkholderia cepacia, Comamonas testosteroni, Hai Dici Salmonella, Pseudomonas aeruginosa, Pseudomonas fluorescens, pseudomonas mendocina, pseudomonas putida and germ oligotrophy unit cell; 2 kinds of described functional genes are hydrocarbon oxidation fungi degradation hydrocarbon key gene alkB and sulphate reducing bacteria key function gene dsrB;
Described acinetobacter 16SrDNA probe sequence is as shown in SEQIDNO.1-3; Bacillus 16SrDNA probe sequence is as shown in SEQIDNO.4-6; Burkholderia 16SrDNA probe sequence is as shown in SEQIDNO.7-8; Enlightening thatch Bordetella 16SrDNA probe sequence is as shown in SEQIDNO.9-11; Marinobacter 16SrDNA probe sequence is as shown in SEQIDNO.12-13; Rhodopseudomonas 16SrDNA probe sequence is as shown in SEQIDNO.14-16; Described acinetobacter calcoaceticus ITS probe sequence is as shown in SEQIDNO.17-18; Acinetobacter junii ITS probe sequence is as shown in SEQIDNO.19-21; Acinetobacter lwoffii ITS probe sequence is as shown in SEQIDNO.22-23; Bacillus cereus ITS probe sequence is as shown in SEQIDNO.24-26; Bacillus licheniformis ITS probe sequence is as shown in SEQIDNO.27-29; Bacillus pumilus ITS probe sequence is as shown in SEQIDNO.30-32; Subtilis ITS probe sequence is as shown in SEQIDNO.33-35; Burkholderia cepacia ITS probe sequence is as shown in SEQIDNO.36-38; Comamonas testosteroni ITS probe sequence is as shown in SEQIDNO.39-41; Hai Dici Salmonella ITS probe sequence is as shown in SEQIDNO.42-44; Pseudomonas aeruginosa ITS probe sequence is as shown in SEQIDNO.45-47; Pseudomonas fluorescens ITS probe sequence is as shown in SEQIDNO.48-50; Pseudomonas mendocina ITS probe sequence is as shown in SEQIDNO.51-53; Pseudomonas putida ITS probe sequence is as shown in SEQIDNO.54-56; Germ oligotrophy unit cell ITS probe sequence is as shown in SEQIDNO.57-58; Described hydrocarbon oxidation fungi degradation hydrocarbon key gene alkB probe sequence is as shown in SEQIDNO.59-63; Described sulphate reducing bacteria key function gene dsrB probe sequence is as shown in SEQIDNO.64-71.
2. a preparation method for gene chip as claimed in claim 1, is characterized in that comprising the following steps:
1st step, design function bacterium and functional gene specific probe
Detecting the 16SrDNA sequence belonged to derives from from RDPRelease11 database (http://rdp.cme.msu.edu/hierarchy/hb_intro.jsp); Detect the ITS sequence of planting and derive from NCBIGenome database (http://www.ncbi.nlm.nih.gov/genome/? term=), use ITS universal primer to carry out amplification order-checking to detection kind and sibling species ITS gene thereof, sequencing result is sequence as a supplement simultaneously; Functional gene alkB and dsrB sequence derive from Fungene database (http://fungene.cme.msu.edu/); According to collecting sequence, design the genus specific probe group for goal gene, plant specific probe and functional gene specific probe, probe sequence is as shown in SEQIDNO.1-71;
2nd step, synthesis specific probe
The general structure of probe: NH
2-poly (T)-probe sequence of barcodes, NH
2represent that probe 5 ' is held through amido modified, poly (T)-probe sequence of barcodes length is 40nt; According to the general structure synthesising probing needle of probe;
3rd step, prepare gene chip:
Use BioDotAD5000 chip point sample instrument to be fixed on the slide of aldehyde radicalization modification with the matrix of setting by probe, UV-crosslinked 12 hours, the chip prepared kept in Dark Place; Probe matrix is made up of totally 71 probes, negative Quality Control probe NC, positive quality control probe PC and the fluorescence localization probe FP for bacterial detection and detection gene.
