CN105087407A - Saccharomyces cerevisiae engineering strain as well as preparation method, application and fermentation culture method thereof - Google Patents
Saccharomyces cerevisiae engineering strain as well as preparation method, application and fermentation culture method thereof Download PDFInfo
- Publication number
- CN105087407A CN105087407A CN201510516170.XA CN201510516170A CN105087407A CN 105087407 A CN105087407 A CN 105087407A CN 201510516170 A CN201510516170 A CN 201510516170A CN 105087407 A CN105087407 A CN 105087407A
- Authority
- CN
- China
- Prior art keywords
- saccharomyces cerevisiae
- pdc5
- pdc6
- gene knockout
- fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of bioengineering, and in particular relates to a saccharomyces cerevisiae engineering strain as well as a preparation method, application and a fermentation culture method thereof. The PDC1, PDC5, PDC6, ADH1 and ADH4 genes of the saccharomyces cerevisiae engineering strain are knocked out, and an LDH gene is inserted into the saccharomyces cerevisiae engineering strain. The saccharomyces cerevisiae engineering strain provided by the invention does not contain an ethanol metabolism main route, a lot of glucose can be used for fermentation so as to accumulate lactic acid, and the strain can grow quickly by using ethanol.
Description
Technical field
The present invention relates to technical field of bioengineering, particularly a kind of saccharomyces cerevisiae engineered yeast strain and preparation method thereof, application, fermentation culture method.
Background technology
Pfansteihl take W-Gum as raw material, and through a kind of organic acid that biological fermentation is refined, be achromaticity and clarification viscous liquid, the aqueous solution shows acid-reaction.Can mix arbitrarily with water, ethanol or ether, insoluble in chloroform.Because of the feature that it is left-handed, there is good bio-intermiscibility, can melt mutually with Mammals, body metabolism, without any side effects can be participated in directly, be widely used in food, medicine and other fields:
Food service industry: be mainly used in candy, in the food-processing industrys such as beverage (as beer, grape wine and lactic acid class beverage), as acidic flavoring agent and taste conditioning agent, is called as the foodstuff additive be perfectly safe.Another also can be used for refreshment drink, the processing of vegetables and preservation;
Pharmaceutical industries: Pfansteihl (L-lacticacid) is a kind of important medicine intermediate, can be used as producing the medicine such as the transfusion of erythromycin ringer's solution, L calcium lactate, L Sodium.alpha.-hydroxypropionate, L zinc lactate, L iron lactate and also can be used as the disinfection sanitizers such as Operation theatre, ward, laboratory;
Makeup: can be used as moisturizing agent, wetting Agent for Printing Inks, skin renewal agent, pH adjusting agent, go acne agent, go the agent of tooth dirt;
Pesticide industry: Pfansteihl has very high biological activity, to farm crop and soil nontoxic, can be used as producing novel environment friendly agricultural chemicals, in the popularization that the developed countries such as Japan and the United States have obtained energetically;
Tobacco industry: add Pfansteihl in right amount, can improve the quality of tobacco, and keeps the humidity of tobacco; Leather manufacture industry: leather can be made soft fine and smooth, thus improve the quality of leather; Textile industry: can be used to process fiber, can easy coloring be made it, increase gloss and soft-touch;
Other industry: except above purposes, Pfansteihl also can be used to produce biodegradable plastic--poly(lactic acid) and green and environment-friendly solvent-L methyl lactate, L ethyl lactate etc.
At present, Pfansteihl mainly adopts fermentation method to synthesize, and it is for raw material with the raw material sucrose containing starch, beet sugar or its molasses.Saccharification access lactobacillus strain.PH controls at 5-5.5, and ferment about temperature 50 C 3-4d, makes the lactic acid of generation be converted into calcium lactate with calcium carbonate.Prevent pH value from reducing and impact fermentation, filtered while hot is separated the solid carbonic acid calcium that exists in solution and calcium hydroxide etc. simultaneously, refines and to obtain calcium lactate.Generate lactic acid and calcium sulfate precipitation with sulfuric acid acidation, filter.Filtrate about contains the crude lactic acid of 10%, is concentrated into 50%.Remove organic impurity with gac again, with yellow prussiate of soda removing heavy metal and concentrated time cohesion impurity.Last spent ion exchange resin removing trace impurity, reconcentration filters and obtains product.But the Pfansteihl purity adopting milk-acid bacteria to carry out fermenting produced is lower, and production cost is higher.Therefore, the purity how improving Pfansteihl becomes the focus of research.
Yeast saccharomyces cerevisiae (Saccharomycescerevisiae), also known as bread yeast or budding yeast.It is one of most popular microorganism in biological production.Yeast saccharomyces cerevisiae is and human relation's primary yeast the most widely, not only because it is for making the food such as bread and steamed bun and wine brewing traditionally, in modern molecular and cytobiology, be used as eucaryon model animals, its effect is equivalent to the model animals intestinal bacteria of protokaryon.Yeast saccharomyces cerevisiae is biological species the most frequently used in fermentation.The cell of yeast saccharomyces cerevisiae is spherical or avette, diameter 5-10 μm.Method of its breeding is gemmation (both can vegetative reproduction also can gemmation).Because it can tolerate lower pH value compared with milk-acid bacteria, required medium component is simple, cheap, becomes the first-selected engineering bacterial strain producing Pfansteihl.
NobuhiroIshida etc. pass through at chromosomal integration cow's milk dehydrogenase gene, and build the S. cervisiae effectively producing Pfansteihl, output can reach 55.6g/L.6 copy cow's milk dehydrogenase gene are incorporated on wine yeast karyomit(e) and build high-yield lactic acid bacterial strain by SatoshiSaitoh etc., and make developing medium with sugar cane juice, and lactic acid production is up to 122g/L.Optical purity reaches 99.9%.Express in the Kluyveromyceslactis that the LDH gene of ox suddenlys change in Pyruvate Decarboxylase Gene by DaniloPorro etc., make lactic acid production reach 109g/L, transgenosis K.lactis bacterial strain improves output under fed-batch fermentation condition greatly.But the above-mentioned biotechnology bacterial strain through transformation also can produce coproduct ethanol except product lactic acid.Due to the consumption of a large amount of carbon source, there is the method for a lot of research metabolic engineering to reduce coproduct ethanol, but failed so far to solve this problem completely.
