CN105087583B - Disturb siRNA, carrier and the application of pig PACAP gene expressions - Google Patents
Disturb siRNA, carrier and the application of pig PACAP gene expressions Download PDFInfo
- Publication number
- CN105087583B CN105087583B CN201510481926.1A CN201510481926A CN105087583B CN 105087583 B CN105087583 B CN 105087583B CN 201510481926 A CN201510481926 A CN 201510481926A CN 105087583 B CN105087583 B CN 105087583B
- Authority
- CN
- China
- Prior art keywords
- pacap
- pig
- sirna
- shrna
- carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of siRNA and its shRNA for disturbing pig PACAP gene expressions and the pig PACAP genes interference carrier using the shRNA lentivirus mediateds built and applications.The siRNA and shRNA of affiliated interference pig PACAP gene expressions, sequence is respectively as shown in SEQ ID No.1 and 2.The siRNA that the present invention designs can effectively reduce the expression of PACAP genes and albumen, utilize the pig PACAP gene RNA interference carriers of the lentivirus mediated of its shRNA structures, the expression of PACAP genes in the cell can be significantly reduced, Research foundation is provided for research pig GH regulation and control, the high lean meat percentage pig of transgenosis.
Description
(1) technical field
It is built the present invention relates to the siRNA and its shRNA of a kind of interference pig PACAP gene expressions and using the shRNA
Lentivirus mediated pig PACAP genes interference carrier and application.
(2) background technology
Slow virus carrier is a kind of retroviral vector, high with its transfection efficiency, can infect division stage and nondividing phase
Cell, the advantages that larger genetic fragment can be accommodated, by the ideal carrier as transfer target gene.And RNA interference skills
Art is to develop rapidly a kind of new skill that can specifically reject specific gene or inhibit specific gene expression in recent years
Art is widely used in the treatment of the diseases such as viral infection, angiocardiopathy, tumour.The RNA of lentivirus-mediated is done
It disturbs, is to combine the characteristic of slow virus carrier efficient infection with the RNA effects that specificity is disturbed to inhibit homologous gene expression,
It is expected to provide new means and method for the function of specific gene and the Therapy study of relevant disease.
Pituitary adenylate cyclase activating peptide (PACAP) is synthesized and secreted by hypothalamus, has different physiological roles, wherein
The release of stimulating growth hormone (GH) is one of its critical function.It is disturbed and carried using the pig PACAP gene RNAs of lentivirus mediated
Body can significantly reduce the expression of PACAP genes in the cell, be provided for research pig GH regulation and control, the high lean meat percentage pig of transgenosis
Research foundation.
(3) content of the invention
Disturb the siRNA and its shRNA of pig PACAP gene expressions and utilization should it is an object of the present invention to provide a kind of
The pig PACAP genes interference carrier of the lentivirus mediated of shRNA structures and application.
The technical solution adopted by the present invention is：
The siRNA of pig PACAP gene expressions is disturbed, sequence is as shown in SEQ ID No.1：5’-GCTACAGCCGCTATC
GGAAACAAAT-3’.The interference sequence is engineer, can effectively reduce the table of aim cell PACAP genes and albumen
It reaches, fluorescent quantitative PCR result shows that the expression quantity of PACAP genes has dropped 90%, Western blot the results show PACAP eggs
White expression quantity has dropped 88%.
The shRNA of pig PACAP gene expressions is disturbed, sequence is as shown in SEQ ID No.2：5’-GATCGCTACAGCCGC
TATCGGAAACAAATTTCAAGAGAATTTGTTTCCGATAGCGGCTGTAGCTTTTTTC-3’.Due to being introduced directly into external source
Its action time is limited if siRNA (generally there was only several days), it is necessary to which the siRNA for stablizing expression just has shRNA, shRNA to be
Add what is formed after the preceding paragraph sequence, intermediate plus the preceding paragraph loop sequences on two sections of siRNA both sides of design, it may be connected to carry
On body and pass through carrier can enter cell in stablize expression form.
The invention further relates to the pig PACAP gene interference carriers of the lentivirus mediated using shRNA structures, by described
ShRNA insertion pLV-U6-Zsgreen carriers in obtain, the pLV-U6-Zsgreen vector plasmids collection of illustrative plates as shown in Figure 1, its
Middle U6 promoters Hou Wei MCS areas, purpose segment shRNA insertion BamHI, EcoRI sites.