3. the application of middle low-temperature reservoir oil recovery function yeast rapid detection gene chip according to claim 1, is characterized in that the distribution for hydrocarbon oxidative function bacterium in rapid detection oil reservoir and environmental sample and alkane hydroxylase gene thereof, sulfate reduction gene and Changing Pattern.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510645694.9A CN105087823A (en) | 2015-06-16 | 2015-10-09 | Gene chip for quickly detecting oil extraction functional bacteria in medium and low temperature oil pool and application of gene chip |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510332435 | 2015-06-16 | ||
| CN201510645694.9A CN105087823A (en) | 2015-06-16 | 2015-10-09 | Gene chip for quickly detecting oil extraction functional bacteria in medium and low temperature oil pool and application of gene chip |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105087823A true CN105087823A (en) | 2015-11-25 |
Family
ID=54569147
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510645694.9A Pending CN105087823A (en) | 2015-06-16 | 2015-10-09 | Gene chip for quickly detecting oil extraction functional bacteria in medium and low temperature oil pool and application of gene chip |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105087823A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011241A (en) * | 2016-05-24 | 2016-10-12 | 盎亿泰地质微生物技术（北京）有限公司 | Chip for microbial prospecting of oil and gas and application thereof |
| CN115852000A (en) * | 2022-11-22 | 2023-03-28 | 壹健生物科技(苏州)有限公司 | Probe, chip, kit and method for detecting methane metabolism genes in sample |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102191332A (en) * | 2011-05-12 | 2011-09-21 | 中国石油化工股份有限公司 | Medium-high temperature oil preserved bacterium population detection gene chip and application thereof |
-
2015
- 2015-10-09 CN CN201510645694.9A patent/CN105087823A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102191332A (en) * | 2011-05-12 | 2011-09-21 | 中国石油化工股份有限公司 | Medium-high temperature oil preserved bacterium population detection gene chip and application thereof |
Non-Patent Citations (8)
| Title |
|---|
| （法）伯纳德等: "《石油微生物学》", 30 April 2011 * |
| NATSUKO HAMAMURA ET AL.: "Assessing Soil Microbial Populations Responding to Crude-Oil Amendment at Different Temperatures Using Phylogenetic, Functional Gene (alkB) and Physiological Analyses", 《ENVIRON. SCI. TECHNOL.》 * |
| PAO-WEN GRACE LIU ET AL.: "Bioremediation of petroleum hydrocarbon contaminated soil Effects of strategies and microbial community shift", 《INTERNATIONAL BIODETERIORATION & BIODEGRADATION》 * |
| PEIKE GAO ET AL.: "Microbial diversity and abundance in the Xinjiang Luliang long-term water-flooding petroleum reservoir", 《MICROBIOLOGY OPEN》 * |
| 何江川，王元基，廖广志: "《油田开发战略性接替技术》", 30 September 2013 * |
| 刘健: "胜利油田采油区土壤石油污染状况及其微生物群落结构", 《中国优秀硕士学位论文全文数据库（工程科技I辑）》 * |
| 张廷山，徐山等: "《石油微生物采油技术》", 28 February 2009 * |
| 高玉光: "油田采油功能菌的研究", 《中国优秀硕士学位论文全文数据库（工程科技I辑）》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011241A (en) * | 2016-05-24 | 2016-10-12 | 盎亿泰地质微生物技术（北京）有限公司 | Chip for microbial prospecting of oil and gas and application thereof |
| CN106011241B (en) * | 2016-05-24 | 2020-06-30 | 盎亿泰地质微生物技术（北京）有限公司 | Chip for microbial oil-gas exploration and application thereof |
| CN115852000A (en) * | 2022-11-22 | 2023-03-28 | 壹健生物科技(苏州)有限公司 | Probe, chip, kit and method for detecting methane metabolism genes in sample |
| CN115852000B (en) * | 2022-11-22 | 2023-09-12 | 壹健生物科技(苏州)有限公司 | Probe, chip, kit and method for detecting methane metabolism gene in sample |
| WO2024109093A1 (en) * | 2022-11-22 | 2024-05-30 | 壹健生物科技(苏州)有限公司 | Probe for detecting methane metabolic gene in sample, chip, kit, and method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Boon et al. | Evaluation of nested PCR–DGGE (denaturing gradient gel electrophoresis) with group-specific 16S rRNA primers for the analysis of bacterial communities from different wastewater treatment plants | |
| Talbot et al. | Evaluation of molecular methods used for establishing the interactions and functions of microorganisms in anaerobic bioreactors | |
| Lydmark et al. | Effects of environmental conditions on the nitrifying population dynamics in a pilot wastewater treatment plant | |
| Hung et al. | Quantitative analysis of a high-rate hydrogen-producing microbial community in anaerobic agitated granular sludge bed bioreactors using glucose as substrate | |
| Dubey et al. | Exploration of soil bacterial communities for their potential as bioresource | |
| Li et al. | Succession of diversity, functions, and interactions of the fungal community in activated sludge under aromatic hydrocarbon stress | |
| Hung et al. | Application of Clostridium-specific PCR primers on the analysis of dark fermentation hydrogen-producing bacterial community | |
| Tolvanen et al. | Molecular methods for characterizing mixed microbial communities in hydrogen-fermenting systems | |
| Oshiki et al. | Ureolytic prokaryotes in soil: community abundance and diversity | |
| Collins et al. | Accessing the black box of microbial diversity and ecophysiology: recent advances through polyphasic experiments | |
| Srivastava et al. | Analyzing functional microbial diversity: an overview of techniques | |
| CN104232766A (en) | Method for detecting community structure and abundance of ammonia oxidizing bacteria in wastewater system | |
| Urrea-Valencia et al. | Molecular techniques to study microbial wastewater communities | |
| CN105087823A (en) | Gene chip for quickly detecting oil extraction functional bacteria in medium and low temperature oil pool and application of gene chip | |
| Forster et al. | Rains, drains and active strains: towards online assessment of wastewater bacterial communities | |
| Fuka et al. | Molecular tools to assess the diversity and density of denitrifying bacteria in their habitats | |
| Kapley et al. | Genomic tools in bioremediation | |
| Savichtcheva et al. | Novel FISH and quantitative PCR protocols to monitor artificial consortia composed of different hydrogen-producing Clostridium spp. | |
| CN110506130A (en) | For detecting the biochip and fast method that participate in the biology of microbiologic(al) corrosion (MIC) | |
| Rittmann | The role of molecular methods in evaluating biological treatment processes | |
| CA3159255C (en) | Method for controlling the quality in cultures of methanogenic archaea using snp-specific primers | |
| Goel et al. | Molecular biological methods in environmental engineering | |
| Wang et al. | A simple and sensitive direct mRNA multiplexed detection strategy for amoA-targeted monitoring of ammonia-oxidizing activity in water environment | |
| dos Santos et al. | New approaches to understanding microbial diversity in wastewater, landfills and leachate treatment | |
| Gu et al. | Molecular methods in biological systems |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151125 |
|
| RJ01 | Rejection of invention patent application after publication |