Summary of the invention
In view of this, the invention provides a kind of saccharomyces cerevisiae engineered yeast strain and preparation method thereof, application, fermentation culture method.This saccharomyces cerevisiae engineered yeast strain is not containing alcohol metabolism main path, and glucose fermentation can be utilized in a large number to accumulate lactic acid, and this bacterial strain can utilize ethanol to grow fast.
In order to realize foregoing invention object, the invention provides following technical scheme:
The invention provides a kind of saccharomyces cerevisiae engineered yeast strain, PDC1, PDC5, PDC6, ADH1, ADH4 gene of saccharomyces cerevisiae engineered yeast strain is knocked, and inserts LDH gene.
Pyruvic carboxylase (PDC) is the Nodes in glycolysis-and fermentation ethanologenic pathway, and conversion of pyruvate is acetaldehyde by it.Three PDC genes (PDC1, PDC5 and PDC6) are had in yeast saccharomyces cerevisiae approach.
Converting acetaldehyde can be ethanol by acetaldehyde dehydrogenase (ADH), is oxidized to NAD along with NADH
+.In yeast saccharomyces cerevisiae, have the isozyme of 6 ADH at least, encoded by ADH1, ADH2, ADH3, ADH4, ADH5, ADH6 and SFA1 respectively.ADH1p becomes ethanol at catalysis acetaldehyde and plays Main Function, and this research finds only to knock out ADH1 and can not suppress alcohol production completely, and the spontaneous chromosome amplification of ADH4 can repair the nonsense mutation of ADH1.
Therefore, in this research, in order to knock out yeast saccharomyces cerevisiae pyruvic acid-acetaldehyde-ethanol pathway, PDC1, PDC5, PDC6, ADH1 and ADH4 has been knocked out.
After knocking out PDC (PDC1, PDC5 and PDC6) and ADH (ADH1 and ADH4), for maintaining born of the same parents' intracellular metabolite balance, carbon source will inevitably flow to other Product formation.So in not producing and ethanol situation, in order to maintain born of the same parents' internal oxidition reduction balance, having introduced external source lactic acid metabolism approach, under lactate dehydrogenase L DH effect, is lactic acid by conversion of pyruvate.The synthesis redox equilibrium of synthesizing lactic acid and ethanol is close, and foreign gene imports minimum, only inserts a gene LDH.After molecular modification, saccharomyces cerevisiae engineered yeast strain of the present invention can utilize glucose lactic acid producing, and not producing and ethanol; This bacterial strain can be only that carbon source grows fast with ethanol.
Saccharomyces cerevisiae engineered yeast strain SyBE_Sc01020039 metabolizable glucose of the present invention not producing and ethanol lactic acid producing, Fig. 1 is shown in by the schematic diagram knocking out ethanol generation pass and insertion external source lactic acid constructive ways.
In embodiments more provided by the invention, yeast saccharomyces cerevisiae is wine brewing bacterial strain BY4741.
Present invention also offers the preparation method of this saccharomyces cerevisiae engineered yeast strain, comprise the steps:
By PDC5, PDC6 gene knockout of yeast saccharomyces cerevisiae, obtain bacterial strain MATa Δ PDC5 Δ PDC6;
Change the mating type of bacterial strain MATa Δ PDC5 Δ PDC6, obtain diploid strains MATa/alpha Δ PDC5 Δ PDC6;
By ADH4, PDC1, ADH1 gene knockout of diploid strains MATa/alpha Δ PDC5 Δ PDC6, and insert LDH gene, obtain bacterial strain a1La4p1p5p6-D, prepare haploid strains, obtain saccharomyces cerevisiae engineered yeast strain.
The preparation method of this saccharomyces cerevisiae engineered yeast strain, specifically comprises the steps:
Build PDC5 gene knockout fragment: a part for the promotor of coding PDC5, terminator, open reading frame and selection markers are connected, obtain PDC5 gene knockout fragment, be designated as Prom_pdc5-Ter_pdc5-Marker_URA3-ORF_pdc5_f ', referred to as Δ PDC5;
Build PDC6 gene knockout fragment: a part for the promotor of coding PDC6, terminator, open reading frame and selection markers are connected, obtain PDC6 gene knockout fragment, be designated as Prom_pdc6-Ter_pdc6-Marker_URA3-ORF_pdc6_f ', referred to as Δ PDC6;
Build ADH4 gene knockout fragment: a part for the promotor of coding ADH4, terminator, open reading frame and selection markers are connected, obtain ADH4 gene knockout fragment, be designated as Prom_adh4-Ter_adh4-Marker_URA3-ORF_adh4_f ', referred to as Δ ADH4;
Build PDC1 gene knockout and LDH Insert Fragment:
The promotor of coding PDC1, terminator, a part for open reading frame, selection markers are connected with the gene of coding LDH, obtain PDC1 gene knockout and LDH Insert Fragment, be designated as Prom_pdc1-ORF_LDH-Ter_pdc1-Marker_URA3-ORF-pdc1_f ', referred to as Δ PDC1 ∷ LDH;
Build ADH1 gene knockout and LDH Insert Fragment:
The promotor of coding ADH1, terminator, a part for open reading frame, selection markers are connected with the gene of coding LDH, obtain ADH1 gene knockout and LDH Insert Fragment, be designated as Prom_adh1-ORF_LDH-Ter_pdc1-Marker_URA3-ORF_pdc1_f ', referred to as Δ ADH1 ∷ LDH;
PDC5 gene knockout fragment, PDC6 gene knockout fragment are transformed in yeast saccharomyces cerevisiae, remove selection markers, obtain MATa Δ PDC5 Δ PDC6;
By HO Plastid transformation MATa Δ PDC5 Δ PDC6, change mating type, obtain diploid strains MATa/alpha Δ PDC5 Δ PDC6;
ADH4 gene knockout fragment, PDC1 gene knockout and LDH Insert Fragment, ADH1 gene knockout and LDH Insert Fragment are transformed into diploid strains MATa/alpha Δ PDC5 Δ PDC6, remove selection markers, obtain bacterial strain and be designated as a1La4p1p5p6-D, prepare haploid strains, obtain saccharomyces cerevisiae engineered yeast strain, be designated as MATa Δ adh1 ∷ Padh1-LDH Δ adh4 Δ pdc6 Δ pdc5 Δ pdc1 ∷ Ppdc1-LDH.
As preferably, selection markers is auxotroph selection markers or antibiotics resistance gene screening mark.
In embodiments more provided by the invention, auxotroph selection markers is URA3 (uridylic) mark.
In embodiments more provided by the invention, lactate dehydrogenase gene LDH derives from Bos Bovine.
In embodiments more provided by the invention, build PDC5 gene knockout fragment, PDC6 gene knockout fragment, ADH4 gene knockout fragment, PDC1 gene knockout and LDH Insert Fragment, ADH1 gene knockout and LDH Insert Fragment promotor used, terminator, open reading frame, selection markers be with the genome of Wine brewing yeast strain BY4741 for template, obtain through PCR reaction amplification.
In embodiments more provided by the invention, yeast saccharomyces cerevisiae is wine brewing bacterial strain BY4741.
Present invention also offers this saccharomyces cerevisiae engineered yeast strain and produce the application in lactic acid.
Present invention also offers the fermentation process of this saccharomyces cerevisiae engineered yeast strain, this fermentation process is: saccharomyces cerevisiae engineered yeast strain of the present invention is that carbon source is fermented with glucose.
As preferably, the temperature of fermentation is 28 ~ 32 DEG C, and rotating speed is 100 ~ 500rpm.
In embodiments more provided by the invention, the temperature of fermentation is 30 DEG C, and rotating speed is 200rpm.
In embodiments more provided by the invention, fermentation used medium is YPD substratum.
As preferably, YPD culture medium prescription is: glucose 10 ~ 200g/L, yeast powder 5 ~ 15g/L, peptone 15 ~ 25g/L.
In embodiments more provided by the invention, YPD substratum also comprises: calcium carbonate 1 ~ 5g/L.
In embodiments more provided by the invention, YPD culture medium prescription is: glucose 22g/L, yeast powder 10g/L, peptone 20g/L, calcium carbonate 3g/L.
In other embodiments provided by the invention, YPD culture medium prescription is: glucose 110g/L, yeast powder 10g/L, peptone 20g/L.
Present invention also offers the cultural method of this saccharomyces cerevisiae engineered yeast strain, this cultural method is: saccharomyces cerevisiae engineered yeast strain of the present invention is that carbon source is cultivated with ethanol.
As preferably, in this cultural method, the temperature of cultivation is 28 ~ 32 DEG C, and rotating speed is 100 ~ 500rpm.
In embodiments more provided by the invention, the temperature of cultivation is 30 DEG C, and rotating speed is 200rpm.
In embodiments more provided by the invention, cultivating used medium is YPE substratum.
As preferably, YPE culture medium prescription is: ethanol 10 ~ 50mL/L, yeast powder 5 ~ 15g/L, peptone 15 ~ 25g/L.
Preferably, YPE culture medium prescription is: ethanol 20mL/L, yeast powder 10g/L, peptone 20g/L.
Present invention also offers the acclimation method of this saccharomyces cerevisiae engineered yeast strain, this acclimation method is:
By saccharomyces cerevisiae engineered yeast strain of the present invention after YPE liquid nutrient medium activation at least twice, then bacterial strain is transferred to 1 ~ 3 generation of domestication in YPD liquid nutrient medium.
By the bacterial strain after domestication, then be transferred in YPD liquid nutrient medium and can comparatively first-generation growth obviously accelerate, consumption of glucose speed accelerates.Bacterial strain after domestication is saved in YPD flat board and glycerol stock, utilizes the ability of glucose to degenerate fast.
The invention provides a kind of saccharomyces cerevisiae engineered yeast strain and preparation method thereof, application, fermentation culture method.PDC1, PDC5, PDC6, ADH1, ADH4 gene of this saccharomyces cerevisiae engineered yeast strain is knocked, and inserts LDH gene.Saccharomyces cerevisiae engineered yeast strain of the present invention is not containing alcohol metabolism main path, and glucose fermentation can be utilized in a large number to accumulate lactic acid, and this bacterial strain can utilize ethanol to grow fast.Result of study shows: in glucose (100g/L) the YPD liquid nutrient medium that is sole carbon source, can produce the lactic acid of 88g/L, and be all Pfansteihl, not producing and ethanol.In ethanol (15.8g/L) the liquid nutrient medium YPE that is sole carbon source, can grow fast, not lactic acid producing.And fermentation used medium composition is simple, cheap.
Accompanying drawing explanation
Fig. 1 shows that the original strain of bacterial strain SyBE_Sc01020039 knocks out ethanol generation pass and inserts the schematic diagram of external source lactic acid constructive ways; A part glucose produces two molecule pyruvic acid through glycolytic pathway, and metabolism generates lactic acid further;
Fig. 2 shows deletion products Prom_pdc5-Ter_pdc5-Marker_URA3-ORF_pdc5_f ' schematic diagram;
Fig. 3 shows deletion products Prom_pdc6-Ter_pdc6-Marker_URA3-ORF_pdc6_f ' schematic diagram;
Fig. 4 shows deletion products Prom_adh4-Ter_adh4-Marker_URA3-ORF_adh4_f ' schematic diagram;
Fig. 5 shows deletion products Prom_pdc1-ORF_LDH-Ter_pdc1-Marker_URA3-ORF_pdc1_f ' schematic diagram, and wherein lactate dehydrogenase gene LDH (NM_174099) derives from Bostaurus (cattle);
Fig. 6 shows deletion products Prom_adh1-ORF_LDH-Ter_pdc1-Marker_URA3-ORF_pdc1_f ' schematic diagram, and wherein lactate dehydrogenase gene LDH (NM_174099) derives from Bostaurus (cattle);
Fig. 7 shows that Pyruvate Decarboxylase Gene PDC5 knocks out principle schematic;
Fig. 8 shows that Pyruvate Decarboxylase Gene PDC1 knocks out and inserts lactate dehydrogenase gene LDH schematic diagram simultaneously;
Fig. 9 represents the molecular biology checking electrophorogram of aimed strain SyBE_Sc01020039 and wild-type related strain;
Wherein, whether a1L: checking Gene A DH1 knocks out the band that simultaneously LDH inserts, complete, correctly;
A4: whether the band that checking Gene A DH4 knocks out is correct;
Whether p1L: checking gene PDC1 knocks out the band that LDH simultaneously inserts, complete, correctly;
P5: whether checking gene PDC5 knocks out correct;
P6: whether checking gene PDC6 knocks out correct;
The swimming lane of mark WT: BY4741 original strain, does not do gene knockout;
Do not do the swimming lane marked: the correct band of aimed strain;
Figure 10 shows the growth curve of bacterial strain SyBE_Sc01020039 on the shake flask fermentation taking ethanol as sole carbon source;
Figure 11 shows that bacterial strain SyBE_Sc01020039 is in the ethanol consumption curve of shake flask fermentation taking ethanol as sole carbon source;
Figure 12 shows that bacterial strain SyBE_Sc01020039 is at the glucose consumption curve of shake flask fermentation and the lactic acid formation curve that take glucose as sole carbon source;
Figure 13 shows that bacterial strain SyBE_Sc01020039 is at the glucose consumption curve of shake flask fermentation and the lactic acid formation curve that take high concentration glucose as sole carbon source.
Embodiment
The invention discloses a kind of saccharomyces cerevisiae engineered yeast strain and preparation method thereof, application, fermentation culture method, those skilled in the art can use for reference present disclosure, and suitable improving technique parameter realizes.Special needs to be pointed out is, all similar replacements and change apparent to those skilled in the art, they are all deemed to be included in the present invention.Method of the present invention and application are described by preferred embodiment, related personnel obviously can not depart from content of the present invention, spirit and scope methods and applications as herein described are changed or suitably change with combination, realize and apply the technology of the present invention.
In saccharomyces cerevisiae engineered yeast strain provided by the invention and preparation method thereof, application, fermentation culture method, bacterial strain uses therefor, primer, DNA all can be buied by market.
Below in conjunction with embodiment, set forth the present invention further:
The structure of embodiment 1 deletion products
1, foreign gene is synthesized
According to lactate dehydrogenase gene NM_174099 sequence, its DNA of synthetic after J-Cat optimizes.
2, disappearance module is built
With the genome of yeast saccharomyces cerevisiae BY4741 bacterial strain for template, amplification obtains promotor, terminator, the ORF frame each several part of Pyruvate Decarboxylase Gene PDC1, PDC5, PDC6 and acetaldehyde dehydrogenase gene ADH1, ADH4.The amplimer sequence of each several part is specific as follows:
Table 1 amplimer sequence
Obtain the promotor of Pyruvate Decarboxylase Gene PDC5, terminator, nutrition mark URA3 and ORF frame part according to PDC5 relevant primer sequence amplification in table 1, by above-mentioned product through PCR reaction forming to obtaining together lacking module Δ PDC5 as shown in Figure 2.
Obtain the promotor of Pyruvate Decarboxylase Gene PDC6, terminator, a nutrition mark URA3 and ORF frame part according to PDC6 relevant primer sequence amplification in table 1, by above-mentioned product through PCR reaction forming to obtaining together lacking module Δ PDC6 as shown in Figure 3.
Obtain the promotor of Pyruvate Decarboxylase Gene ADH4, terminator, a nutrition mark URA3 and ORF frame part according to ADH4 relevant primer sequence amplification in table 1, by above-mentioned product through PCR reaction forming to obtaining together lacking module Δ ADH4 as shown in Figure 4.
The fragment of gene PDC1 promotor, terminator, a nutrition mark Ura3 and ORF frame part is obtained according to PDC1 relevant primer sequence amplification in table 1, the fragment of lactate dehydrogenase gene LDH is obtained with LDH relevant primer sequence (SEQIDNO:33, SEQIDNO:34) amplification, by the PCR primer fragment of above-mentioned acquisition, through PCR reaction forming together, disappearance module Δ PDC1 ∷ LDH is obtained as shown in Figure 5.
The fragment of Gene A DH1 promotor, terminator, a nutrition mark Ura3 and ORF frame part is obtained according to ADH1 relevant primer sequence amplification in table 1, the fragment of lactate dehydrogenase gene LDH is obtained with LDH relevant primer sequence (SEQIDNO:43, SEQIDNO:44) amplification, by the PCR primer fragment of above-mentioned acquisition, through PCR reaction forming together, disappearance module Δ ADH1 ∷ LDH is obtained as shown in Figure 6.
Embodiment 2: the structure of gene knock-out bacterial strain
1, BY4741 bacterial strain is connect at YPD substratum, 30 DEG C of incubated overnight.
2, transfer the nutrient solution of the above-mentioned bacterial strain spent the night in the fresh YPD of 5ml, make initial OD
600=0.1, continue 30 DEG C and cultivate 4-6 hour, make nutrient solution OD
600reach 0.4-0.6.
3, transform: use lithium acetate transformation method, in the competent cell make disappearance module Δ PDC5 conversion BY4741 obtained above, be coated on the flat board of SC-Ura after conversion, 30 DEG C of cultivations.
4, extract genome checking: picking transformant, extract genome and make PCR checking label, BY4741 is as negative control, and stripe size is correct, shows that disappearance module homologous recombination is correct, completes.
5, bullet falls nutrition mark Ura3: rule at FoA by correct for checking transformant, and bullet falls nutrition mark URA3.
6, extract genome checking: the bacterial strain that picking grows on FoA flat board, extract genome and carry out PCR, label is verified, BY4741 is as negative control, and stripe size is correct, shows genetically deficient success.
7, the correct bacterial strain of checking step 5 obtained receives YPD substratum, 30 DEG C of incubated overnight; Repeating step 2-6 continues to transform disappearance module Δ PDC6.
8, transform: the correct bacterial strain obtained successively is transformed HO plasmid, after conversion, is coated on the flat board of SC-Ura, 30 DEG C of cultivations.
9, extract genome checking: picking transformant, extract genome and be PCR and verify label, have a type and alpha type two band and size is correct, show that mating type changes correct, complete.
10, will lack module Δ ADH4, Δ ADH1 ∷ LDH, Δ PDC1 ∷ LDH successively proceeds to step 9 and obtains diploid strains, repeating step 2-7, obtains the bacterial strain that five genes all knock out.
11, step 10 is obtained bacterial strain to be coated with on Potassium ethanoate flat board, cultivate 5 days.
12, step 11 is obtained spore, use yeast to split instrument, carry out tearing spore open and obtain haploid strains.
13, haploid strains step 12 obtained, carries genome and carries out PCR, and label is verified, genotype is verified, BY4741 is as negative control, and the stripe size of five genes is correct, shows genetically deficient success, obtains aimed strain, be designated as SyBE_Sc01020039.
Pyruvate Decarboxylase Gene PDC5 knocks out principle schematic and sees Fig. 7, and Pyruvate Decarboxylase Gene PDC1 knocks out insertion lactate dehydrogenase gene LDH schematic diagram simultaneously and sees Fig. 8.
Aimed strain electrophorogram is shown in Fig. 9.Fig. 9 represents the molecular biology checking of aimed strain SyBE_Sc01020039 and wild-type related strain:
Wherein, whether a1L: checking Gene A DH1 knocks out the band that simultaneously LDH inserts, complete, correctly;
A4: whether the band that checking Gene A DH4 knocks out is correct;
Whether p1L: checking gene PDC1 knocks out the band that LDH simultaneously inserts, complete, correctly;
P5: whether checking gene PDC5 knocks out correct;
P6: whether checking gene PDC6 knocks out correct;
The swimming lane of mark WT: BY4741 original strain, does not do gene knockout;
Do not do the swimming lane marked: the correct band of aimed strain.
Embodiment 3 molecular biology is verified
The extracting method of Yeast genome is with reference to yeast genetics experiment guide, and embodiment 2 molecular biology checking the primer is as follows:
1, after transforming disappearance module, the PCR that non-bullet falls Ura3 verifies primer:
Checking disappearance module Δ PDC5 restructuring primer is upstream p5_cku:5 '-TTTCAGCTCTTTCAAGTTCCTC-3 ' (SEQIDNO:45), downstream P_p5_dw:5 '-CATGAGTTTTATGTTAATTAGCTTATTTGTTCTTCTTGTTATTGTATTGTGTTGTT C-3 ' (SEQIDNO:46), with upstream U_p5_up:5 '-TCCTTAATGCTCGAATACTACAGGGTAATAACTGATATAATTAAATTGAAG-3 ' (SEQIDNO:47), downstream p5_ckd1:5 '-TAGACTGGTCTTTGGGTAGTGTAGG-3 ' (SEQIDNO:48).
Checking disappearance module Δ PDC6 restructuring primer is upstream p6_cku:5 '-ATGTCCATTGGAATATGCAGA-3 ' (SEQIDNO:49), downstream P_p6_dw:5 '-GTTTGAGTACACTACTAATGGCTTATTTGTTGGCAATATGTTTTTGCTATATTACG TG-3 ' (SEQIDNO:50), with upstream U_p6_up:5 '-TAACAAGTGCTCATTCTGCATGGGTAATAACTGATATAATTAAATTGAAG-3 ' (SEQIDNO:51), downstream p6_ckd1:5 '-CCAAAAGAGAACCAGGAACCT-3 ' (SEQIDNO:52).
Checking disappearance module Δ ADH4 restructuring primer is upstream a4_cku:5 '-CTTCACGGTTAAGCAACCAGT-3 ' (SEQIDNO:53), downstream P_a4_dw:5 '-TTGACGTTTATGAGTTCGTTCGATTTTTTTATTTTCTTATTTGACTATTAGTTGTT GCA-3 ' (SEQIDNO:54), with upstream U_a4_up:5 '-CTGTCAATGATATTGTCTTCCTTGGGTAATAACTGATATAATTAAATTGAAG-3 ' (SEQIDNO:55), downstream a4_ckd1:5 '-AGCTTCGATACAGTGAGTCAA-3 ' (SEQIDNO:56).
Checking disappearance module Δ PDC1 ∷ LDH restructuring primer is upstream p1_cku:5 '-TTGCAAAATGCATAACCTATGC (SEQIDNO:57), downstream LDH_dw_p1:5 '-ACTTTAACTAATAATTAGAGATTAAATCGCTTAGAATTGCAATTCCTTTTGGA-3 ' (SEQIDNO:58), and upstream U_p1_up:5 '-TGCTCAAGACAAGCTAGTTGTGGGTAATAACTGATATAATTAAATTGAAG-3 ' (SEQIDNO:59) and p1_ckd1:5 '-TGGAGTTTGCAACAACTTAGCT-3 ' (SEQIDNO:60).
Checking disappearance module Δ ADH1 ∷ LDH restructuring primer is upstream a1_cku:5 '-CCTAGACTTGATAGCCATCATCA-3 ' (SEQIDNO:61), downstream LDH_dw_a1:5 '-TTCGCTTATTTAGAAGTGTCAACTTAGAATTGCAATTCCTTTTGGA-3 ' (SEQIDNO:62); With upstream T_a1_up:5 '-CAATCAACTATCTCATATACAGTTGACACTTCTAAATAAGCGAA-3 ' (SEQIDNO:63), downstream a1_ckd1:5 '-GAGATAGCAACCCAGTGAC-3 ' (SEQIDNO:64).
2, bullet falls the PCR checking primer of Ura3:
Checking gene PDC5 deletion-primers is upstream P5-cku2:5 '-TGACACGTTCGATTATATGGC-3 ' (SEQIDNO:65), downstream P5-ckd3:5 '-ATGAAATCAATTGGCGAAGCA-3 ' (SEQIDNO:66).
Checking gene Δ PDC6 deletion-primers is upstream P6-cku:5 '-ATGTCCATTGGAATATGCAGA-3 ' (SEQIDNO:67), downstream P6-ckd2:5 '-CAATACTGCTAACAATGGAA-3 ' (SEQIDNO:68).
Checking gene Δ ADH4 deletion-primers is upstream a4-cku:5 '-CTTCACGGTTAAGCAACCAGT-3 ' (SEQIDNO:69), downstream a4-ckd2:5 '-GACGTTGCTTATAACAGGTTG-3 ' (SEQIDNO:70).
Checking gene Δ PDC1 ∷ LDH deletion-primers is upstream P_p1_up:5 '-CCCGCGGCCGCCTGACTTTTCGTGTGATGAGG-3 ' (SEQIDNO:71), downstream p1_ckd2:5 '-GCTTGTGGGTATTGTTCAGAGA-3 ' (SEQIDNO:72).
Checking gene Δ ADH1 ∷ LDH deletion-primers is upstream LDH_up_a1:5 '-ACAATCAACTATCTCATATACAATGGCTACTTTGAAGGACCAA-3 ' (SEQIDNO:73), downstream A1-ckd3:5 '-TGCATTCTTATCGCATCGTT-3 ' (SEQIDNO:74).
Test-results is as Fig. 9.
Embodiment 4 bacterial strain take ethanol as the shake flask fermentation feature of sole carbon source
1, test materials: bacterial strain SyBE_Sc01020039.
2, test method:
YPE substratum: ethanol 20ml/L, yeast powder 10g/L, peptone 20g/L, 121 DEG C of sterilizing 20min.
By SyBE_Sc01020039 inoculation in 100mLYPE substratum, 30 DEG C, 200rpm cultivates 24h, with initial cell concentration OD
600=0.1 is inoculated in the 250mL Erlenmeyer flask of 100mL fermention medium, in 30 DEG C, cultivate under 200rpm condition, use 722 type spectrophotometric determination thalli growth curves.Glucose concn, alcohol concn high performance liquid chromatography (Waters1515) measures, and chromatographic column is AminexHPX-87H, column temperature: 65 DEG C, detector: Waters Composition distribution 2421, moving phase is 5mM sulphuric acid soln, flow velocity 0.6mL/min, and sample size is 10 μ L.
3, test-results:
As shown in Figure 10, SyBE_Sc01020039 bacterial strain is starting to enter logarithmic phase after 20h, shows quick growth, and during to 55h, and proceed to stationary phase gradually, about 60h, grows into stationary phase.It can thus be appreciated that SyBE_Sc01020039 bacterial strain, under being only the condition of carbon source containing ethanol, showing growth vigor, ethanol can be utilized to grow.
As shown in figure 11, in substratum, ethanol content declines gradually with the growth of bacterial strain SyBE_Sc01020039, and known bacterial strain can utilize ethanol.
Embodiment 5 bacterial strain take glucose as the shake flask fermentation feature of sole carbon source
1, test materials: bacterial strain SyBE_Sc01020039
2, test method:
YPD substratum: glucose 22g/L, yeast powder 10g/L, peptone 20g/L, calcium carbonate 3g/L121 DEG C sterilizing 20min.
By SyBE_Sc01020039 inoculation in 100mLYPE substratum, 30 DEG C, 200rpm cultivates 24h, with initial cell concentration OD
600=0.1 is inoculated in the 250mL Erlenmeyer flask of 100mL fermention medium, in 30 DEG C, cultivate under 200rpm condition, use 722 type spectrophotometric determination thalli growth curves.Glucose concn, alcohol concn, lactic acid concn high performance liquid chromatography (Waters1515) measures, chromatographic column is AminexHPX-87H, column temperature: 65 DEG C, detector: Waters Composition distribution 2421, moving phase is 5mM sulphuric acid soln, flow velocity 0.6mL/min, sample size is 10 μ L.
3, test-results:
As shown in figure 12, SyBE_Sc01020039 bacterial strain, after enter logarithmic phase after 192h, starts quick consumption of glucose, produces lactic acid in a large number, and lactic acid ultimate capacity reaches 14g/L, does not have ethanol to produce.It can thus be appreciated that SyBE_Sc01020039 bacterial strain, under only high concentration glucose is the condition of carbon source, can produce a large amount of lactic acid, and not producing and ethanol.
Embodiment 6 bacterial strain take high concentration glucose as the ferment tank feature of sole carbon source
1, test materials: bacterial strain SyBE_Sc01020039
2, test method:
YPD substratum: glucose 110g/L, yeast powder 10g/L, peptone 20g/L, 121 DEG C of sterilizing 20min.
By SyBE_Sc01020039 inoculation in 100mLYPE substratum, 30 DEG C, 200rpm cultivates 24h, with initial cell concentration OD
600=0.5 is inoculated in the 250mL Erlenmeyer flask of 100mL fermention medium, in 30 DEG C, cultivate under 200rpm condition, use 722 type spectrophotometric determination thalli growth curves.Glucose concn, alcohol concn, lactic acid concn high performance liquid chromatography (Waters1515) measures, chromatographic column is AminexHPX-87H, column temperature: 65 DEG C, detector: Waters Composition distribution 2421, moving phase is 5mM sulphuric acid soln, flow velocity 0.6mL/min, sample size is 10 μ L.
3, test-results:
As shown in figure 13, SyBE_Sc01020039 bacterial strain is starting to enter logarithmic phase after 70h, starts quick consumption of glucose, produces lactic acid in a large number, and 120h glucose exhausts substantially, and lactic acid ultimate capacity reaches 88g/L, does not have ethanol to produce.It can thus be appreciated that SyBE_Sc01020039 bacterial strain, only containing under glucose is the condition of carbon source, can utilize glucose to produce lactic acid, and not producing and ethanol.
The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the premise without departing from the principles of the invention; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.
Claims (10)
1. a saccharomyces cerevisiae engineered yeast strain, is characterized in that, PDC1, PDC5, PDC6, ADH1, ADH4 gene of described saccharomyces cerevisiae engineered yeast strain is knocked, and inserts LDH gene.
2. the preparation method of saccharomyces cerevisiae engineered yeast strain as claimed in claim 1, is characterized in that, comprise the steps:
By PDC5, PDC6 gene knockout of yeast saccharomyces cerevisiae, obtain bacterial strain MATa Δ PDC5 Δ PDC6;
Change the mating type of described bacterial strain MATa Δ PDC5 Δ PDC6, obtain diploid strains MATa/alpha Δ PDC5 Δ PDC6;
By ADH4, PDC1, ADH1 gene knockout of described diploid strains MATa/alpha Δ PDC5 Δ PDC6, and insert LDH gene, obtain bacterial strain a1La4p1p5p6-D, prepare haploid strains, obtain saccharomyces cerevisiae engineered yeast strain.
3. preparation method according to claim 2, is characterized in that, comprises the steps:
Build PDC5 gene knockout fragment: a part for the promotor of coding PDC5, terminator, open reading frame and selection markers are connected, obtain PDC5 gene knockout fragment;
Build PDC6 gene knockout fragment: a part for the promotor of coding PDC6, terminator, open reading frame and selection markers are connected, obtain PDC6 gene knockout fragment;
Build ADH4 gene knockout fragment: a part for the promotor of coding ADH4, terminator, open reading frame and selection markers are connected, obtain ADH4 gene knockout fragment;
Build PDC1 gene knockout and LDH Insert Fragment: the promotor of coding PDC1, terminator, a part for open reading frame, selection markers are connected with the gene of coding LDH, obtain PDC1 gene knockout and LDH Insert Fragment;
Build ADH1 gene knockout and LDH Insert Fragment: the promotor of coding ADH1, terminator, a part for open reading frame, selection markers are connected with the gene of coding LDH, obtain ADH1 gene knockout and LDH Insert Fragment;
PDC5 gene knockout fragment, PDC6 gene knockout fragment are transformed in yeast saccharomyces cerevisiae, remove selection markers, obtain MATa Δ PDC5 Δ PDC6;
By MATa Δ PDC5 Δ PDC6 described in HO Plastid transformation, change mating type, obtain diploid strains MATa/alpha Δ PDC5 Δ PDC6;
Described ADH4 gene knockout fragment, PDC1 gene knockout and LDH Insert Fragment, ADH1 gene knockout and LDH Insert Fragment are transformed into described diploid strains MATa/alpha Δ PDC5 Δ PDC6, remove selection markers, prepare haploid strains, obtain saccharomyces cerevisiae engineered yeast strain.
4. preparation method according to claim 2, is characterized in that, described selection markers is auxotroph selection markers or antibiotics resistance gene screening mark.
5. preparation method according to claim 4, is characterized in that, described auxotroph selection markers is URA3 mark.
6. preparation method according to claim 3, it is characterized in that, build described PDC5 gene knockout fragment, described PDC6 gene knockout fragment, described ADH4 gene knockout fragment, described PDC1 gene knockout and LDH Insert Fragment, described ADH1 gene knockout and LDH Insert Fragment promotor used, terminator, open reading frame, selection markers be with the genome of Wine brewing yeast strain BY4741 for template, obtain through PCR reaction amplification.
7. the application in lactic acid is being produced in saccharomyces cerevisiae engineered yeast strain as claimed in claim 1.
8. the fermentation process of saccharomyces cerevisiae engineered yeast strain as claimed in claim 1, it is characterized in that, saccharomyces cerevisiae engineered yeast strain is that carbon source is fermented with glucose as claimed in claim 1.
9. the cultural method of saccharomyces cerevisiae engineered yeast strain as claimed in claim 1, it is characterized in that, saccharomyces cerevisiae engineered yeast strain is that carbon source is cultivated with ethanol as claimed in claim 1.
10. the acclimation method of saccharomyces cerevisiae engineered yeast strain as claimed in claim 1, it is characterized in that, by saccharomyces cerevisiae engineered yeast strain as claimed in claim 1 after YPE liquid nutrient medium activation at least twice, then bacterial strain is transferred to 1 ~ 3 generation of domestication in YPD liquid nutrient medium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510516170.XA CN105087407B (en) | 2015-08-20 | 2015-08-20 | A kind of saccharomyces cerevisiae engineered yeast strain and preparation method thereof, application, fermentation culture method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510516170.XA CN105087407B (en) | 2015-08-20 | 2015-08-20 | A kind of saccharomyces cerevisiae engineered yeast strain and preparation method thereof, application, fermentation culture method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105087407A true CN105087407A (en) | 2015-11-25 |
| CN105087407B CN105087407B (en) | 2018-11-27 |
Family
ID=54568743
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510516170.XA Active CN105087407B (en) | 2015-08-20 | 2015-08-20 | A kind of saccharomyces cerevisiae engineered yeast strain and preparation method thereof, application, fermentation culture method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105087407B (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107641605A (en) * | 2017-08-31 | 2018-01-30 | 天津大学 | A kind of method of rapid Optimum yeast cells factory |
| CN107916235A (en) * | 2017-11-15 | 2018-04-17 | 天津大学 | A kind of method that restructuring yeast strains and microorganism mix bacterium electricity production |
| CN110088279A (en) * | 2016-12-15 | 2019-08-02 | 株式会社钟化 | Novel host cell and used its target protein manufacturing method |
| CN110106098A (en) * | 2019-04-30 | 2019-08-09 | 广西科学院 | A kind of saccharomyces cerevisiae engineered yeast strain of high yield pyruvic acid and its fermentation process |
| CN111378682A (en) * | 2020-04-03 | 2020-07-07 | 江南大学 | Method for reducing ethyl carbamate content in yellow wine by metabolically modifying saccharomyces cerevisiae |
| CN112941119A (en) * | 2021-01-22 | 2021-06-11 | 江南大学 | Method for increasing yield of fatty acid ethyl ester of saccharomyces cerevisiae engineering bacteria |
| CN113430127A (en) * | 2021-07-07 | 2021-09-24 | 江南大学 | Recombinant bacterium for producing L-lactic acid and application thereof |
| CN116555062A (en) * | 2023-03-17 | 2023-08-08 | 江南大学 | Method for improving production of L-lactic acid by saccharomyces cerevisiae based on ethanol metabolic flow regulation and control |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102016024A (en) * | 2008-04-23 | 2011-04-13 | 丰田自动车株式会社 | Yeast mutant and substance production method using the same |
| CN104099258A (en) * | 2014-07-16 | 2014-10-15 | 江南大学 | Saccharomyces cerevisiae genetically-engineered bacterium capable of realizing ethanol accumulation reduction and application thereof |
| US20150203549A1 (en) * | 2011-09-13 | 2015-07-23 | Dana-Farber Cancer Institute, Inc. | Compositions and methods for brown fat induction and activity using fndc5 |
-
2015
- 2015-08-20 CN CN201510516170.XA patent/CN105087407B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102016024A (en) * | 2008-04-23 | 2011-04-13 | 丰田自动车株式会社 | Yeast mutant and substance production method using the same |
| US20150203549A1 (en) * | 2011-09-13 | 2015-07-23 | Dana-Farber Cancer Institute, Inc. | Compositions and methods for brown fat induction and activity using fndc5 |
| CN104099258A (en) * | 2014-07-16 | 2014-10-15 | 江南大学 | Saccharomyces cerevisiae genetically-engineered bacterium capable of realizing ethanol accumulation reduction and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 赵亮亮: "代谢工程改造酿酒酵母生产L-乳酸", 《中国优秀硕士学位论文全文数据库 工程科技I辑》 * |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110088279A (en) * | 2016-12-15 | 2019-08-02 | 株式会社钟化 | Novel host cell and used its target protein manufacturing method |
| CN107641605A (en) * | 2017-08-31 | 2018-01-30 | 天津大学 | A kind of method of rapid Optimum yeast cells factory |
| CN107916235A (en) * | 2017-11-15 | 2018-04-17 | 天津大学 | A kind of method that restructuring yeast strains and microorganism mix bacterium electricity production |
| CN107916235B (en) * | 2017-11-15 | 2020-12-18 | 天津大学 | Recombinant yeast strain and microorganism mixed strain electricity generation method |
| CN110106098B (en) * | 2019-04-30 | 2022-05-20 | 广西科学院 | Saccharomyces cerevisiae engineering strain for high yield of pyruvic acid and fermentation method thereof |
| CN110106098A (en) * | 2019-04-30 | 2019-08-09 | 广西科学院 | A kind of saccharomyces cerevisiae engineered yeast strain of high yield pyruvic acid and its fermentation process |
| CN111378682A (en) * | 2020-04-03 | 2020-07-07 | 江南大学 | Method for reducing ethyl carbamate content in yellow wine by metabolically modifying saccharomyces cerevisiae |
| CN112941119A (en) * | 2021-01-22 | 2021-06-11 | 江南大学 | Method for increasing yield of fatty acid ethyl ester of saccharomyces cerevisiae engineering bacteria |
| CN112941119B (en) * | 2021-01-22 | 2022-08-30 | 江南大学 | Method for increasing yield of fatty acid ethyl ester of saccharomyces cerevisiae engineering bacteria |
| CN113430127A (en) * | 2021-07-07 | 2021-09-24 | 江南大学 | Recombinant bacterium for producing L-lactic acid and application thereof |
| CN113430127B (en) * | 2021-07-07 | 2024-01-12 | 江南大学 | Recombinant bacterium for producing L-lactic acid and application thereof |
| CN116555062A (en) * | 2023-03-17 | 2023-08-08 | 江南大学 | Method for improving production of L-lactic acid by saccharomyces cerevisiae based on ethanol metabolic flow regulation and control |
| CN116555062B (en) * | 2023-03-17 | 2023-10-27 | 江南大学 | Method for improving production of L-lactic acid by saccharomyces cerevisiae based on ethanol metabolic flow regulation and control |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105087407B (en) | 2018-11-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105087407B (en) | A kind of saccharomyces cerevisiae engineered yeast strain and preparation method thereof, application, fermentation culture method | |
| US11753658B2 (en) | Pichia stipitis strain and cultures and uses of the same | |
| CN103354836B (en) | Novel Wine brewing yeast strain | |
| CA2726054A1 (en) | Method of producing yeast biomass | |
| Wang et al. | Fermentation of sweet sorghum derived sugars to butyric acid at high titer and productivity by a moderate thermophile Clostridium thermobutyricum at 50 C | |
| US10738332B2 (en) | Genetically modified yeasts and fermentation processes using genetically modified yeasts | |
| US11667935B2 (en) | Fermentation process for improved glycerol and acetic acid conversion | |
| CN107922914A (en) | Breed microorganism and correlation technique and system | |
| CN109207373A (en) | The method that one plant height produces the microbial strains and its fermentation starch saccharic production citric acid of citric acid | |
| CN105051181B (en) | The preparation method of the increased recombinant microorganism of the generative capacity of 2,3-butanediol and the 2,3-butanediol using it | |
| CN106414735B (en) | Optimized propagation pentose fermentation strain | |
| CN104024419A (en) | Method for producing ethanol that uses recombinant yeast | |
| Zazulya et al. | Adaptive evolution for the improvement of ethanol production during alcoholic fermentation with the industrial strains of yeast Saccharomyces cerevisiae | |
| EP2890799B1 (en) | A selective microbial production of xylitol from biomass based sugar stream with enriched pentose component | |
| CN104204206B (en) | A kind of method for producing butanol | |
| CN108841736A (en) | It is a kind of with the ethyl alcohol thick mash fermentation superior strain of multiple tolerance and its application | |
| Medina | Fermentation technology | |
| Petelkov et al. | Encapsulation of brewing yeast in alginate/chitosan matrix: Kinetic characteristics of the fermentation process at a constant fermentation temperature | |
| CN101955890B (en) | Cadmium salt-resistant saccharomyces cerevisiae and application thereof | |
| CN106480106B (en) | A method of bacterial strain is improved to mortifier resistance using micro ventilation | |
| CN102676438B (en) | Alpha-ketoglutarate producing strain and method for producing alpha-ketoglutarate by fermentation with same | |
| CN105624212A (en) | Method for preparing 2,3-butanediol (BDO) by adopting microalgae as raw material | |
| Dwivedi | Fundamentals Of Fermentation Technology | |
| CN117897475A (en) | Development of Yeast strains for ethanol production | |
| CN103614309A (en) | Candida tropicalis genetically engineered bacterium with high yield of xylitol, and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |