CN105063043A - Duck parvovirus Taqman probe fluorescent quantitative PCR (polymerase chain reaction) detection kit - Google Patents

Abstract

The invention belongs to the technical field of biology, and relates to a duck parvovirus Taqman probe fluorescent quantitative PCR (polymerase chain reaction) detection kit and application thereof. The inventor provides a pair of specific primers and a corresponding fluorescent probe; a conserved gene sequence is selected by utilizing the known duck parvovirus strain genome sequence, and a gene cloning technique is utilized to construct a standard plasmid molecule containing the conserved gene sequence, thereby obtaining a standard curve; and a corresponding fluorescent quantitative PCR technique can be utilized to detect the sample and compare with the standard curve, thereby judging whether the sample is positive. The method has the advantages of high specificity, high sensitivity, favorable linear relationship, high automation degree and pollution resistance, and is simple to operate. The Taqman fluorescent probe used for quantitative amplification and detection can perform detection in one tube without opening the cover, so the pollution can not be easily generated. Meanwhile, the amplification and detection are completed in one step, so the method is simple to operate and can easily implement automation.

Description

A kind of Duck parvovirus Taqman fluorescence probe quantitative PCR detection kit

Technical field

The present invention relates to biological technical field, relate to a kind of Duck parvovirus Taqman fluorescence probe quantitative PCR detection kit and application thereof.

Background technology

Duck parvovirus is the one of parvovirus, mainly encroaches on the duckling in 1 ~ 3 week age, clinical soft for cardinal symptom with diarrhoea, expiratory dyspnea and pin, all there is generation throughout the year, raise to duck and bring great financial loss, be one of main disease during duck is raised, M & M is also higher.Since in March, 2015, there is a kind of disease in the ground meat duck groups such as China Shandong, Jiangsu and Anhui, this disease is with the dysplasia of duck beak, and tongue is overhanging is feature, and this disease mainly occurs in the commodity duck of more than 14 ages in days, after duckling infects, main manifestations is that beak shortens, and tongue is exposed to outside, thus causes difficulty of searching for food, the bodily form is become thin, and feedstuff-meat ratio increases.Duck group sickness rate be 5%-20% not etc., about 50% can be reached time serious; Suffer from duck and deliver body weight compared with normal duck reduction 20%-30% for sale, when the course of disease longer trouble duck is delivered for sale, body weight is only the half of healthy duck, causes huge financial loss to the foster duck industry of China.Can be separated to this virus in kind of duck cloacal swab, recall rate is up to 90%.The cloacal swab of the apparent healthy duck in morbidity duck group also can detect this virus, and recall rate is about 70%.The above results shows, the stronger transmission capacity that this disease has in duck group.

Quantitative fluorescent PCR, also known as real-time quantitative PCR, is the super-sensitive nucleic acid quantitation technique of one grown up on the basis of round pcr, can carries out quantitative analysis method by typical curve to unknown template.It introduces fluorophor in nucleic acid amplification system, by the Real-Time Monitoring to fluorescent signal in reaction mechanism, reach the object of monitoring whole experiment process, there is the features such as sensitive, accurate, special, overcome the ubiquitous false positive of traditional PCR technique greatly and quantitatively can not wait problem, its topmost advantage can carry out accurate quantitative analysis to the initial PCR reaction template of sample to be tested.

TaqMan fluorescent quantitative PCR technique is based on TaqMan fluorescent probe, utilizes 5'-3' 5 prime excision enzyme activity of DNA polymerase to be hydrolyzed the probe of hybridizing with aim sequence.TaqMan fluorescent probe is the oligonucleotide of a more than 20bp, and its 5' holds mark fluorescent to launch group, 3' end mark quenching group.When probe keeps complete, 3' holds quenching group to suppress 5' end to launch the fluorescent emission of group, can only detect that 3' holds fluorescent signal, and the fluorescent signal that 5' holds can not be detected.In pcr amplification, after the template denaturation in solution during low-temperature annealing, primer and probe are combined with template simultaneously.Under the mediation of primer, probe junction is extended to forward along template, probe 5' holds the fluorophor connected to cut down from probe by 5'-3' 5 prime excision enzyme activity of Taq DNA polymerase, be free in reaction system, thus depart from the shielding that 3' holds fluorescent quenching group, accept light stimulus and send fluorescent signal.Namely often increase a DNA chain, just has fluorescence molecule to be formed, and achieves the Complete Synchronization that the accumulation of fluorescent signal and PCR primer are formed.Because d/d fluorophor number and PCR primer quantity are man-to-man relations in theory, and optical density(OD) is also proportional relation with the number of d/d fluorophor, and therefore this technology can carry out accurate quantitative analysis to template.TaqMan probe technology specificity is good, and false positive is low, and linear relationship is good, and accuracy is high.The method has very high practical value in the evaluation of clinical detection and medical diagnosis on disease.

At present, yet there are no application Taqman fluorescence quantitative RT-RCR technology carries out diagnosis and detection report to Duck parvovirus.

Summary of the invention

For above-mentioned situation, the present inventor provides a kind of Duck parvovirus Taqman fluorescence probe quantitative PCR detection kit and application thereof, inventor provide the fluorescent probe of a pair Auele Specific Primer and correspondence, known Duck parvovirus pnca gene group sequence is utilized to choose conserved genetic sequences afterwards, gene clone technology is utilized to build the standard plasmid molecule containing this conserved genetic sequences, and then acquisition typical curve, the fluorescent quantitative PCR technique of utilization correspondence can carry out detection to sample and comparison typical curve can judge that whether sample is as positive, this method specificity is good, highly sensitive and linear relationship good, simple to operate, level of automation is high, anti-pollution, use Taqman fluorescence probe quantitative amplification and detect and can detect in same pipe, do not need to uncap, not easily pollute.Increase simultaneously and detect a step and complete, simple to operate, easily be automated.

Contriver provide firstly a pair Auele Specific Primer, and its nucleotide sequence is respectively as shown in SEQIDNo.1 and 2, and provide corresponding TaqMan fluorescent probe, the nucleotide sequence of described fluorescent probe is as shown in SEQIDNo.3 simultaneously:

Forward primer is: TCATCAAGAATACACCAGTASEQIDNo.1

Reverse primer is: GTATTGAGTTATGTAGGAGTTCSEQIDNo.2

Probe sequence is: CCTCCAGTAGAATATGTGAACCAGASEQIDNo.3

Above-mentioned primer and fluorescent probe all design the conserved regions in Duck parvovirus gene, only special to Duck parvovirus, and other species no cross reactions; Fluorescent probe should region between a pair Auele Specific Primer.

Contriver obtains its conservative region by the open sequence of known Duck parvovirus afterwards, this conservative region nucleotides sequence is classified as TCATCAAGAATACACCAGTACCTGCAGACCCTCCAGTAGAATATGTGAACCAGAAG TGGAACTCCTACATAACTCAATAC, as shown in SEQIDNo.4, gene clone technology is utilized to build the standard substance plasmid molecule containing this sequence afterwards, plasmid used is pMD18-T, is specially:

Utilize DNA to recombinate, build the standard plasmid containing Duck parvovirus conserved sequence, plasmid standards for quantitation plasmid 8.8 × 10 ¹⁰copies/ μ L, ten times are diluted to 10 ¹⁰, 10 ⁹, 10 ⁸, 10 ⁷, 10 ⁶, 10 ⁵, 10 ⁴, 10 ³, 10 ², 10 ¹with 10 ⁰(copies/ μ L) respectively gets 2 μ L as template.

Quantitative fluorescent PCR reaction system is as follows:

PremixExTaq10 μ L; Forward primer (10 μMs) 0.4 μ L; Reverse primer (10 μMs) 0.4 μ L; RoxReferenceDyeII0.2 μ L; ddH ₂o6.2 μ L; TaqMan probe (10 μMs) 0.8 μ L; Template 2.0 μ L.

PCR response procedures:

According to above-mentioned steps preparation PCR reaction system, put into quantitative real time PCR Instrument, response procedures: 95 DEG C of denaturation 30s, a circulation; 95 DEG C of sex change 5s, 60 DEG C of annealing extend 34s, react end after 40 circulations.

The foundation of typical curve

With the standard substance of above-mentioned preparation for template, in quantitative real time PCR Instrument, carry out pcr amplification according to above system and response procedures, collect fluorescent signal, Criterion curve.

The duck DNA of non-infected duck parvovirus is utilized to prepare negative PCR system afterwards: PremixExTaq10 μ L; Forward primer 0.4 μ L; Reverse primer 0.4 μ L; RoxReferenceDyeII0.2 μ L; DH ₂o6.2 μ L; TaqMan probe 0.8 μ L; Negative DNA2.0 μ L;

And the duck DNA of infected duck parvovirus prepares positive control PCR reaction system: PremixExTaq10 μ L; Forward primer (10 μMs) 0.4 μ L; Reverse primer (10 μMs) 0.4 μ L; RoxReferenceDyeII0.2 μ L; ddH ₂o6.2 μ L; TaqMan probe (10 μMs) 0.8 μ L; Positive DNA2.0 μ L;

Utilize above-mentioned identical PCR response procedures to obtain reaction product, utilize fluorescent PCR instrument to gather fluorescent signal, as calculated machine Software Create negative control point and positive control point, negative control is in the detection without C _tvalue and without amplification curve, positive control point is positioned on typical curve, and its C _tvalue < 32.

In sum, utilize fluorescent quantitative PCR technique provided by the invention can carry out detection comparison typical curve to sample and can judge that whether sample is as positive, this method specificity is good, highly sensitive and linear relationship good, simple to operate, level of automation is high, anti-pollution; Use Taqman fluorescence probe quantitative amplification and detect and can detect in same pipe, do not need to uncap, not easily pollute.Increase simultaneously and detect a step and complete, simple to operate, easily be automated.

Accompanying drawing explanation

Fig. 1 is the examination criteria curve of Duck parvovirus;

Fig. 2 is Duck parvovirus quantitative fluorescent PCR sensitivity Detection electrophorogram;

Wherein M is that 20bpladderDNAmarker, 1-10 are respectively 10 ⁹, 10 ⁸, 10 ⁷, 10 ⁶, 10 ⁵, 10 ⁴, 10 ³, 10 ², 10 ¹with 10 ⁰copies standard substance plasmid.

Embodiment

The acquisition of embodiment 1 Auele Specific Primer and probe

A pair described Auele Specific Primer, its nucleotide sequence is respectively as shown in SEQIDNo.1 and 2, and provide corresponding fluorescent probe, the nucleotide sequence of described TaqMan fluorescent probe is as shown in SEQIDNo.3 simultaneously:

Forward primer for: TCATCAAGAATACACCAGTA nucleotide sequence is as shown in SEQIDNo.1,

Reverse primer for: GTATTGAGTTATGTAGGAGTTC nucleotide sequence is as shown in SEQIDNo.2,

Probe sequence for: CCTCCAGTAGAATATGTGAACCAGA nucleotide sequence is as shown in SEQIDNo.3,

Above-mentioned primer and fluorescent probe all design the conserved regions in Duck parvovirus gene, only special for Duck parvovirus, and other species no cross reactions; Fluorescent probe should region between a pair Auele Specific Primer.

The acquisition of embodiment 2 typical curve

Contriver obtains its conservative region by the open sequence of known Duck parvovirus, this conservative region nucleotides sequence is classified as TCATCAAGAATACACCAGTACCTGCAGACCCTCCAGTAGAATATGTGAACCAGAAG TGGAACTCCTACATAACTCAATAC, nucleotide sequence is as shown in SEQIDNo.4, gene clone technology is utilized to build the standard substance plasmid molecule containing this sequence afterwards, plasmid used is pMD18-T, is specially:

Utilize DNA to recombinate, build the standard plasmid containing Duck parvovirus conserved sequence, plasmid standards for quantitation plasmid 8.8 × 10 ¹⁰copies/ μ L, ten times are diluted to 10 ¹⁰, 10 ⁹, 10 ⁸, 10 ⁷, 10 ⁶, 10 ⁵, 10 ⁴, 10 ³, 10 ², 10 ¹with 10 ⁰(copies/ μ L) respectively gets 2 μ L as template.

Quantitative fluorescent PCR reaction system is as follows:

PremixExTaq10 μ L; Forward primer (10 μMs) 0.4 μ L; Reverse primer (10 μMs) 0.4 μ L; RoxReferenceDyeII0.2 μ L; ddH ₂o6.2 μ L; TaqMan probe (10 μMs) 0.8 μ L; Template 2.0 μ L.

PCR response procedures:

According to above-mentioned steps preparation PCR reaction system, put into quantitative real time PCR Instrument, response procedures: 95 DEG C of denaturation 30s, a circulation; 95 DEG C of sex change 5s, 60 DEG C of annealing extend 34s, react end after 40 circulations.

The foundation of typical curve

With the standard substance of above-mentioned preparation for template, in quantitative real time PCR Instrument, carry out pcr amplification according to above system and response procedures, collect fluorescent signal, Criterion curve, as shown in Figure 1.Above-mentioned pcr amplification product is carried out 3% agarose gel electrophoresis, and result as shown in Figure 2.

Embodiment 3 infects the preparation of the DNA of Virus Sample

Adopt phenol chloroform extraction method to extract the DNA infecting Virus Sample, concrete steps are:

Get the fresh or frozen tissue block 0.3 ~ 0.5cm of ill duck ³, shred, add TE damping fluid 400 μ L and carry out homogenate, proceed in 2mLEp pipe, add equal-volume 2 × histiocyte lysate capable and Proteinase K mixing, digest more than 4 hours in 56 DEG C of water-baths.

After above tissue digestion terminates, add 400 μ L phenol and equal-volume chloroform, after mixing, 12000r/s, centrifugal 10min.

Get supernatant after centrifugal end in a new Ep pipe, add 400 μ L phenol and equal-volume chloroform, mixing, 12000r/s, centrifugal ten minutes.

Get after centrifugal end in 200 μ l supernatants and a 1.5mLEp pipe, add 400 μ L dehydrated alcohols ,-20 DEG C of standing 30min.

Sample thief 12000r/s, centrifugal 5min, abandons supernatant.

Add 75% ethanol of 1mL precooling, the centrifugal 5min of 12000r/s, clean twice.

Abandon ethanol, room temperature is dried, and adds 30 μ LddH ₂o dissolves, for subsequent use in-20 DEG C.

Embodiment 4 fluorescent PCR detects

The duck DNA of non-infected duck parvovirus is utilized to prepare negative PCR system: PremixExTaq10 μ L; Forward primer 0.4 μ L; Reverse primer 0.4 μ L; RoxReferenceDyeII0.2 μ L; DH2O6.2 μ L; TaqMan probe 0.8 μ L; Negative DNA2.0 μ L;

And the duck DNA of infected duck parvovirus prepares positive control PCR reaction system: PremixExTaq10 μ L; Forward primer (10 μMs) 0.4 μ L; Reverse primer (10 μMs) 0.4 μ L; RoxReferenceDyeII0.2 μ L; ddH ₂o6.2 μ L; TaqMan probe (10 μMs) 0.8 μ L; Positive DNA2.0 μ L;

Utilize above-mentioned identical PCR response procedures to obtain reaction product, utilize fluorescent PCR instrument to gather fluorescent signal, as calculated machine Software Create negative control point and positive control point, negative control is in the detection without C _tvalue and without amplification curve, positive control point is positioned on typical curve, and its C _tvalue < 32.

Claims (2)

1. a Duck parvovirus TaqMan probe fluorescent quantificationally PCR detecting kit, it is characterized in that: adopt a pair Auele Specific Primer, its nucleotide sequence is respectively as shown in SEQIDNo.1 and 2, provide corresponding TaqMan fluorescent probe, the nucleotide sequence of described fluorescent probe is as shown in SEQIDNo.3 simultaneously.

2. Duck parvovirus TaqMan probe fluorescent quantificationally PCR detecting kit according to claim 1, is characterized in that: described kit fluorescence quantitative PCR reaction system is as follows:

PremixExTaq10 μ L; Forward primer 0.4 μ L; Reverse primer 0.4 μ L; RoxReferenceDyeII0.2 μ L; ddH ₂o6.2 μ L; TaqMan probe 0.8 μ L; Template 2.0 μ L;

PCR response procedures:

According to above-mentioned steps preparation PCR reaction system, put into quantitative real time PCR Instrument, response procedures: 95 DEG C of denaturation 30s, a circulation; 95 DEG C of sex change 5s, 60 DEG C of annealing extend 34s, react end after 40 circulations.