The invention further relates to applications of the siRNA in pig growth hormone regulation and control.
The invention further relates to applications of the siRNA in the high lean meat percentage pig of transgenosis is cultivated.
The beneficial effects are mainly as follows：The siRNA that the present invention designs can effectively reduce PACAP genes and egg
White expression using the pig PACAP gene RNA interference carriers of the lentivirus mediated of its shRNA structures, can significantly reduce
The expression of PACAP genes in the cell provides Research foundation for research pig GH regulation and control, the high lean meat percentage pig of transgenosis.
(4) illustrate
Fig. 1 is pLV-U6-Zsgreen interference carrier plasmid maps；
Fig. 2 is PACAP shRNA1 sequencing results；
Fig. 3 is PACAP shRNA2 sequencing results；
Fig. 4 is PACAP shRNA3 sequencing results；
Fig. 5 measures slow virus titre figure for limiting dilution assay；
Fig. 6 is fluorescent quantitative PCR result；
Fig. 7, Fig. 8 are Western Blotting results.
(5) specific embodiment
With reference to specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in
This：
Embodiment 1：PACAP shRNA slow virus carriers are built
1.1 experiment material
(1) carrier and target gene information：
1) pLV-U6-Zsgreen interference carriers (being stored in Zhejiang University's Animal Genetics, Breeding and Reproduction laboratory) collection of illustrative plates
It is MCS (multiple cloning sites) area after U6 promoters such as Fig. 1, BamHI and EcoRI are insertion point：
2) purpose segment insertion BamHI, EcoRI sites are expressed by U6 promoter regulations, contained in the slow virus carrier
The Zsgreen marks of CMV promoter regulation and control.
3) interference sequence design is as follows：
PACAP siRNA1 sequences：GCTGGTCTACGGGATAATAAT
PACAP shRNA1 sequences：
PACAP siRNA2 sequences：GCTACAGCCGCTATCGGAAACAAAT
PACAP shRNA2 sequences：
PACAPsiRNA3 sequences：CGGAAACAAATGGCTGTTAAGAAAT
PACAPshRNA3 sequences：
1.2 experiment flow
The structure of PACAP shRNA
1.2.1 primer synthesizes
1.2.2 carrier pLV-U6-Zsgreen BamHI, EcoRI double digestion, digestion system are as follows：
1.2.3 glue recycles after the completion of digestion
1.2.4 the segment shRNA of mesh is obtained using 3 ' and 5 ' single-stranded annealing：
System：20ul
10×Buffer：2ul
100mM Tris-cl pH7.5
1M NaCl
10mM EDTA
shDNA-R/shDNA-F：1/1ul
H2O：16ul
Cycle of annealing：
1.2.5 the target fragment shRNA handled well and carrier pLV-U6-Zsgreen coupled reaction systems：
Above connection liquid is stayed overnight at 4 DEG C.
1.2.6 convert (competent cell:DH5a)
Resistance:Amp；37 DEG C, overnight incubation
1.2.7 the PACAP shRNA tablets after converting choose bacterium, 37 DEG C 250 revs/min shake bacterium 14 it is small when, by bacterium solution
Sequencing.
1.3 experimental result：
Sequencing result is as follows：
PACAP shRNA1 sequencing results (referring to Fig. 2, underscore part is shRNA1 sequences)：TTTATATATCTTGT
GGAAAGGACGAGGATCGCTGGTCTACGGGATAATAATTTCAAGAGAATTATTATCCCGTAGACCAGCTTTTTTCAAT
TCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTAC
GGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAA
CGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTG
TATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGAC
CTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGT
ACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTG
TTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCG
TGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGTCGCCACCAT
GGCCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCATGAAGTACCGCATGGAGGGCTGCGTGGACGGCCACAAGT
TCGTGATCACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGGTGGAGGGCGGC
CCCTTGCCCTTCGCCGAGGACATCTTGTCCGCCGCCTTCATGTACGGCAACCGCGTGTTCACCGAGTACCCCCAGGA
CATCGTCGACTACTTCAAGAACTCCTGCCCCGCCGGCTACACCTGGGACGCT
PACAP shRNA2 sequencing results (referring to Fig. 3, underscore part is shRNA2 sequences)：AAAGGACGAGGATC GCTACAGCCGCTATCGGAAACAAATTTCAAGAGAATTTGTTTCCGATAGCGGCTGTAGCTTTTTTCAATTCTAGTTA
TTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATG
GCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATA
GGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATAT
GCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGG
ACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAAT
GGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCA
CCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGT
GGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGTCGCCACCATGGCCCAGT
CCAAGCACGGCCTGACCAAGGAGATGACCATGAAGTACCGCATGGAGGGCTGCGTGGACGGCCACAAGTTCGTGATC
ACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGGTGGAGGGCGGCCCCTTGCC
CTTCGCCGAGGACATCTTGTCCGCCGCCTTCATGTACGGCAACCGCGTGTTCACCGAGTACCCCCAGGACATCGTCG
ACTACTTCAAGAACTCCTGCCCCGCCGGCTACACCTGG
PACAP shRNA3 sequencing results (referring to Fig. 4, underscore part is shRNA3 sequences) TTGGCTTTATATAT
CTTGTGGAAAGGACGAGGATCGCGGAAACAAATGGCTGTTAAGAAATTTCAAGAGAATTTCTTAACAGCCATTTGTT TCCGTTTTTTCAATTCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGC
GTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTA
TGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGG
CAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTAT
GCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGAT
GCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACG
TCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAA
ATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTA
CCGGTCGCCACCATGGCCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCATGAAGTACCGCATGGAGGGCTGCGT
GGACGGCCACAAGTTCGTGATCACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCG
TGGTGGAGGGCGGCCCCTTGCCCTTCGCCGAGGACATCTTGTCCGCCGCCTTCATGTACGGCAACCGCGTGTTCACC
GAGTACCCCCAGGACATCGTCGACTACTTCAAGAACTCCTGCCCCGCCGGCTACACCTGGGACCGCCTCCTCCTGGT
Embodiment 2：Slow virus is packed
1st, experiment flow
It prepares slow virus shuttle plasmid and its auxiliary packaging original paper vector plasmid, three plasmid vectors carries out high-purity respectively
Endotoxin-free extracts, cotransfection 293T cells, and 6h is changed to complete medium after transfection, and after cultivating 48h and 72h, collection is rich in
The cell supernatant of lentiviral particle, 0.45um filters (Millpore companies) filter virus supernatant, vial supernatant pass through
Ultracentrifugation concentrating virus.The slow virus concentrate of high titre is obtained after being concentrated to it.
2nd, experiment material
Slow virus carrier, incasing cells and bacterial strain
The Viral Packaging System is three pUC pUCs, is formed as pSPAX2, pMD2G, pLV-U6-Zsgreen.
293T growth mediums are DMEM (containing 10%FBS).
Bacterial strain is competent cell：DH5a
3rd, specific steps
3.1 plasmid amplification
The slow virus carrier and helper plasmid built need to pass through a large amount of extractings, and concentration is more than 1ug/ul, and A260/280 exists
It can be wrapping poison between 1.7~1.8.
3.2 pass 293T cells
The culture medium cultivated in T75 bottles of 293T cells is exhausted, 0.25% pancreatin that 4 degree of refrigerators of 2mL take out is added in, makes
Its uniform fold bottom of bottle is placed in 3-5min in 37 degree of incubators, takes out, and rocking can find that cell departs from bottom, by its whole
Under rolling, the 10%DMEM preheated in 37 degree of water-baths of 3mL is added in, liquid-transfering gun is blown and beaten with 10mL pipettes, blows and beats 6- more energetically
8 times, dead angle is not stayed, pipette can be directed at training mouth by the more difficult piping and druming of bottle mouth position, and culture medium is got and can covered by small power
Close to the cell of bottleneck.Afterwards, all cells are suctioned out, be placed in 15mL centrifuge tubes, take the cell after 50ul mixings in 1.5mL
In eppendorf pipes, 450ul 10%DMEM are added in, are 10 times of dilutions, mixing takes 10ul cells to be counted in tally.
Totally 4 big lattice on tally, per big 16 small lattice of lattice.During counting, 4 big lattice count, sum divided by 4 (obtaining per big lattice cell number), then
10 (10 times of dilutions) are multiplied by, are actual ten thousand/mL of n cell concentrations.The passage same day is denoted as first day, if second day is transfected,
Spread ten thousand/T75 of 900-1000；If the 3rd day transfects, ten thousand/T75 of paving 350-400.Every bottle of T75 adds 10mL 10%DMEM culture mediums.Turn
Dye same day observation cell density, 80-90% can completely be transfected.Culture medium need not be changed before transfection.
3.3, which do fat, turns complex
Opti MEM need to be preheated in 37 degree of water-baths, and transfection reagent recovers to room temperature to use, and needs to shake up before use.
The complex ingredients for transfecting every bottle of T75 are as follows：
pSPAX2 10μg
pMD2G 10μg
10 μ g of pLV carriers
6h renews fresh training liquid after transfection.
3.4 collection virus
48 and 72h collects viral supernatants (collecting the fresh training liquid of rear substitution for 24 hours) twice respectively after transfection, with 0.45 after collection
The filtering of μm filter, in 40mL ultracentrifugation pipes, 4 DEG C, 72000g/min is centrifuged 120 minutes；
3.5 viruses are resuspended and preserve
Viral pellet is resuspended in 500ul fresh mediums, is placed in -80 degree and preserves.
3.6 titer determinations (dilution method of counting)：
I. cell prepares
1x10 is diluted to after the good 293T cell dissociations of growth conditions are counted4/ ml, 96 orifice plates of addition, 100ul/ holes,
Prepare 6 holes for each virus.37 DEG C are put into, 5%CO2It is cultivated in incubator.
II. it is plus viral
Second day, 3 times of gradient dilutions, continuous 6 dilution factors are done in EP pipes.Dilution process is as follows：
1) each virus prepares 6 1.5mlEP pipes, and the first pipe adds in 105ul culture solutions and 15ul virus stock solution useds；
2) 40ul is drawn from first pipe add in second pipe (containing 80ul culture solutions) after mixing；
3) draw 40ul from second pipe after mixing and add in the 3rd pipe (containing 80ul culture solutions)；
4) and so on, it is 6 dilution factor (10~3.3*10^-2), often it will add in corresponding 96 hole by pipe liquid after dilution is good
In.
III. observe result and calculate titre
5th day, in fluorescence microscopy Microscopic observation as a result, fluorescence percentage calculates virus titer in 10~30% hole：Drop
Spend (PFU/ml)=cell number * fluorescence percentage * MOI (1) * viral dilution multiple * 10^3.Titre results figure is shown in Fig. 5.
Titre results：Lv-PACAPsh1,2,3 titres are 1 × 108PFU/ml, control group virus titer for 2 ×
108PFU/ml.Illustrate that the virus titer through slow virus packaging is higher, available for Subsequent infection aim cell.
3.7 slow-virus infection aim cells：
Method：Before transfection for 24 hours, by aim cell (Large White fetal fibroblast) with 105/ ml density is inoculated in 12 holes
In plate, cell density is made to be transfected when reaching 60%~70%.Disease is prepared with the MOI values of every hole 500ul culture solutions and cell
Malicious rotaring redyeing system (per hole 100ul virus liquids), sucks original culture medium, the mixed liquor of Fresh is added in per hole, in 37 DEG C,
5%CO2Continue to cultivate in incubator, cell growth state and green fluorescence expression are observed after transfecting 48h.
As a result：In three interference sequences of design, although PACAPshRNA1 and shRNA3 can make PACAP genes and albumen
Expression quantity declines, but interference effect unobvious.PACAP shRNA2 can effectively reduce aim cell PACAP genes and egg
White expression, fluorescent quantitative PCR result (Fig. 6) show that PACAP shRNA2 interference sequences can make under the expression quantity of PACAP genes
It has dropped 90%, Western blot results (Fig. 7,8) and has shown that PACAP shRNA2 infection sequence declines PACAP expressing quantities
88%, therefore the pig PACAP gene RNA interference carriers of the lentivirus mediated using its structure, PACAP bases can be significantly reduced
Because of expression in the cell, Research foundation is provided for research pig GH regulation and control, the high lean meat percentage pig of transgenosis.
Claims (2)
1. a kind of siRNA for disturbing pig PACAP gene expressions, sequence is as shown in SEQ ID No.1.
2. a kind of shRNA for disturbing pig PACAP gene expressions, sequence is as shown in SEQ ID No.2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510481926.1A CN105087583B (en) | 2015-08-07 | 2015-08-07 | Disturb siRNA, carrier and the application of pig PACAP gene expressions |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510481926.1A CN105087583B (en) | 2015-08-07 | 2015-08-07 | Disturb siRNA, carrier and the application of pig PACAP gene expressions |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105087583A CN105087583A (en) | 2015-11-25 |
| CN105087583B true CN105087583B (en) | 2018-05-25 |
Family
ID=54568916
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510481926.1A Active CN105087583B (en) | 2015-08-07 | 2015-08-07 | Disturb siRNA, carrier and the application of pig PACAP gene expressions |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105087583B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101356191A (en) * | 2005-11-22 | 2009-01-28 | 遗传工程与生物技术中心 | Neuropeptides for the culture of aquatic organisms |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050129687A1 (en) * | 2003-11-03 | 2005-06-16 | University Of Vermont And State Agricultural College | Use of inhibitors of PACAP receptor activity for treatment of overactive bladder and pelvic floor pain syndrome |
-
2015
- 2015-08-07 CN CN201510481926.1A patent/CN105087583B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101356191A (en) * | 2005-11-22 | 2009-01-28 | 遗传工程与生物技术中心 | Neuropeptides for the culture of aquatic organisms |
Non-Patent Citations (2)
| Title |
|---|
| Pituitary adenylate cyclase activating peptide(PAPAC) participates in adipogenesis by activating ERK signaling pathway;Tatnaja等;《PLOS ONE》;20130930;第8卷(第9期);摘要部分 * |
| xm_005665307;无;《NCBI:GenBank》;20130926 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105087583A (en) | 2015-11-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107190024A (en) | A kind of construction method of stable expression NS1 albuminous cells strain | |
| CN106350540A (en) | High-efficient inducible type CRISPR/Cas9 gene knockout carrier mediated by lentivirus and application thereof | |
| WO2017049759A1 (en) | Recombinant baculovirus and application thereof | |
| CN104830908B (en) | Pseudovirus packaging system and application thereof | |
| CN104877971B (en) | A kind of gland relevant viral vector for the carrying MG53 genes that can alleviate mouse symptoms of heart failure | |
| CN110343157A (en) | Cotton verticillium wilt related gene GhBONI and its coding albumen and application | |
| CN104694576B (en) | A kind of method of IFNAR1 genes in 1 cell lines of silence DF | |
| CN108753822A (en) | Deliver the expression vector and its preparation method and application of pattern of fusion rna binding protein | |
| CN108018264A (en) | A kind of structure and expression using multi-copy gene coexpression baculoviral foreign protein | |
| CN107794244A (en) | Vero pAPN cell lines and preparation method thereof | |
| CN105087583B (en) | Disturb siRNA, carrier and the application of pig PACAP gene expressions | |
| CN108949809A (en) | A kind of method of the carrier mediated Gene Silencing of Fructus Forsythiae blade TRV | |
| CN105624162B (en) | For the siRNA of mammal R-Spondin2 gene targets, ShorthairpinRNA and carrier and application | |
| CN104789532B (en) | A method of the cell strain of expression adenovirus and efficiently preparation adenovirus | |
| CN104531762B (en) | The slow virus carrier and its construction method and application of a kind of RAB7A and EGFP gene overexpression fusion green fluorescent protein | |
| CN110218726A (en) | It is a kind of for inhibiting the shRNA and application thereof of rat Cacna1c gene expression | |
| CN105200059A (en) | SiRNA for targeted inhibition of mouse UCP2 gene expression and construction of expression vector thereof | |
| CN107338269A (en) | Conditionally replicating adenovirus carrier and application of the virus replication by Transcription inhibition type Tet on system regulations | |
| CN105274089B (en) | A kind of construction method for the REV viral infectivities clone for expressing green fluorescence cyst membrane fusion protein | |
| CN105177043B (en) | A kind of preparation method of H7N9 pseudovirus and the application of the H7N9 pseudovirus | |
| CN104789533B (en) | The cell of high efficient expression adenovirus and the method for preparing adenovirus | |
| CN100532544C (en) | Retrovirus encapsulated cell line and liver cell targeted introduction method | |
| CN102051345A (en) | Method for screening influenza virus resisting medicines | |
| CN110387357A (en) | A kind of purification process of the recombinant virus with fluorescent marker | |
| CN103966259B (en) | A kind of restructuring of the siRNA based on J subgroup avian leucosis virus gag gene conserved sequence interference carrier and its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |