CN105087630A - Target fungus cytoderm chitin synthetase decreasing agent cell screening model - Google Patents
Target fungus cytoderm chitin synthetase decreasing agent cell screening model Download PDFInfo
- Publication number
- CN105087630A CN105087630A CN201510543219.0A CN201510543219A CN105087630A CN 105087630 A CN105087630 A CN 105087630A CN 201510543219 A CN201510543219 A CN 201510543219A CN 105087630 A CN105087630 A CN 105087630A
- Authority
- CN
- China
- Prior art keywords
- umpro
- screening
- luc
- ppic9kg
- luciferase reporter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a target fungus cytoderm chitin synthetase decreasing agent high-throughput screening model, belonging to the field of genetic engineering, the model consists of a UMcsh5 gene promoter sequence UMPRO, a recombinant plasmid Ppic9KG-UMPRO-LUC, monoclonal cell strain GS115-UMPRO-LUC for stable expression of the UMPRO promoter, a screening reagent and a luciferase reporter gene detection system. The screening model has the advantages of simple and convenient operation, low cost, high flexibility, wide applicable range, high screening efficiency and the like and has great application potentiality.
Description
Technical field:
The invention belongs to genetically engineered field, relate to a kind of target fungal cell wall chitin synthetase and lower agent high flux drug cell screening model.
Background technology:
Chitin synthetase is the key enzyme in chitin biosynthesizing, and the chitin synthetase inhibitor produced by microorganism can suppress the activity of this enzyme, stop chitinous biosynthesizing, thus Antifungi growth or stop insect larvae and pupa to be casted off a skin to reach insecticidal effect.Because mammal does not have chitin metabolic system, so screening chitin synthetase inhibitor, be expected to develop the harmless new antifungal agents of people, animal low toxicity and sterilant.
In all kinds of chitin synthetase, CS3 (IV class), when the cell cycle starts, to sprout site synthesis chitin ring at cell; CS2 (II class), in metamitosis, synthesizes elementary barrier film between parent cell and daughter cell, and CS1 (I class) plays reparation damaging action after cell fission; So under study for action, target of the present invention selects CS3 (IV class) as Screening target.
So far, existing many about target chitin synthetase carry out fungi-medicine screening model report (Deng Qiao. Chongqing. graduate school of Southwestern University .2014-4-1), and correlative study focuses mostly in the research of chitinase inhibitors.More due to drug screening target limited specificity, there is the problem of crossing drug resistant in the medical compounds that described research is sieved.Screening target is locked in chitin biosynthesizing upstream enzyme gene regulatory sequence by this research, and this design completely newly can improve greatly sieves to obtain the following potential applied of chitin synthetase inhibitor.
Summary of the invention:
The chitin synthetase that the invention provides a kind of target fungal cell wall lowers agent high flux screening model.Described screening model is made up of the monoclonal cell strain GS115-UMPRO-LUC of UMcsh5 gene promoter sequence UMPRO, the recombinant plasmid Ppic9KG-UMPRO-LUC carrying luciferase reporter gene, stably express UMPRO promotor, screening reagent and luciferase reporter gene detection system.
Described UMcsh5 gene is the chitin synthesis enzyme coding gene in plant epiphyte pathogenic bacterium Ustilago Ustilagomaydis521chromosome6, and No. Genbank is NC_026483;
Preferably, described chitin synthetase promoter sequence UMPRO is the DNA sequence dna shown in SEQIDNo:1;
Preferably, described construction recombination plasmid adopts carrier Ppic9K;
Preferably, described screening reagent comprises penbritin and Geneticin.
The chitin synthetase of a kind of target fungal cell wall provided by the invention lowers agent high flux screening model, utilize UMcsh5 gene UMPRO promoter sequence as the target of drug screening, by UMPRO promotor-mono-luciferase reporter gene detection system, according to luciferase act on its substrate send the intensity of bioluminescence, judge the activity of UMPRO promotor, according to the inhibition of compound to promotor, judge that chitin synthetase is lowered active.So, cell model screening system provided by the present invention, can efficiently, high-throughput ground is used for the screening of different sources compound.UMPRO promoter activity can be suppressed, make luciferase reporter gene express the compound reduced, namely likely become and suppress the biosynthetic drug candidate of chitin.
The chitin synthetase of a kind of target fungal cell wall provided by the invention lowers the structure of agent high flux screening model, comprises the following steps:
1. reorganize the preparation of carrier Ppic9KG
By Ppic9k carrier via after the process of BgIII and SacI double digestion, run glue, purifying recovery fragment length is the fragment of about 9000bp, obtain Ppic9KG;
The amplification of 2.UMcsh5 gene promoter sequence UMPRO
Utilize No. NCBIGenbank for UMcsh5 gene promoter region sequence 1500bp in NC_026483UM521 bacterium is as UMcsh5 gene promoter UMPRO.Application primerprimer5.0 primer-design software, the primer of design UMPRO promotor, with the promoter sequence UMPRO of synthetic for template carries out PCR, increase the object fragment obtained;
3. the amplification of luciferase reporter gene (LUC)
Application primerprimer5.0 primer-design software, the primer of design luciferase reporter gene (Luc), carries out PCR with pGL4.17 (purchasing in promega company) template, and increase the object fragment obtained;
4. carry the structure of the recombinant plasmid of luciferase reporter gene
By the promoter sequence UMPRO in step 2 via after the process of BgIII and SacI double digestion, after being connected with Ppic9KG, transform, extract plasmid acquisition Ppic9KG-UMPRO recon; Subsequently, the luciferase reporter gene (LUC) in step 3 is connected with Ppic9KG-UMPRO recon after SnaBI and NotI double digestion, transforms, extract plasmid DNA and obtain recombinant plasmid Ppic9KG-UMPRO-LUC;
5. the screening of the monoclonal cell strain GS115-UMPRO-Luc of stably express UMPRO promotor
Recombinant plasmid electricity is proceeded in Pichia pastoris GS115, through not containing the screening culture medium of Histidine and the two screening of substratum containing Geneticin, according to luciferase reporter gene detected result, obtain the monoclonal cell strain that expression intensity is the highest, enlarged culturing obtains GS115-UMPRO-LUC monoclonal cell strain.
6. the application of drug screening
In GS115-UMPRO-LUC monoclonal cell strain culturing process, add candidate compound, act on after 24 hours, utilize and according to luciferase reporter gene fluorescence intensity, react the activity of promotor UMPRO, and then obtain and have inhibiting compound to chitin synthetase promotor.
Invention advantage:
1, the present invention adjusts screening model under a kind of chitin synthetase based on UMcsh5 gene promoter sequence UMPRO.Chitin biosynthesizing is a synthesis path very important in fungal cell, and its disappearance can affect the activity of fungal cell to a great extent.So, based on to the activity influence of UMPRO promotor as target, there is good practicality;
2, screening model of the present invention selects the unicellular bacterial strain of stably express UMPRO promoter activity, and the selection result has feature homogeneous, reliable, efficiently rapid, easy and simple to handle, can meet the requirement of high flux screening;
3, screening model of the present invention selects luciferase as reporter gene, by this detection system, according to the activity of luciferase intensity reaction promotor UMPRO, and then display compound is to the restraining effect of chitin synthetase promotor, highly sensitive, effect is directly perceived;
4, screening model of the present invention can be applicable to different compound, and comprise one or more in natural compounds, synthetic compound, organic molecule, inorganic molecules, carbohydrate, lipid, its applied range, screening efficiency are high, chance of success is large.
5, in this research, screening target is locked in the upstream regulatory sequence of chitin synthetase, is different from the research at present to chitinase inhibitors, brand-new design can improve the potential obtaining benzoylurea derivertives application greatly.
Accompanying drawing illustrates:
The structure of Fig. 1-Ppic9KG-UMPRO-LUC recombinant plasmid
The detection of Fig. 2-GS115-UMPRO-LUC monoclonal cell strain fluorescein expression intensity
Fig. 3-compound F 17-hydroxy-corticosterone 1-F10 relative fluorescence element enzyme detected result
Embodiment:
Describe the present invention below in conjunction with drawings and Examples, but described content is explanation of the invention instead of restriction.
The structure of " embodiment 1 " Ppic9kG-UMPRO-LUC recombinant plasmid
1.1 design of primers
UMPRO-F：GAAGATCTTGTAGCATGTACCTTGGTCGAGCCA
UMPRO-R：CGAGCTCAGCAAGCGAAAAGCCTCCCATG
LUC-F：TACGTAATGGAAGATGCCAAAAACATTAAGA
LUC-R：ATAAGAATGCGGCCGCTAAACTATTTAGACGTTGATCCTGGCGCTG
The acquisition of 1.2 reorganization carrier Ppic9KG
By Ppic9K carrier (purchasing in Invitrogen) via after the process of BgIII and SacI (purchasing in Takara) double digestion, run glue, purifying recovery fragment length is the fragment of about 9000bp, obtain reorganization carrier, called after Ppic9KG;
The acquisition of 1.3UMcsh5 gene promoter sequence UMPRO
No. NCBIGenbank is utilized to be about 1500bp for promoter region sequence before the UMcsh5 gene in NC_026483Ustilagomaydis521chromosome6, application primerprimer5.0 primer-design software, primer UMPRO-F and UMPRO-R of design UMPRO promotor, with the promoter sequence UMPRO of synthetic (entrusting the synthesis of calm and peaceful Bioisystech Co., Ltd of Sino-U.S.) for template carries out PCR, amplification obtains the promoter sequence UMPRO of object fragment UMcsh5 gene, and utilize agarose gel electrophoresis to identify PCR primer, acquisition two ends are contained BgIII and SacI restriction enzyme site object product and are about 1500bp.
The acquisition of 1.4 luciferase reporter genes (LUC)
Application primerprimer5.0 primer-design software, amplimer LUC-F and LUC-R of design luciferase reporter gene (LUC), with pGL4.17 (purchasing in promega company) for template carries out PCR, amplification obtains object fragment and is about 1780bp luciferase reporter gene (LUC), and utilizes agarose gel electrophoresis to identify PCR primer;
1.5 structures carrying the recombinant plasmid of luciferase reporter gene
By the promoter sequence UMPRO of acquisition in 1.3 after the process of BgIII and SacI double digestion, purifying reclaims, and it is connected with the reorganization carrier Ppic9kG obtained in 1.2, ligation liquid is transformed in bacillus coli DH 5 alpha competence (purchasing in Beijing Quanshijin Biotechnology Co., Ltd), on LB solid medium, be inverted cultivation 16 ~ 20h for 37 DEG C, picking amicillin resistance positive monoclonal, extract plasmid DNA, the technology preliminary evaluation positive colony such as utilize bacterium colony PCR, enzyme is cut, obtain recombinant plasmid, called after Ppic9KG-UMPRO; Subsequently, the recombinant plasmid Ppic9KG-UMPRO of extraction is connected after SnaBI and NotI double digestion with the LUC gene obtained in 1.4, connecting fluid is proceeded in bacillus coli DH 5 alpha competence, on solid medium, be inverted cultivation 16 ~ 20h for 37 DEG C, picking amicillin resistance positive monoclonal, extracts plasmid DNA.The technology preliminary evaluation positive colony such as utilize bacterium colony PCR, enzyme is cut, obtains recombinant plasmid, called after Ppic9kG-UMPRO-LUC.Fig. 1 is shown in by the structure of recombinant plasmid.
The screening of the monoclonal cell strain GS115-UMPRO-LUC of " embodiment 2 " stably express UMPRO promotor.
2.1 Pichia pastoris GS115 electricity transform
2.1.1, in the 50ml centrifuge tube containing 5mlYPD, cultivate pichia spp, 30 DEG C are spent the night;
2.1.2 get 0.1-0.5ml overnight culture, inoculation is containing the 2L shaking flask of 500ml fresh culture, and overnight growth is to OD600=1.3-1.5;
2.1.3 at 4 DEG C, 1500 centrifugal 5min collecting cells, the aqua sterilisa suspension cell of 500ml precooling;
2.1.4 as above centrifugal, with the aqua sterilisa suspension cell of 250ml precooling;
2.1.5 as above centrifugal, with the 1M sorbyl alcohol suspension cell of 20ml precooling;
2.1.6 as above centrifugal, with the 1M sorbyl alcohol suspension cell of 1ml precooling, be about 1.5ml to final volume;
2.1.7 get the above-mentioned cell of 80ul to mix with 5 ~ 20ug linearizing DNA (being dissolved in 5 ~ 10ulTE), proceed in the 0.2cm electricity revolving cup of precooling;
2.1.8 5min is placed on ice;
The yeast saccharomyces cerevisiae parameter of 2.1.9 recommending according to institute's using appts is clicked;
Content, in cup, is transferred in sterile centrifugation tube by the 1M sorbyl alcohol 2.1.10 adding 1ml precooling immediately;
2.1.11 be divided into 200 ~ 600ul equal portions, be applied on MD substratum (purchasing in Qingdao topology biotechnology company limited) flat board;
2.1.12 flat board is hatched to cloning generation at 30 DEG C.
The screening of the monoclonal cell strain GS115-UMPRO-LUC of 2.2 stably express UMPRO promotors
Single bacterium colony in picking 2.1, to containing on the YPD-Geneticin flat board of different geneticin concentrations, hatches 3-4 days for 30 DEG C, screening geneticin resistant clone.Geneticin resistant mono-clonal is transferred in 96 orifice plates, every hole adds 200ulYPD substratum, cultivate after 48 hours, 4000rpm centrifugal treating 30min, getting supernatant 100ul is afterwards transferred in 96 new orifice plates, lucifuge adds luciferase test agent (LARII), with luciferase reporter gene detection system (
repoterAssaySystem, Promega) detect, record Photinus pyralis LUC reading.Take out 96 hole blanks, lucifuge adds 50ul/ hole Stop & Glo reagent, buries in oblivion Photinus pyralis LUC reaction, activates renilla luciferase reaction simultaneously, record renilla luciferase reading.With Photinus pyralis LUC reading divided by renilla luciferase reading, average, ask standard error, be respectively negative and blank with the GS115 and blank cultures that do not proceed to recombinant plasmid.The detected result of GS115-UMPRO-LUC monoclonal cell strain fluorescein expression intensity is shown in Fig. 2.Test in triplicate, obtain the monoclonal cell strain of stably express UMPRO promotor.
The application of " embodiment 3 " drug screening
By monoclonal cell strain GS115-UMPRO-LUC according to every hole 2 × 10
4individual cell is laid on 96 orifice plates, add candidate compound F1-F10 (50ug/ml) (being selected from the compound library that laboratory builds), not add candidate compound and YPD substratum as positive and blank, often organize the multiple hole of Setup Experiments three, act on after 48 hours, the centrifugal 30min of 4000rpm, draws supernatant 100ul and is transferred in 96 new orifice plates, add luciferase substrate (Bright-Glo
tMluciferaseAssaySystem) 50ul/ hole, detects after leaving standstill 1min.Result shows, and after adding compound F 17-hydroxy-corticosterone 7 (phosphodiester analog derivative), it is the most weak that GS115-UMPRO-LUC cell strain produces fluorescence, shows that F7 is the strongest to UMPRO promoter activity restraining effect, sees Fig. 3.
Claims (6)
1. the chitin synthetase of a target fungal cell wall lowers agent high flux screening model, it is characterized in that, described model by chitin synthetase UMcsh5 gene promoter sequence UMPRO, carry luciferase reporter gene recombinant plasmid Ppic9KG-UMPRO-LUC, the monoclonal cell strain GS115-UMPRO-LUC of stably express UMPRO promotor, screening reagent and luciferase reporter gene detection system and form.
2. screening model according to claim 1, is characterized in that, chitin synthetase is selected from fungal cell when starting in the cycle, the CS3 (IV class) of the site synthesis chitin ring that sprouts at cell.
3. screening model according to claim 1, is characterized in that, chitin synthetase UMcsh5 gene promoter sequence UMPRO is the DNA sequence dna shown in SEQIDNo1.
4. build the method for screening model described in claim 1, it is characterized in that, Ppic9k carrier is obtained reorganization carrier Ppic9KG through the process of BgIII and SacI double digestion; According to NCBIGenbankNC_026483UMcsh5 gene promoter region sequence design primer, carry out PCR with the promoter sequence UMPRO of synthetic for template, Ppic9KG and UMPRO is connected, obtain recombinant plasmid Ppic9KG-UMPRO; Apply primerprimer5.0 primer-design software again, the primer of design luciferase reporter gene, PCR is carried out with pGL4.17 template, obtain luciferase reporter gene, be connected with recombinant plasmid Ppic9KG-UMPRO through SnaBI with NotI double digestion, obtain recombinant plasmid Ppic9KG-UMPRO-LUC; Recombinant plasmid electricity is proceeded in Pichia pastoris GS115, through not containing the screening culture medium of Histidine and the two screening of substratum containing Geneticin, according to luciferase reporter gene detected result, obtain the monoclonal cell strain GS115-UMPRO-LUC that expression intensity is the highest.
5. the application in agent high flux screening lowered by model described in claim 1 at fungal cell wall chitin synthetase, it is characterized in that, described application is in GS115-UMPRO-LUC monoclonal cell strain culturing process, add candidate compound, act on after 24 hours, utilize and according to luciferase reporter gene fluorescence intensity, react the activity of promotor UMPRO, and then screening there is inhibiting drug candidate to chitin synthetase.
6. application according to claim 5, is characterized in that, described candidate compound is selected from one or more in natural compounds, synthetic compound, organic molecule, inorganic molecules, carbohydrate, lipid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510543219.0A CN105087630B (en) | 2015-08-28 | 2015-08-28 | Adjust cell screening model under a kind of targeting fungal cell wall chitin synthetase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510543219.0A CN105087630B (en) | 2015-08-28 | 2015-08-28 | Adjust cell screening model under a kind of targeting fungal cell wall chitin synthetase |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105087630A true CN105087630A (en) | 2015-11-25 |
| CN105087630B CN105087630B (en) | 2019-01-15 |
Family
ID=54568962
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510543219.0A Active CN105087630B (en) | 2015-08-28 | 2015-08-28 | Adjust cell screening model under a kind of targeting fungal cell wall chitin synthetase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105087630B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114891708A (en) * | 2022-05-26 | 2022-08-12 | 四川大学 | Luciferase reporter gene strain for monitoring up-regulation of gtfD and ftf gene level expression, preparation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1428432A (en) * | 2002-11-25 | 2003-07-09 | 中山大学 | Yeast model for screening insect chitin synthetase inhibitor, its construction method and application |
| CN102174472A (en) * | 2011-01-14 | 2011-09-07 | 中国医学科学院医药生物技术研究所 | Model for screening medicament for resisting myocardial hypertrophy as well as construction and applications thereof |
| CN104232588A (en) * | 2014-09-12 | 2014-12-24 | 中国医学科学院医药生物技术研究所 | Construction and application of anti-hepatic fibrosis drug high-throughput screening cell model |
-
2015
- 2015-08-28 CN CN201510543219.0A patent/CN105087630B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1428432A (en) * | 2002-11-25 | 2003-07-09 | 中山大学 | Yeast model for screening insect chitin synthetase inhibitor, its construction method and application |
| CN102174472A (en) * | 2011-01-14 | 2011-09-07 | 中国医学科学院医药生物技术研究所 | Model for screening medicament for resisting myocardial hypertrophy as well as construction and applications thereof |
| CN104232588A (en) * | 2014-09-12 | 2014-12-24 | 中国医学科学院医药生物技术研究所 | Construction and application of anti-hepatic fibrosis drug high-throughput screening cell model |
Non-Patent Citations (1)
| Title |
|---|
| CAROL A.MUNRO ET AL.: "The PKC, HOG and Ca2+ signalling pathways co-ordinately regulate chitin synthesis in Candida albicans", 《MOLECULAR MICROBIOLOGY》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114891708A (en) * | 2022-05-26 | 2022-08-12 | 四川大学 | Luciferase reporter gene strain for monitoring up-regulation of gtfD and ftf gene level expression, preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105087630B (en) | 2019-01-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yu et al. | Effects of elevated carbon dioxide on environmental microbes and its mechanisms: A review | |
| Raddadi et al. | Biotechnological applications of extremophiles, extremozymes and extremolytes | |
| Maassen et al. | Influence of carbon and nitrogen concentration on itaconic acid production by the smut fungus Ustilago maydis | |
| Barone et al. | Marine metagenomics, a valuable tool for enzymes and bioactive compounds discovery | |
| Pongcharoen et al. | High temperature alcoholic fermentation by new thermotolerant yeast strains Pichia kudriavzevii isolated from sugarcane field soil | |
| Zeng et al. | Biological characteristics of energy conversion in carbon fixation by microalgae | |
| Scoma et al. | Acclimation to hypoxia in Chlamydomonas reinhardtii: can biophotolysis be the major trigger for long‐term H2 production? | |
| CN106635937A (en) | Genetic engineering strain high in yield of phenazine-1-formamide and construction method thereof | |
| Hülsen et al. | Naturally illuminated photobioreactors for resource recovery from piggery and chicken-processing wastewaters utilising purple phototrophic bacteria | |
| Price | Microbial genesis, life and death in glacial ice | |
| Matsudo et al. | Photosynthetic efficiency and rate of CO2 assimilation by Arthrospira (Spirulina) platensis continuously cultivated in a tubular photobioreactor | |
| Jung et al. | Opportunity and challenge of seaweed bioethanol based on life cycle CO2 assessment | |
| Zhao et al. | Metabolic engineering of fungal strains for efficient production of cellulolytic enzymes | |
| Wang et al. | Treatment of fishery wastewater by co-culture of Thalassiosira pseudonana with Isochrysis galbana and evaluation of their active components | |
| Kusumaningtyas et al. | Enhanced oil production by the tropical marine diatom Thalassiosira Sp. cultivated in outdoor photobioreactors | |
| CN105087630A (en) | Target fungus cytoderm chitin synthetase decreasing agent cell screening model | |
| Bulgari et al. | Solid-State Fermentation of Trichoderma spp.: A New Way to Valorize the Agricultural Digestate and Produce Value-Added Bioproducts | |
| CN104046567A (en) | Microalgae cultivation method and grease production method | |
| Lu et al. | Preparation of protoplasts from Chlorella protothecoides | |
| Lin et al. | Purification and characterization of xylanase from spent mushroom compost and its application in saccharification of biomass wastes | |
| CN204682179U (en) | A kind of benthic mollusca breeding cage | |
| CN104789473A (en) | Non-permeating protective agent for frozen preservation of microalgae | |
| Schmoll et al. | Resistance marker-and gene gun-mediated transformation of Trichoderma reesei | |
| CN105217799A (en) | A kind of industrial fermentation method of molten algae streptomycete active substance | |
| Rodrigues Reis et al. | The application of microbial consortia in a biorefinery context: Understanding the importance of artificial lichens |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |