CN105087631A - Method for improving absorption and utilization capacities of brewer's yeast xylose - Google Patents
Method for improving absorption and utilization capacities of brewer's yeast xylose Download PDFInfo
- Publication number
- CN105087631A CN105087631A CN201510483533.4A CN201510483533A CN105087631A CN 105087631 A CN105087631 A CN 105087631A CN 201510483533 A CN201510483533 A CN 201510483533A CN 105087631 A CN105087631 A CN 105087631A
- Authority
- CN
- China
- Prior art keywords
- rgt1
- xylose
- saccharomyces cerevisiae
- yeast
- wood sugar
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a method for improving absorption and utilization capacities of brewer's yeast xylose. According to the method, DNA homologous recombination is adopted for inserting DNA sequences containing selection marker genetic expression frames on the RGT1 genetic expression open reading frame region of a brewer's yeast chromosome, so as to destroy the expression of the RGT1 genes, obtain the brewer's yeast strain having the transcription factor gene RGT1 knocked off and containing the xylose transformation path, and improve the absorption and utilization capacities of the brewer's yeast xylose. The experiment shows that through the RGT1 deficiency method, the expression levels of hexose transporter proteins HXT1 and HXT2 in the brewer's yeast under the condition of xylose are improved by 17.32 times and 3.75 times compared with the prior art, the utilization efficiency of xylose is improved to 0.34g/L/h from the prior art of 0.23g/L/h, which is improved by 47.8%, and thus the method is contemplated to have extremely great application prospect in the production.
Description
Technical field
The present invention relates to a kind of method improving the absorption of yeast saccharomyces cerevisiae wood sugar and Utilization ability, belong to biological technical field.
Background technology
Lignocellulosic sources is of a great variety, annual production is huge, and its comprehensive utilization both can bring economic benefit, can reduce again the environmental pollution because the improper process such as burning cause.Wood sugar component content in lignocellulosic material, up to about 30%, is only second to glucose component, and carrying out comprehensive utilization to it can significantly improve raw material availability.Yeast saccharomyces cerevisiae (Saccharomycescerevisiae) is widely used in food and industrial microorganism, and it has the characteristics such as the vigorous and grade-safe of strong robustness, metabolism.By genetic engineering means, suitable pathways metabolism key enzyme is introduced yeast saccharomyces cerevisiae, can obtain can be the cell factory of various target product by xylose.At present, main direct target product comprises alcohol fuel, Xylitol, xylosic acid etc. (take yeast saccharomyces cerevisiae as the progress that the lignocellulosic material of cell factory utilizes wood sugar component.Shen Yu, Hou Jin, Xiao Lin, Xia Ruirui, Bao Xiaoming.Biological industry technology, 2014,05,76-81).The absorption of wood sugar is the first step that yeast saccharomyces cerevisiae utilizes wood sugar.Yeast saccharomyces cerevisiae does not have special wood sugar transport protein, and it depends on hexose transport protein to the absorption of wood sugar.The expression of these hexose transport proteins is subject to the regulation and control of intraor extracellular glucose signals, and they are subject to the competitive inhibition of glucose to the transport of wood sugar.Wherein, when surrounding environment does not have dextrose plus saccharose, transcription factor Rgt1 is directly combined in transporter gene HXT1, HXT2, HXT3, and the promoter region of HXT4, checks their expression.When there is glucose or sucrose in surrounding environment, on brewing yeast cell film, albumen Rgt2 and Snf3 passes the signal along in cell, impels Mth1 and the Std1 degraded that script and Rgt1 combine.Departed from the Rgt1 of Mth1 and Std1 and then be phosphorylated, depart from the promoter region of transport protein gene, these genes are just expressed.And on the other hand, when glucose concn in surrounding environment is very high, another transcription factor Mig1 is combined in HXT2, HXT3, and HXT4 promoter region, check their expression (Busti, S., Coccetti, P., Alberghina, L., andVanoni, M.Glucosesignaling-mediatedcoordinationofcellgrowthandce llcycleinSaccharomycescerevisiae.Sensors, 2010,10,6195-6240.).In addition, separately there are some researches show, knock out the expression that RGT1 gene can also promote another translocator HXT7 gene, its concrete mechanism is still not clear (Dlugai, S., Hippler, S., Wieczorke, R., andBoles, E.Glucose-dependentand-independentsignallingfunctionsoft heyeastglucosesensorSnf3.FebsLett, 2001,505,389-392.).But retrieval finds, utilize the method for disappearance RGT1 gene to improve and have not been reported with the document of the xylose utilization ability of the recombinant Saccharomyces cerevisiae of xylose utilization approach or patent.
Summary of the invention
For the deficiencies in the prior art, the problem to be solved in the present invention is to provide a kind of method utilizing disappearance RGT1 gene to improve the absorption of yeast saccharomyces cerevisiae wood sugar and Utilization ability.
The method of raising yeast saccharomyces cerevisiae wood sugar absorption of the present invention and Utilization ability, it is characterized in that: recombinated by DNA homology, by RGT1 genetic expression encoder block region on the S. cerevisiae chromosomal that is inserted into containing riddled basins expression cassette DNA sequence dna Deletioncassette containing xylose approach, destroy the expression of RGT1 gene, acquisition knocks out the Wine brewing yeast strain containing xylose approach of transcription factor gene RGT1 (systematic name: YKL038W), to realize the raising of the absorption of this yeast saccharomyces cerevisiae wood sugar and Utilization ability.
Above-mentioned raising yeast saccharomyces cerevisiae wood sugar absorb and Utilization ability method in: described DNA sequence dna Deletioncassette is the nucleotide sequence of 2139bp, and its sequence is as shown in SEQIDNo.1.
Above-mentioned raising yeast saccharomyces cerevisiae wood sugar absorb and Utilization ability method in: described xylose approach refers to xylose to be the pathways metabolism of Xylitol, xylosic acid or ethanol.
Above-mentioned raising yeast saccharomyces cerevisiae wood sugar absorb and Utilization ability method in: the described yeast saccharomyces cerevisiae containing xylose approach preferably contains the strain Saccharomyces cerevisiae BSPC085 of xylose utilization approach, described in knock out RGT1 gene bacterial strain be preferably yeast saccharomyces cerevisiae BSPC085-RT.
Above-mentioned raising yeast saccharomyces cerevisiae wood sugar absorb and Utilization ability method in: it is template with the chromosomal DNA of transformant that described Wine brewing yeast strain BSPC085-RT verifies that method that its RGT1 indeed knocks out is, carry out pcr amplification with primer rgt1-1 and primer rgt1-6, the band of acquisition is 2139bp; Wherein,
The nucleotide sequence of primer rgt1-1 is: TGTGACGTGGCTTATGAGCACCAG,
The nucleotide sequence of primer rgt1-6 is: TGGCAATGGCAATAGTGATGGCACC.
In the restriction of transhipment link when utilizing wood sugar for yeast saccharomyces cerevisiae in prior art, the present invention is based on above regulatory mechanism, provide a kind of method improving the absorption of yeast saccharomyces cerevisiae wood sugar and Utilization ability, the wood sugar being improved with wood sugar the engineering strain being the compounds such as raw material production ethanol, Xylitol, xylosic acid by the method is absorbed and Utilization ability, and achieves the engineering strain application aborning that will obtain.
The present invention is realized by the transcription factor gene RGT1 knocked out in Wine brewing yeast strain.The expression level of yeast saccharomyces cerevisiae hexose transport albumen under wood sugar condition can be significantly improved by knocking out RGT1 gene, thus improve the ability that bacterial strain absorbs and utilize wood sugar.Experiment confirms the method by lacking RGT1, and in yeast saccharomyces cerevisiae, the expression level under wood sugar condition of hexose transport albumen HXT1, HXT2 brings up to original 17.32 and 3.75 times respectively.Accordingly, utilize the method for disappearance RGT1, improve the xylose utilization ability of the recombinant Saccharomyces cerevisiae with xylose utilization approach, xylose utilization rates, from original 0.23g/L/h, brings up to 0.34g/L/h, improves 47.8%.
Accompanying drawing explanation
Fig. 1: for the acquisition schema of the DNA fragmentation that RGT1 knocks out.
Fig. 2: RGT1 knocks out the impact on bacterial strain wood-sugar fermentation.
Fermention medium is with 20g/L wood sugar for sole carbon source, and square represents yeast saccharomyces cerevisiae dry cell weight, and upper triangle represents wood sugar, and lower triangle represents ethanol.That represent by open symbols is RGT1 knock-out bacterial strain BSPC085-RT, and filled symbols representative does not knock out the control strain BSPC085 of RGT1.
Fig. 3: RGT1 knocks out the impact of fermenting altogether on bacterial strain glucose-wood sugar.
Fermention medium is with 20g/L wood sugar and 20g/L glucose for carbon source, and square represents yeast saccharomyces cerevisiae dry cell weight, and circle represents glucose, and upper triangle represents wood sugar, and lower triangle represents ethanol.That represent by open symbols is RGT1 knock-out bacterial strain BSPC085-RT, and filled symbols representative does not knock out the control strain BSPC085 of RGT1.
Embodiment
Embodiment 1: for the acquisition of the DNA fragmentation that RGT1 knocks out
The DNA fragmentation knocked out for RGT1 is obtained by fusion DNA vaccine technology, and in amplification condition, annealing temperature is 60 DEG C, and as shown in Figure 1, concrete steps are as follows for flow process:
1) with yeast saccharomyces cerevisiae BSPC085 (Shandong University, the bright silver-colored master thesis of Peng, 2011) chromosomal DNA is template, and increasing with primer rgt1-1 and primer rgt1-2 obtains DNA fragmentation Fragment1 (384bp), this fragment and RGT1 gene upstream sequence homology; Increase with primer rgt1-5 and primer rgt1-6 and obtain DNA fragmentation Fragment3 (398bp), this fragment and RGT1 downstream of gene sequence homology.
2) with plasmid pUG6 (G ü ldener, U., Heck, S., Fielder, T., Beinhauer, J., andHegemann, J.H.Anewefficientgenedisruptioncassetteforrepeateduseinb uddingyeast.Nucleicacidsresearch, 1996,24,2519-2524.) be template, increase with primer rgt1-3 and primer rgt1-4 and obtain DNA fragmentation Fragment2 (1404bp), this fragment has G418 tolerant gene expression frame TEFp-KanR-TEFt, and two ends also have the part with Fragment1, Fragment3 homology respectively.
3) with DNA fragmentation Fragment1, Fragment2, Fragment3 mixture for template, increase with primer rgt1-1 and primer rgt1-6 and obtain the complete DNA fragmentation Deletioncassette (2139bp) knocked out for RGT1.
The acquisition of embodiment 2:RGT1 knock-out bacterial strain
DNA fragmentation Deletioncassette (2139bp) the transformed saccharomyces cerevisiae BSPC085 knocked out with RGT1 in embodiment 1, method for transformation adopts common method lithium acetate transformation method (Shandong University, the bright silver-colored master thesis of Peng, 2011).Interpolation 400mg/LG418 as screening pressure and 20g/L glucose as the SC-URA solid medium of carbon source in screen transformant.
Wherein SC-URA substratum contains 1.7g/L yeast basic nitrogen source (YNB, Sangon, China), 5g/L ammonium sulfate (Sangon, China), 0.77g/L kilnitamin CSM-URA (MPBiomedicals, Solon, OH), pH4.5.Solid medium adds 20g/L agarose.
Through PCR checking, the Strain Designation that RGT1 indeed knocks out is BSPC085-RT.Verification method is template with the chromosomal DNA of transformant, and increase with primer rgt1-1 and primer rgt1-6PCR, the band of acquisition is 2139bp.
Embodiment 3: under different carbon source condition, in RGT1 knock-out bacterial strain, the expression level of hexose transport protein gene measures
RGT1 deletion mycopremna BSPC085-RT and starting strain BSPC085 is cultivated in the 50mL triangular flask that 20mLSC-URA liquid nutrient medium is housed, cultivates 12 hours for 30 DEG C.Be switched to two kinds of fresh SC-URA substratum of 20mL again, a kind of using 20g/L glucose as carbon source, another kind of using 20g/L wood sugar as carbon source, inoculum size is initial OD
600=0.2.30 DEG C of shaking culture to OD
600for 0.8-1.0, collected by centrifugation thalline.
UNIQ-10 pillar Trizol total serum IgE extraction agent box is used to extract total serum IgE.Use TaKaRaPrimeScript
tMrTReagentKitwithgDNAEraser test kit carries out genomic dna removal and reverse transcription, obtains cDNA.Two kinds of test kit operations are carried out according to its specification sheets.
With the cDNA of BSPC085-RT and BSPC085 for masterplate (recording concentration between 1100-1400ng/ μ l), dilution 5-8 doubly, respectively to HXT1, HXT2, HXT7, GAL2 does quantitative fluorescent PCR reaction (Real-timeQuantitativePCR, qPCR), using ACT1 as interior mark.Measure the primer used and be respectively hxt1-F and hxt1-R, hxt2-F and hxt2-R, hxt7-F and hxt7-R, gal2-F and gal2-R, act1-F and act1-R.Often organizing data, to do 3 groups of biologies parallel, and often biological parallel to do 3 group technique parallel for group, obtains real-time fluorescence amplification curve.
Adopt 2
-Δ Δ Ctmethod take ACT1 as internal reference, calculates the relative expression levels of HXT1, HXT2, HXT7, GAL2.The results are shown in Table 1.
Table 1 is gene expression dose under glucose and xylose culture condition
Result shows, although knock out the expression that RGT1 makes HXT1 in glucose to have dropped half, in wood sugar, HXT1 expression level is original 17 times, and HXT2 expression level is close to original 4 times.Although the expression level of HXT7 have dropped under wood sugar condition, generally speaking, knocking out RGT1 makes the expression level of bacterial strain transport protein under wood sugar condition significantly rise.
In embodiment 1-3, the primer is listed as follows:
Embodiment 4: checking knocks out the xylose utilization ability that RGT1 improves bacterial strain
Bacterial strain BSPC085-RT and BSPC085 is inoculated into respectively the SC-URA substratum containing 20g/L glucose, cultivates 12 hours for 30 DEG C, switching bacterial strain is in the 100mL triangular flask that 40mLSC-URA substratum is housed, and carbon source is 20g/L wood sugar, initial OD
600be that 1,200rpm cultivates 72h.
Fermentating metabolism substrate and product HPLC analyze.Result display (see Fig. 2), the bacterial strain BSPC085-RT knocking out RGT1 has stronger xylose utilization ability.
Bacterial strain BSPC085-RT and BSPC085 is inoculated into respectively the SC-URA substratum containing 20g/L glucose, cultivates 12 hours for 30 DEG C, switching bacterial strain is in the 100mL triangular flask that 40mLSC-URA substratum is housed, and carbon source is 20g/L glucose and 20g/L wood sugar, initial OD
600be that 1,200rpm cultivates 72h.
Fermentating metabolism substrate and product high performance liquid chromatography (HPLC) are analyzed.Result display (see Fig. 3), the bacterial strain BSPC085-RT and its control strain BSPC085 that knock out RGT1 do not demonstrate difference in the glucose fermentation stage, but in xylose utilization stage (after 15 hours), the bacterial strain BSPC085-RT knocking out RGT1 demonstrates advantage in xylose utilization ability.
Wherein, the HPLC of the concentration of above-mentioned glucose, wood sugar, ethanol analyzes and uses Shimadzu company LC-20A system, and chromatography column uses
hPX-87H (Bio-Rad), detects with the RID-10A Composition distribution of Shimadzu company.Moving phase is 5mmol/LH
2sO
4, flow velocity 0.6mL/min, column oven temperature keeps 45 DEG C.
Claims (5)
1. one kind is improved the method for the absorption of yeast saccharomyces cerevisiae wood sugar and Utilization ability, it is characterized in that: recombinated by DNA homology, by RGT1 genetic expression encoder block region on the S. cerevisiae chromosomal that is inserted into containing riddled basins expression cassette DNA sequence dna Deletioncassette containing xylose approach, destroy the expression of RGT1 gene, obtain the Wine brewing yeast strain containing xylose approach knocking out transcription factor gene RGT1, to realize the raising of the absorption of this yeast saccharomyces cerevisiae wood sugar and Utilization ability.
2. the as claimed in claim 1 yeast saccharomyces cerevisiae wood sugar that improves absorbs and the method for Utilization ability, it is characterized in that: described xylose approach refers to xylose to be the pathways metabolism of Xylitol, xylosic acid or ethanol.
3. the method improving the absorption of yeast saccharomyces cerevisiae wood sugar and Utilization ability as claimed in claim 1, it is characterized in that: the described yeast saccharomyces cerevisiae containing xylose approach is the strain Saccharomyces cerevisiae BSPC085 containing xylose utilization approach, described in knock out RGT1 gene bacterial strain be yeast saccharomyces cerevisiae BSPC085-RT.
4. the method improving the absorption of yeast saccharomyces cerevisiae wood sugar and Utilization ability as claimed in claim 1, is characterized in that: described DNA sequence dna Deletioncassette is the nucleotide sequence of 2139bp, and its sequence is as shown in SEQIDNo.1.
5. the method improving the absorption of yeast saccharomyces cerevisiae wood sugar and Utilization ability as claimed in claim 3, it is characterized in that: it is template with the chromosomal DNA of transformant that described Wine brewing yeast strain BSPC085-RT verifies that method that its RGT1 indeed knocks out is, carry out pcr amplification with primer rgt1-1 and primer rgt1-6, the band of acquisition is 2139bp; Wherein,
The nucleotide sequence of primer rgt1-1 is: TGTGACGTGGCTTATGAGCACCAG,
The nucleotide sequence of primer rgt1-6 is: TGGCAATGGCAATAGTGATGGCACC.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510483533.4A CN105087631A (en) | 2015-08-07 | 2015-08-07 | Method for improving absorption and utilization capacities of brewer's yeast xylose |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510483533.4A CN105087631A (en) | 2015-08-07 | 2015-08-07 | Method for improving absorption and utilization capacities of brewer's yeast xylose |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105087631A true CN105087631A (en) | 2015-11-25 |
Family
ID=54568963
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510483533.4A Pending CN105087631A (en) | 2015-08-07 | 2015-08-07 | Method for improving absorption and utilization capacities of brewer's yeast xylose |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105087631A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102174549B (en) * | 2011-02-22 | 2012-10-10 | 山东大学 | Nucleic acid molecules for coding xylose isomerase and xylose isomerase coded by same |
| WO2014022692A1 (en) * | 2012-08-01 | 2014-02-06 | Whitehead Institute For Biomedical Research | Prion-based manipulation of yeast fermentation and growth |
| CN103597084A (en) * | 2011-02-07 | 2014-02-19 | 加利福尼亚大学董事会 | Enhanced cellodextrin metabolism |
| US20140342419A1 (en) * | 2011-11-21 | 2014-11-20 | Metabolic Explorer | Microorganism strains for the production of 2,3-butanediol |
-
2015
- 2015-08-07 CN CN201510483533.4A patent/CN105087631A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103597084A (en) * | 2011-02-07 | 2014-02-19 | 加利福尼亚大学董事会 | Enhanced cellodextrin metabolism |
| CN102174549B (en) * | 2011-02-22 | 2012-10-10 | 山东大学 | Nucleic acid molecules for coding xylose isomerase and xylose isomerase coded by same |
| US20140342419A1 (en) * | 2011-11-21 | 2014-11-20 | Metabolic Explorer | Microorganism strains for the production of 2,3-butanediol |
| WO2014022692A1 (en) * | 2012-08-01 | 2014-02-06 | Whitehead Institute For Biomedical Research | Prion-based manipulation of yeast fermentation and growth |
Non-Patent Citations (8)
| Title |
|---|
| ACHIM WACH: "PCR-Synthesis of Marker Cassettes with Long Flanking Homology Regions for Gene Disruptions in S. cerevisiae", 《YEAST》 * |
| GOFFEAU,A. 等: "Saccharomyces cerevisiae S288c chromosome XI, complete sequence", 《GENBANK DATABASE》 * |
| J. HORAK 等: "Regulations of sugar transporters: insights from yeast", 《CURRENT GENETICS》 * |
| JA POLISH 等: "How the Rgt1 Transcription Factor of Saccharomyces cerevisiae is Regulated by Glucose", 《GENETICS》 * |
| SILKE DLUGAI 等: "Glucose-dependent and -independent signalling functions of the yeast glucose sensor Snf3", 《FEBS LETTERS》 * |
| 沈煜 等: "以酿酒酵母为细胞工厂的木质纤维素原料对木糖组分利用的研究进展", 《生物产业技术》 * |
| 沈煜 等: "酿酒酵母木糖发酵酒精途径工程的研究进展", 《生物工程学报》 * |
| 王娜 等: "酵母菌木糖转运蛋白研究进展", 《中国农业科技导报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lee et al. | Bioethanol production from cellulosic hydrolysates by engineered industrial Saccharomyces cerevisiae | |
| Radecka et al. | Looking beyond Saccharomyces: the potential of non-conventional yeast species for desirable traits in bioethanol fermentation | |
| Goncalves et al. | Xylose and xylose/glucose co-fermentation by recombinant Saccharomyces cerevisiae strains expressing individual hexose transporters | |
| EP3165609B1 (en) | Expression cartridge for the transformation of a eukaryotic cell, method for transforming a eukaryotic cell, genetically modified organism, and process for producing biofuels and/or biochemicals and biofuels thus produced | |
| Wisselink et al. | Novel evolutionary engineering approach for accelerated utilization of glucose, xylose, and arabinose mixtures by engineered Saccharomyces cerevisiae strains | |
| AU2007302867B2 (en) | Metabolic engineering of arabinose-fermenting yeast cells | |
| CN105199976B (en) | Recombinant saccharomyces cerevisiae strain for co-fermenting glucose and xylose and application thereof | |
| Klein et al. | The expression of glycerol facilitators from various yeast species improves growth on glycerol of Saccharomyces cerevisiae | |
| JP5804327B2 (en) | Production method of ethanol from biomass | |
| US10767155B2 (en) | Method of preparing a strain of Saccharomyces cerevisiae and a method of fermentation to produce ethanol | |
| US9441249B2 (en) | Method for producing ethanol from biomass | |
| CN108485996B (en) | Novel ethyl acetate-producing saccharomyces cerevisiae strain and construction method thereof | |
| US20160326552A1 (en) | Expression of a hap transcriptional complex subunit | |
| De Valk et al. | Engineering proton-coupled hexose uptake in Saccharomyces cerevisiae for improved ethanol yield | |
| JP5813977B2 (en) | Mutant yeast belonging to the genus Kluyveromyces and method for producing ethanol using the same | |
| CN104024419A (en) | Method for producing ethanol that uses recombinant yeast | |
| CN104220600B (en) | Promoter and application thereof | |
| JP5590140B2 (en) | Method for producing ethanol using recombinant yeast | |
| Ding et al. | Evolutionary engineering of yeast for closed-circulating ethanol fermentation in PDMS membrane bioreactor | |
| CN105087631A (en) | Method for improving absorption and utilization capacities of brewer's yeast xylose | |
| CN108486176B (en) | Saccharomyces cerevisiae for producing ethyl lactate and construction method and application thereof | |
| KR102323926B1 (en) | New yeast strain fermenting arabinose to produce ethanol | |
| CN112752845A (en) | Increased alcohol production from yeast producing increased amounts of active CRZ1 protein | |
| JP6812097B2 (en) | Yeast that produces ethanol from xylose | |
| CN110846238A (en) | Low-diacetyl and higher alcohol-producing grape juice yeast strain and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20151125 |
|
| WD01 | Invention patent application deemed withdrawn after publication |