CN105055381B - The pharmacy application of Lignanoids compounds and pharmaceutical composition - Google Patents
The pharmacy application of Lignanoids compounds and pharmaceutical composition Download PDFInfo
- Publication number
- CN105055381B CN105055381B CN201510456284.XA CN201510456284A CN105055381B CN 105055381 B CN105055381 B CN 105055381B CN 201510456284 A CN201510456284 A CN 201510456284A CN 105055381 B CN105055381 B CN 105055381B
- Authority
- CN
- China
- Prior art keywords
- compounds
- compound
- lignanoids compounds
- pharmaceutical composition
- starch
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Pharmacy application and pharmaceutical composition the invention provides Lignanoids compounds；Wherein, Lignanoids compounds are extracted from grass-leaved sweetflag rhizome, and can be used in preparing can treat the medicine of osteoporosis；Pharmaceutical composition contains the Lignanoids compounds of effective dose, can be made into various types of drug preparations；The results show of the present invention：The Monocytes/Macrophages that the Lignanoids compounds extracted can significantly suppress bone marrow derived are divided into the process of osteoclast and suppress the formation of Bone resoiption pit, and the inhibitory action is relevant with TRAP, Cts K and MMP-9；Further, since this kind of Lignanoids compounds do not have obvious cellulotoxic effect to the macrophage of bone marrow derived, therefore can be used to that preventing and treating is made or treat the medicine of osteoporosis, with good medical prospect in medicine.
Description
Technical field
The invention belongs to field of medicaments, it is related to pharmacy application and the pharmaceutical composition of Lignanoids compounds.
Background technology
Osteoporosis (Osteoporosis) is common bone metabolic disease, with Low BMD and bone tissue micro-structural regression
For principal character, and occur with the increase of bone fragility and easily the symptoms such as fracture.
The statistics of international osteoporosis foundation represents that osteoporosis endangers more than 50 years old of the whole world about 1/3 at present
Women and 1/5 more than 50 years old male, its incidence of disease has leapt to the 7th in world's common chronic disease, as middle aged and aged women
Ostalgia is fractured and because fracture disables, (the Chinese osteoporosis magazines of, 2002,8 are waited in the Qinling Mountains to lethal one of the main reasons：90‐
93)。
With the development of the social economy, the living standard of people is gradually stepped up, China human mortality aging degree more and more higher,
Osteoporotic fracture is also in cumulative year after year trend, and osteoporosis and osteoporotic fracture have turned into harm China citizen health
Serious public health problem.But, so far, osteoporosis still lacks preferable and reliable treatment method, moreover, passing through
Treatment can only alleviate the symptom for having found patient, can not thoroughly treat.Therefore, find prevent and treat osteoporosis medicine turn into work as
A focus and difficult point for preceding new drug development.
Bone m etabolism is to maintain bone tissue to constantly update, and keeps the basic process of vitality, this process is built again by bone
(Bone remodeling) is completed.The bone tissue of normal adults is in the bone that osteoclast (Osteoclast, OC) is mediated
Among the dynamic equilibrium of the bon e formation of absorption and Gegenbaur's cell (Osteoblast, OB) mediation.If this dynamic equilibrium quilt
Destruction, amount of osteoclast increase or increased activity, then bone information is excessive, causes the various diseases relevant with bone loss, such as bone
Matter is loose.Osteoclast derives from stem cell (Stem cells), is that formed one kind is merged by Monocytes/Macrophages
Well differentiated multinucleate giant cell, plays the effect of key in the disease pathology process related to bone loss such as osteoporosis.
Receptor activator of the nuclear factor-κappaB ligand (RANKL) and macrophage colony stimulatory factor (M-CSF) are the differentiation of osteoclast
With two kinds of cell factors necessary to maturation.RANKL is combined by the RANK acceptors with osteoclast precursor cells film surface, is swashed
MAPK signal paths and transcription factor NF-KB, NFATC1 and c-Fos living.The activation direct regulation and control of above-mentioned signal path is with breaking
Related marker gene such as TRAP, MMP-9 and Cts k of osteocyte generation expression, these genes are further in osteoclast point
Cause the formation of Bone resoiption pit during change and maturation.Therefore, suppress osteoclast differentiation and maturation is used as the bones such as osteoporosis
The therapeutic strategy for losing related disease is increasingly subject to pay attention to.
Grass-leaved sweetflag is traditional conventional Chinese medicine simply, is Araeceae herbaceos perennial grass-leaved sweetflag (Acorus
Tatarinowii Schott) dry rhizome, the effects such as with dissipating phlegm for resuscitation, removing dampness to restore normal functioning of the stomach, inducing resuscitation intelligence development.At present clinically
It is widely used in the treatment of diseases associated with senescence.
Chinese patent CN102557893A and Gang Ni etc. (Journal of organic chemistry, 2011,
76:2056-2061) reporting from the isolated lignans compound of grass-leaved sweetflag has Glucokinase activation effect,
It can be used for the treatment of diabetes, but whether the lignans compound has the effect that can suppress osteoclast generation,
And further there is the effect for suppressing bone information not yet to have been reported at present.
The content of the invention
The primary and foremost purpose of the present invention is the provision of a kind of pharmaceutical applications of Lignanoids compounds.
Other purposes of the present invention, which are that offer is a kind of, can treat the pharmaceutical composition and the medicine group of osteoporosis
The various types of drug preparations of compound.
To reach above-mentioned purpose, solution of the invention is：
Lignanoids compounds can be applied preparing for treating in medicine for treating osteoporosis, and its chemical formula is：
C36H48O9、C24H32O6Or C24H32O7, structural formula is：
Or
A kind of pharmaceutical composition for being used to treat osteoporosis, it is characterised in that：Contain Lignanoids compounds and use
In the pharmaceutical carrier for carrying the Lignanoids compounds.
Wherein, the chemical formula or structural formula of Lignanoids compounds can be any one in above-mentioned chemical formula or structural formula
Kind.
Pharmaceutical carrier can be diluent, excipient, filler, adhesive, wetting agent, disintegrant, sorbefacient, table
Any one or a few in face activating agent, absorption carrier and lubricant.
Further, filler can form sediment selected from starch, Icing Sugar, calcium phosphate, dextrin, microcrystalline cellulose, lactose, pregelatinated
Any one or a few in powder and mannitol.
Adhesive can selected from sodium carboxymethylcellulose, PVP-K30, hydroxypropyl cellulose, starch slurry, methylcellulose,
Any one or a few in ethyl cellulose, hydroxypropyl methyl cellulose and gelling starch.
Disintegrant selected from dried starch, PVPP, Ac-Di-Sol, sodium carboxymethyl starch and low can take
For any one or a few in hydroxypropyl cellulose.
Lubricant can be in for magnesium stearate, talcum powder, lauryl sodium sulfate and superfine silica gel powder any one
Or it is several.
Tablet, capsule, pill, injection, sustained release preparation, controlled release preparation or particulate can be made in above-mentioned pharmaceutical composition
Delivery system.
Due to using such scheme, the beneficial effects of the invention are as follows：
The Lignanoids compounds of the present invention are the active components extracted from grass-leaved sweetflag rhizome, can substantially be suppressed
The macrophage differentiation of bone marrow derived is the process of osteoclast and the formation of suppression Bone resoiption pit, and to bone marrow derived
Macrophage there is no obvious cellulotoxic effect, can be used to be made the medicine of preventing and treating or treatment osteoporosis and take for a long time
With so as to effectively prevent the formation of osteoporosis.
Brief description of the drawings
Fig. 1 is the X-ray single crystal diffraction molecular structure of the chemical compounds I of the present invention.
Fig. 2 is the X-ray single crystal diffraction molecular structure of the compounds Ⅳ of the present invention.
Fig. 3 is the X-ray single crystal diffraction molecular structure of the compound V of the present invention.
Fig. 4 is the column schematic diagram of chemical compounds I of the invention to the influence of VI couple of RANKL BMMs cytoactives stimulated.
Fig. 5 is the control group of the present invention and the TRAP colored graphs of chemical compounds I treatment group.
Fig. 6 is the compound ii treatment group of the present invention and the TRAP colored graphs of compound III treatment group.
Fig. 7 dyes for the TRAP of the compounds Ⅳ treatment group, the treatment group of compound V and the treatment group of compound VI of the present invention
Figure.
The column schematic diagram of the number of TRAP staining positive cells under Fig. 8 is handled for the chemical compounds I of the present invention to VI.
Fig. 9 is the Von Kossa colored graphs of control group, chemical compounds I treatment group and the compound ii treatment group of the present invention.
Figure 10 is the compound III treatment group of the present invention and the Von Kossa colored graphs of compounds Ⅳ treatment group.
Figure 11 is the treatment group of compound V of the present invention and the Von Kossa colored graphs of the treatment group of compound VI.
The column schematic diagram of the area of Bone resoiption pit under Figure 12 is handled for the chemical compounds I of the present invention to VI.
The schematic diagram of the MMP-9mRNA levels of different time under Figure 13 is handled for the chemical compounds I of the present invention to VI.
The schematic diagram of the TRAP mRNA level in-sites of different time under Figure 14 is handled for the chemical compounds I of the present invention to VI.
The schematic diagram of the Cts K mRNA level in-sites of different time under Figure 15 is handled for the chemical compounds I of the present invention to VI.
Embodiment
The application in being used to treat medicine for treating osteoporosis is being prepared the invention provides Lignanoids compounds, is containing the wood
The pharmaceutical composition of fat chlorins compound and the various types of drug preparations of the pharmaceutical composition.
<Lignanoids compounds>
The Lignanoids compounds of the present invention are extracted from grass-leaved sweetflag rhizome, have different structure comprising six kinds
The optical isomer of the compound of formula and these compounds.The structural formula of these compounds is as follows：
Chemical compounds I：Tatarinan N,Chemical formula is C36H48O9；
Compound ii：Tatarinan O,Chemical formula is C36H48O9；
Compound III：Tatanan A,Chemical formula is C36H48O9；
Compounds Ⅳ：Tatarinan S,Chemical formula is C24H32O6；
Compound V：Tatarinan U,Chemical formula is C24H32O6；
Compound VI：Tatarinan V,Chemical formula is C24H32O7。
The Lignanoids compounds of the present invention can be used in preparing the medicine for the treatment of osteoporosis.
<The pharmacy application of Lignanoids compounds>
The pharmaceutical composition of the present invention is used to treat osteoporosis symptoms, contains appointing in above-mentioned Lignanoids compounds
Meaning one or more and pharmaceutical carrier.
Wherein, the effective dose of Lignanoids compounds is：The weight of Lignanoids compounds accounts for pharmaceutical composition gross weight
The 0.1-95% of amount, preferably 1-85%, more preferably 2-60%.The content of Lignanoids compounds is in unit dosage form
0.1 to 100 milligram.
Pharmaceutical carrier is diluent, excipient, filler, adhesive, wetting agent, disintegrant, sorbefacient, surface work
Any one or a few in property agent, absorption carrier and lubricant.
Filler can be selected from starch, Icing Sugar, calcium phosphate, dextrin, microcrystalline cellulose, lactose, pregelatinized starch and sweet dew
Any one or a few in alcohol.
Adhesive can selected from sodium carboxymethylcellulose, PVP-K30, hydroxypropyl cellulose, starch slurry, methylcellulose,
Any one or a few in ethyl cellulose, hydroxypropyl methyl cellulose and gelling starch.
Disintegrant selected from dried starch, PVPP, Ac-Di-Sol, sodium carboxymethyl starch and low can take
For any one or a few in hydroxypropyl cellulose.
Lubricant can selected from any one in magnesium stearate, talcum powder, lauryl sodium sulfate and superfine silica gel powder or
It is several.
Below in conjunction with experimental result shown in accompanying drawing and specific embodiment, the present invention is further illustrated.
Preparation example：The extracting method of Lignanoids compounds
The Lignanoids compounds of the present invention are extracted from grass-leaved sweetflag rhizome, and its extracting method includes following step
Suddenly：
(1) Chinese medicine grass-leaved sweetflag medicinal material 10kg, is taken, after crushed, is extracted 2 times with 95% alcohol reflux, merges 2 extractions
Liquid, is concentrated under reduced pressure, vacuum drying, obtains medicinal extract 700g.
(2), with the above-mentioned medicinal extract of water mix suspending (quality of water is 5 times of medicinal extract quality) of about 5 times of amounts, successively with oil
After ether, chloroform and extracting n-butyl alcohol, recycling design, each several part extract is obtained.
(3), chloroform extraction position (common 190g) 100-200 mesh silica gel column chromatographies, using volume ratio as 5:1 petroleum ether-
Acetone soln carries out gradient elution as mobile phase, obtains 6 flow point Fr.1-Fr.6；Silicon is used respectively successively to Fr.2 therein
After glue post, reversed-phase column and gel column are isolated and purified, compounds Ⅳ is obtained to VI (compound 4 to 6)；To Fr.4 therein according to
It is secondary isolated and purified respectively with silicagel column, reversed-phase column and gel column after, obtain chemical compounds I to III (compound 1 to 3).
Wherein, in step (3), chloroform extraction position refers to the organic solvent extract in step (2), only handles chloroform extraction
Thing is taken, petroleum ether and n-butyl alcohol extract are not processed.
Silicagel column uses silica gel H, and mobile phase is 5 using volume ratio:1 petroleum ether-acetone soln；Reversed-phase column uses chromatogram
Post RP C-18, mobile phase is 3 using volume ratio:1 methanol-water solution；Gel column uses Sephadex LH-20, mobile phase
Use methanol.
Identify example：
By mass spectrum, nuclear magnetic resonance and X- single crystal diffractions technology to the chemical compounds I that is obtained by said extracted method extremely
VI is identified, and the structure of above-claimed cpd is determined.Chemical compounds I is as follows to VI specific spectral data：
Chemical compounds I (Tatarinan N)：Lump shaped crystalline (petroleum ether-acetone).ESI‐MS m/z 624[M]+。
1H NMR(400MHz,CDCl3)δ:0.75 (d, J=7.84), 0.84 (d, J=6.55), 1.46 (d, J=6.46),
1.78(d),2.04(d),2.62(m),3.01(m),3.49(m),3.72(s),3.76(9H),3.83(s),3.86(s),3.90
(6H),3.92(s),6.35(t),6.50(s),6.50(s),6.52(s),6.54(s),6.59(s),6.67(s)；
13C NMR(100MHz,CDCl3)δ:14.8,18.2,19.7,24.1,35.2,39.5,51.8,55.6,56.0,
56.1,56.2,56.3,56.4,56.6,56.8,57.8,96.8,98.1,98.8,113.3,114.5,115.8,119.9,
120.3,123.7,125.4,142.1,142.1,142.7,143.9,147.6,148.3,148.7,152.1,152.6,
153.4。
The X-ray single crystal diffraction molecular structure of chemical compounds I is as shown in Figure 1.Compound ii (Tatarinan O)：It is colourless
Crystal, ESI-MS m/z 624 [M]+。
1H NMR(400MHz,CDCl3)δ:0.58 (t, J=7.27), 0.62 (d, J=7.06), 1.14 (d, J=6.82),
1.41(m),1.71(m),1.74(m),2.20(m),2.83(m),3.21(m),3.60(s),3.73(s),3.77(s),3.79
(s),3.81(s),3.88(12H),4.21(d),6.40(s),6.43(s),6.48(s),6.55(s),6.59(s)。
13C NMR(100MHz,CDCl3)δ:15.1,12.6,21.1,21.1,26.4,42.3,49.6,49.7,49.8,
53.3,55.3,56.2,56.4,56.6,56.7,56.7,56.8,56.9,60.2,96.8,97.9,98.1,113.2,113.4,
125.5,127.0,127.2,139.9,140.1,142.7,147.3,147.3,147.7,151.5,152.0,152.6,
153.0。
Compound ii is that natural origin is isolated first.
Compound III (Tatanans A)：Clear crystal, ESI-MS m/z 624 [M]+。
1H NMR(400MHz,CDCl3)δ:0.77 (t, J=7.262), 0.92 (d, J=6.77), 1.50 (m), 1.59
(s),1.73(m),2.59(m),3.07(m),3.48(s),3.51(d),3.70(s),3.74(s),3.77(s),3.78(s),
3.85(6H),3.88(s),3.90(s),6.41(s),6.32(s),6.47(s),6.53(s),6.53(s),6.63(s),6.87
(s)。
13C NMR(100MHz,CDCl3)δ:13.1,14.7,15.0,26.9,29.7,37.2,51.1,55.8,56.2,
56.3,56.3,56.6,56.8,56.9,57.0,57.2,97.2,98.4,98.8,113.0,114.7,114.7,120.3,
122.0,122.5,124.0,138.7,142.3,142.6,142.7,147.5,147.5,148.2,151.9,152.7,
153.0。
Compounds Ⅳ (Tatarinan S)：Lump shaped crystalline (petroleum ether-acetone), mp 95-97 DEG C, ESI-MS m/z 416
[M]+。
1HNMR(CDCl3,400MHz)δ：0.90 (3H, t, J=7.28,9'-H), 1.60 (3H, s, 9-H), 1.71 (1H, m,
8'‐H),1.93(1H,m,8'‐H),3.70(3H,m,7'‐H),3.78,3.81(3H,each,s,OMe),3.82(6H,
overlap,OMe),3.88(6H,overlap,OMe),6.46(1H,s,7‐H),6.52(1H,s,3‐H),6.53(1H,s,3'‐
H),6.70(1H,s,6‐H),6.80(1H,s,6'‐H)；
13C NMR(CDCl3,125MHz),δ：120.0(C‐1),151.8(C‐2),98.2(C‐3),148.3(C‐4),
147.7(C‐5),114.7(C‐6),120.0(C‐7),140.0(C‐8),17.5(C‐9),124.7(C‐1'),152.2(C‐
2'),98.2(C‐3'),147.7(C‐4'),143.4(C‐5'),112.0(C‐6'),47.1(C‐7'),26.5(C‐8'),12.6
(C‐9'),56.2,56.3,56.7,56.8,56.8,57.1(each,OMe).The X- single crystal diffraction molecular structures of compounds Ⅳ
As shown in Figure 2.Compounds Ⅳ (Tatarinan S) is that natural origin is isolated first.
Compound V (Tatarinan U)：Lump shaped crystalline (petroleum ether-acetone).ESI‐MS m/z 416[M]+。
1H NMR(400MHz,CDCl3)δ:0.86 (t, J=7.39), 1.17 (d, J=6.98), 1.45 (m), 1.83 (m),
2.07(m),2.68(m),3.38(s),3.64(s),3.83(s),3.85(6H),3.87(s),4.29(d),6.37(s),6.43
(s),6.55(s)。
13C NMR(100MHz,CDCl3)δ:12.0,22.2,26.9,47.9,50.1,52.6,55.7,56.3,56.8,
56.9,57.0,60.1,97.3,98.2,113.3,127.3,127.8,139.4,139.9,142.9,147.7,151.5,
152.2,152.4.The X- single crystal diffraction molecular structures of compound V are as shown in Figure 3.Compound V (Tatarinan U) is day
So source is isolated first.
Compound VI (Tatarinan V)：Grease, ESI-MS m/z 432 [M]+。
1H NMR(400MHz,CDCl3)δ:0.96 (d, J=6.64), 1.30 (d, J=5.92), 2.44 (m), 3.12 (m),
3.80(s),3.82(s),3.83(s),3.89(9H),4.34(m),5.02(d),6.54(s),6.76(s),6.76(s),6.79
(s)。
13C NMR(100MHz,CDCl3)δ:14.7,20.4,49.7,54.7,56.3,56.3,56.7,57.0,57.0,
57.0,81.0,81.6,98.1,98.6,111.9,112.5,119.7,122.5,143.5,143.6,148.4,149.1,
151.9,152.9.Compound VI (Tatarinan V) is that natural origin is isolated first.
Above-mentioned spectral data indicates the Structural Identification process of the compound of the present invention.Pass through spectral data and X monocrystalline
Diffraction patterns can identify the structural formula of the compound of the present invention.
The activity experiment of chemical compounds I to VI
1st, cell separation is tested：
In order to determine the activity of chemical compounds I to VI, it is necessary first to which bone marrow cell is separated, surveyed with obtaining meeting experiment
The target cell of provisioning request.The method separated to bone marrow cell comprises the following steps：
(1) the male C57/6L-J mouse (being purchased from Shanghai Experimental Animal Center) of 6 week old, are taken, at cervical dislocation
Extremely；
(2) it is, sterile to strip shin bone, femur and ilium, bone two ends are cut off, rinsing ossis with PBS obtains bone marrow cell, in
420g centrifuges 5min；
(3), isolated bone marrow cell is used to the α-MEM nutrient solutions containing 10% hyclone and 20ng/ml M-CSF
Prepare cell suspension, be added in 10cm culture dishes, at 37 DEG C containing 5%CO2Incubator in overnight incubation；
(4) non-attached cell, is drawn, 5min is centrifuged in 420g, using containing 10% hyclone, 1% dual anti-and 20ng/ml
Cell is resuspended in M-CSF α-MEM nutrient solutions, and with suitable cell density culture 3d, obtained attached cell is spread out as marrow
Raw macrophage (BMMs).
2nd, cytotoxicity experiment：
In order to know that chemical compounds I, to the toxicity of the macrophage (BMMs) of VI pair of bone marrow derived, is surveyed using mtt assay
It is fixed.The step of mtt assay determines the cytotoxicity of chemical compounds I to VI is as follows：
(1), according to 5 × 104BMMs is inoculated into 96 orifice plate cultures by the cell density of cells/well, washes away non-attached cell
Afterwards, continue to cultivate 24h；
(2), empirically require BMMs cells being divided into RANKL control groups and testing compound group, in testing compound group
Every group of cell add the testing compounds of various concentrations, add RANKL (20ng/ml) after being incubated 30min and stimulated；
(3), in 37 DEG C, 5%CO2Under conditions of be incubated 24h after, add MTT solution simultaneously continue cultivate 4h.The MTT- of formation
Formazan crystallization 100 μ l 0.04N hydrochloric acid-isopropanols dissolve, and determine absorbance in 570nm afterwards, as a result as shown in Figure 4.
Fig. 4 shows chemical compounds I to VI toxicity under 5 μM and 10 μM of concentration to BMMs, and its ordinate represents cell
Active (Cell viability), with the absorbance and the ratio of the absorbance of RANKL control groups of testing compound group each group
(%of the control) is indicated；5 μM and 10 μM in abscissa represent each compound in testing compound group
Concentration.
As shown in Figure 4, chemical compounds I to VI Cmax be 10 μM when to BMMs without significant cellulotoxic effect.
3rd, the generation Inhibition test of osteoclast
BMMs is divided into osteoclast to cause increasing for osteoclast number, and the abnormal increase of osteoclast is to lead
One of the reason for causing osteoporosis.This experiment is intended to explore the shadow that chemical compounds I is induced to differentiate into osteoclast to VI couple of BMMs
Ring.
Experimental procedure is as follows：
By BMMs obtained above with 6x104The density of cells/well is placed in 48 orifice plates, with comprising 10% hyclone,
20ng/ml M-CSF, 20ng/ml RANKL and various concentrations treat that the α-MEM nutrient solutions of reagent thing (i.e. chemical compounds I to VI) exist
37 DEG C contain 5%CO23d is cultivated in incubator.Then, nutrient solution is removed, and with purchased from institute in Sigma TRAP staining kits
The fixer of carrying is fixed after cell, and TRAP dyeing is carried out according to kit explanation.1h is incubated in 37 DEG C of incubators of lucifuge
Afterwards, the cell of dyeing distillation washing 3 times, in 200 times of optical microphotograph Microscopic observation cells.The cell of TRAP stained positives is in dark
It is red.TRAP staining positive cells comprising 3 and more than 3 nucleus are considered as osteoclast.Experimental result such as Fig. 5 extremely schemes
Shown in 8.Fig. 5 to Fig. 8 magnification ratio is identical.
Fig. 5 is the TRAP colored graphs of control group and the osteoclast of chemical compounds I treatment group.Fig. 5 the picture left above represents unused
TRAP colored graphs under RANKL stimulations, are pointed out under conditions of unused RANKL stimulations, BMMs will not be divided into osteoclast；Figure
5 top right plot represents the TRAP colored graphs under being stimulated using RANKL, points out stimulating using RANKL and be not added with chemical compounds I
To under conditions of VI, BMMs can be divided into osteoclast；Fig. 5 lower-left figure represents that 10 μM are stimulated and with the addition of using RANKL
Compound 1 (i.e. chemical compounds I) under conditions of TRAP colored graphs, with the addition of certain densityization it can be seen from the figure
After compound I, the process that BMMs is divided into osteoclast is suppressed significantly；Fig. 5 bottom-right graph represents to be stimulated and added using RANKL
TRAP colored graphs under conditions of 5 μM of chemical compounds I, it can be seen from the figure with the addition of certain density chemical compounds I
Afterwards, BMMs is divided into the process of osteoclast and is suppressed significantly, but the suppression differentiation effect of the chemical compounds I of high concentration be better than it is low
The chemical compounds I of concentration.
Fig. 6 is the TRAP colored graphs of the osteoclast of compound ii treatment group and compound III treatment group.Fig. 6 the picture left above
Represent that the TRAP colored graphs under conditions of 10 μM of compound 2 (i.e. compound ii) are stimulated and with the addition of using RANKL, by the figure
As can be seen that after it with the addition of certain density compound ii, the process that BMMs is divided into osteoclast is suppressed significantly；Fig. 6
Top right plot represent to stimulate and with the addition of using RANKL TRAP colored graphs under conditions of 5 μM of compound ii, can be with by the figure
Find out, after it with the addition of certain density compound ii, the process that BMMs is divided into osteoclast is suppressed significantly；A Fig. 6 left side
Figure below represents to stimulate and with the addition of using RANKL the TRAP colored graphs under conditions of 10 μM of compound 3 (i.e. compound III), by
The figure be can be seen that after it with the addition of certain density compound III, and the process that BMMs is divided into osteoclast is suppressed significantly；
Fig. 6 bottom-right graph represents to stimulate and with the addition of using RANKL the TRAP colored graphs under conditions of 5 μM of compound III, by the figure
As can be seen that after it with the addition of certain density compound III, the process that BMMs is divided into osteoclast is suppressed significantly；From figure
6 as can be seen that the inhibition of compound ii of the inhibition better than 10 μM of 10 μM of compound III.
Fig. 7 contaminates for the TRAP of the osteoclast of compounds Ⅳ treatment group, the treatment group of compound V and the treatment group of compound VI
Chromatic graph.Fig. 7 the picture left above represents to stimulate and with the addition of using RANKL under conditions of 10 μM of compound 4 (i.e. compounds Ⅳ)
TRAP colored graphs；Fig. 7 top right plot represents to stimulate and with the addition of using RANKL the TRAP dyes under conditions of 5 μM of compounds Ⅳ
Chromatic graph；Fig. 7 left figure represents to stimulate and with the addition of using RANKL under conditions of 10 μM of compound 5 (i.e. compound V)
TRAP colored graphs；Figure represents that the TRAP dyes under conditions of 5 μM of compound V are stimulated and with the addition of using RANKL in Fig. 7 right side
Chromatic graph；Fig. 7 lower-left figure represents to stimulate and with the addition of using RANKL under conditions of 10 μM of compound 6 (i.e. compound VI)
TRAP colored graphs；Fig. 7 bottom-right graph represents to stimulate and with the addition of using RANKL the TRAP dyes under conditions of 5 μM of compound VI
Chromatic graph.
The TRAP staining positive cells of above-mentioned each group are counted and is counted and is calculated, Fig. 8 is obtained.Fig. 8 is shown
Chemical compounds I to VI depression effect broken up to BMMs under 5 μM and 10 μM of the concentration, its ordinate represents TRAP stained positives
Cell (TRAP+MNCs number) is relative to the percentage of the cell number of control group (being stimulated only with RANKL), abscissa
In 5 μM and 10 μM represent testing compound groups in each compound concentration.In Fig. 8, compared with control group, * p<0.05；**
p<0.01；***p<0.001.
From Fig. 5 to Fig. 8, chemical compounds I to VI significantly inhibits RANKL inductions under 5 μM and 10 μM of concentration
Formation of multi nucleate cells positive TRAP in BMMs, this shows that chemical compounds I can be suppressed RANKL to VI in the way of concentration dependant and be lured
The osteoclast generation led.
4th, bone information Inhibition test
One of effect of osteoclast is exactly to carry out bone information, if bone information excessively, can cause various and bone loss
Relevant disease, such as osteoporosis.This experiment is intended to explore chemical compounds I to the influence of the bone resorption of VI pair of osteoclast.
This experiment is used as bone information analysis side using the orifice plate vitro systems of Corning Osteo Assay Surface 24
Method, the orifice surfaces of Corning Osteo Assay Surface 24 are sent out covered with hydroxyapatite mineral matter coating
Table is disclosed in the plurality of articles on the internal authority publication such as PNAS, and experimental procedure is as follows：
By BMMs with 1 × 105The density of cells/well is inoculated into the orifice plates of Corning Osteo Assay Surface 24
In, treat reagent thing (i.e. chemical combination with comprising 10% hyclone, 20ng/ml M-CSF, 20ng/ml RANKL and various concentrations
Thing I to VI) α-MEM nutrient solutions 37 DEG C contain 5%CO26d is cultivated in incubator, and every the fresh nutrient solution of 3d replacings
And compound；After 6d, nutrient solution is removed, cell 5min is handled with 5% (w/v) liquor natrii hypochloritis, to remove cell；Distilled water
Rinsing 5 times, is dyed using the Von Kossa colouring methods by amendment, and method is as follows：Sodium hypochlorite removes thin in culture plate
After born of the same parents, it is incubated at room temperature with concentration for 5% (w/v) silver nitrate by the volume lucifuge in 300 μ L/ holes after 30min, distilled water rinsing 5
It is secondary, then with the sodium carbonate liquor for being dissolved in 10% formalin that concentration is 5% (w/v) in incubation at room temperature 5min, distilled water drift
Wash after 5 times, blot, after being air-dried, be imaged using inverted light microscope, and calculated using Image J analysis softwares per hole
Bone information area.As a result as shown in Fig. 9 to Figure 12.Fig. 9 to Figure 11 magnification ratio is identical.
Fig. 9 is the Von Kossa colored graphs of control group, chemical compounds I and compound ii treatment group.Fig. 9 the first row left figure
Represent the Von Kossa colored graphs under being stimulated using RANKL, it is shown that the formational situation of the Bone resoiption pit in the case of this kind；
Figure represents to stimulate and the Von Kossa colored graphs under 10 μM of chemical compounds I processing using RANKL in Fig. 9 the first row；The of Fig. 9
A line right figure represents to stimulate and the Von Kossa colored graphs under 5 μM of chemical compounds Is processing using RANKL；Fig. 9 the second row left figure
Represent to stimulate and the Von Kossa colored graphs under 10 μM of compound iis processing using RANKL；Fig. 9 the second row right figure represents to adopt
Stimulated and the Von Kossa colored graphs under 10 μM of compound iis processing with RANKL；It follows that chemical compounds I and compound ii table
Reveal the inhibitory action to the bone information of osteoclast.
Figure 10 is the Von Kossa colored graphs of compound III and compounds Ⅳ treatment group.Figure 10 the picture left above represents to use
RANKL is stimulated and the Von Kossa colored graphs under 10 μM of compound IIIs processing；Figure 10 top right plot represents to stimulate using RANKL
With the Von Kossa colored graphs under 5 μM of compound III processing；Figure 10 lower-left figure represents to stimulate using RANKL and 10 μM of chemical combination
Von Kossa colored graphs under the processing of thing IV；Figure 10 bottom-right graph is represented using under RANKL stimulations and 5 μM of compounds Ⅳs processing
Von Kossa colored graphs.
Figure 11 is the Von Kossa colored graphs of compound V and the treatment group of compound VI.Figure 11 the picture left above represents to use
RANKL stimulates the Von Kossa colored graphs under being handled with 10 μM of compounds V；Figure 11 top right plot represents to stimulate using RANKL
Von Kossa colored graphs under being handled with 5 μM of compounds V；Figure 11 lower-left figure represents to stimulate using RANKL and 10 μM of chemical combination
Von Kossa colored graphs under the processing of thing VI；Figure 11 bottom-right graph is represented under being handled using RANKL stimulations and 5 μM of compounds VI
Von Kossa colored graphs.
The area of the bone lacuna of the Von Kossa colored graphs of above-mentioned each group is counted and calculated, Figure 12 is obtained.Figure 12
Chemical compounds I is shown to VI influence under 5 μM and 10 μM of concentration to the area of bone lacuna, its ordinate represents the bone of each group
The face of bone lacuna of the area relative to control group (being stimulated only with RANKL) of lacuna (Bone resorptive pit area)
The concentration of each compound in 5 μM and 10 μM expression testing compound groups in long-pending percentage, abscissa.It is and right in Figure 12
Compared according to group, * p<0.05；**p<0.01；***p<0.001.
From Fig. 9 to Figure 12, under 5 μM and 10 μM of concentration, chemical compounds I to VI is suppressed in the way of concentration dependant
The Bone resoiption pit number and area of the osteoclast formation of RANKL mediations, this shows chemical compounds I to VI can be with concentration dependant
Mode suppress the bone resorption activity of osteoclast.
5th, the factor expression experiment in atomization
During BMMs is divided into osteoclast, change and the close phase of atomization of the expression quantity of some factors
Close, therefore, this experiment is intended to probe into these factors.
The experimentation of this experiment is as follows：
With 1 × 106BMMs is inoculated into 6 orifice plates and cultivated by the cell density of cells/well, washes away after non-attached cell,
3d is broken up in RANKL and 10 μM of chemical compounds I to induction in the presence of VI；During 3d breaks up, cell is collected daily, is used in combination
EZ-10total RNA Mini-Preps Kit (Shanghai life work) extract total serum IgE for masterplate to specifications, are used in combination
Transcriptor First Strand cDNA Synthesis Kit (Roche) synthesize the first chain cDNA；With synthesis
CDNA is masterplate, and carrying out real time PCR using 2 × q PCR Master Mix (Roche) detects.Reaction is as follows：95℃
10min, 40 PCR cycles (95 DEG C of 10s, 60 DEG C of 1min).Reference gene is used as using β-actin.Testing gene and reference gene
Primer sequence is as shown in table 1 below.
Table 1
| Primer | Gene order |
| mouse Cts K forward | 5′‐AATACCTCCCTCTCGATCCTACA‐3′ |
| mouse Cts K reverse | 5′‐TGGTTCTTGACTGGAGTAACGTA‐3′ |
| mouse MMP‐9forward | 5′‐CTGGACAGCCAGACACTAAAG‐3′ |
| mouse MMP‐9reverse | 5′‐CTCGCGGCAAGTCTTCAGAG‐3′ |
| mouse TRAP forward | 5′‐CACTCCCACCCTGAGATTTGT‐3′ |
| mouse TRAP reverse | 5′‐CATCGTCTGCACGGTTCTG‐3′ |
| mouseβ‐actin forward | 5′‐GGCTGTATTCCCCTCCATCG‐3′ |
| mouseβ‐actin reverse | 5′‐CCAGTTGGTAACAATGCCATGT‐3′ |
TRAP, Cts K and MMP-9 play an important role during biological bone matrix degradation, and Cts K and MMP-9 are collagen
Digestive enzyme, the collagen component for the sclerous tissues that directly degraded during osteoclastic bone resorption.These three enzymes are osteoclast differentiation
Important symbol, differentiation and bone resorption activity with osteoclast have very strong correlation.This experiment is using real time
PCR have detected TRAP, Cts K and MMP-9 mRNA level in-site, and testing result is as shown in FIG. 13 to 15.
Figure 13 represents the mRNA level in-sites of MMP-9 at different conditions, and its ordinate represents relative mRNA level in-site (Relative
MRNA level), abscissa represents incubation time (Incubation time), and incubation time is calculated with day.
Figure 14 represents the mRNA level in-sites of TRAP at different conditions, and its ordinate represents relative mRNA level in-site (Relative
MRNA level), abscissa represents incubation time (Incubation time), and incubation time is calculated with day.
Figure 15 represents the mRNA level in-sites of Cts K at different conditions, and its ordinate represents relative mRNA level in-site (Relative
MRNA level), abscissa represents incubation time (Incubation time), and incubation time is calculated with day.
As shown in Figure 13 to Figure 15, Realtime PCR analysis shows, RANKL dramatically increases TRAP, Cts K and MMP-9
MRNA level in-site, and 10 μM of chemical compounds Is to VI significantly inhibit RANKL induction TRAP, Cts K and MMP-9 up-regulated expressions.
Figure 13 is into Figure 15, compared with control group, * p<0.05；**p<0.01；***p<0.001.
To sum up, chemical compounds I is to VI osteoclast for suppressing RANKL mediations in the way of concentration dependant breaks up, bone information is fallen into
Nest formation and osteoclast related gene such as TRAP, Cts K and MMP-9 up-regulated expression, therefore, chemical compounds I to VI may
By suppressing osteoclast formation so as to the disease such as bone loss such as osteoporosis, rheumatic arthritis related to osteoclast
Disease plays therapeutic action.
Embodiment one
Tablet is made using Lignanoids compounds I, excipient and filler in pharmaceutical composition in the present embodiment.Wooden fat
The mass percent of chlorins compound I is 70%, and the mass percent of excipient is 20%, and the mass percent of filler is
10%.
Embodiment two
Injection is made using Lignanoids compounds II, diluent and sorbefacient in pharmaceutical composition in the present embodiment
Agent.
Embodiment three
Pharmaceutical composition in the present embodiment uses Lignanoids compounds III, excipient, filler, adhesive and absorption
Pill is made in carrier.
Example IV
Pharmaceutical composition in the present embodiment uses Lignanoids compounds V, excipient, adhesive, wetting agent and disintegration
Sustained release preparation is made in agent.
The above-mentioned description to embodiment is that this hair is understood that and used for ease of those skilled in the art
It is bright.Person skilled in the art obviously easily can make various modifications to these embodiments, and described herein
General Principle is applied in other embodiment without passing through performing creative labour.Therefore, the invention is not restricted to above-described embodiment,
Those skilled in the art are according to the announcement of the present invention, and not departing from improvement and modification that scope made all should be in this hair
Within bright protection domain.
Claims (8)
1. Lignanoids compounds are preparing the application in being used to treat medicine for treating osteoporosis, the knot of the Lignanoids compounds
Structure formula is：
Or
2. a kind of application of pharmaceutical composition in preparing for treating medicine for treating osteoporosis, described pharmaceutical composition contains wooden fat
Chlorins compound and the pharmaceutical carrier for carrying the Lignanoids compounds, the structural formula of the Lignanoids compounds
For：
Or
3. application according to claim 2, it is characterised in that：The pharmaceutical carrier be diluent, excipient, filler,
In adhesive, wetting agent, disintegrant, sorbefacient, surfactant, absorption carrier and lubricant any one or it is several
Kind.
4. application according to claim 3, it is characterised in that：The filler be selected from starch, Icing Sugar, calcium phosphate, dextrin,
Any one or a few in microcrystalline cellulose, lactose, pregelatinized starch and mannitol.
5. application according to claim 3, it is characterised in that：Described adhesive be sodium carboxymethylcellulose, PVP-K30,
It is any in hydroxypropyl cellulose, starch slurry, methylcellulose, ethyl cellulose, hydroxypropyl methyl cellulose and gelling starch
It is one or more of.
6. application according to claim 3, it is characterised in that：The disintegrant is dried starch, PVPP, crosslinking carboxylic
Any one or a few in sodium carboxymethylcellulose pyce, sodium carboxymethyl starch and low-substituted hydroxypropyl cellulose.
7. application according to claim 3, it is characterised in that：The lubricant is magnesium stearate, talcum powder, dodecyl
Any one or a few in sodium sulphate and superfine silica gel powder.
8. the application according to any one of claim 2 to 7, it is characterised in that：Tablet, glue is made in described pharmaceutical composition
Capsule, pill, injection, sustained release preparation, controlled release preparation or particulate delivery system.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510456284.XA CN105055381B (en) | 2015-07-29 | 2015-07-29 | The pharmacy application of Lignanoids compounds and pharmaceutical composition |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510456284.XA CN105055381B (en) | 2015-07-29 | 2015-07-29 | The pharmacy application of Lignanoids compounds and pharmaceutical composition |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105055381A CN105055381A (en) | 2015-11-18 |
| CN105055381B true CN105055381B (en) | 2017-08-29 |
Family
ID=54485066
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510456284.XA Expired - Fee Related CN105055381B (en) | 2015-07-29 | 2015-07-29 | The pharmacy application of Lignanoids compounds and pharmaceutical composition |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105055381B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116585301B (en) * | 2023-07-18 | 2023-09-22 | 青岛瑞源细胞生物科技开发有限公司 | Preparation for improving stem cell therapeutic capacity |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1634905A (en) * | 2004-09-27 | 2005-07-06 | 深圳中药及天然药物研究中心 | Use of Lignans compound used for anti-osteoporosis medicine |
| CN1634025A (en) * | 2004-09-27 | 2005-07-06 | 深圳中药及天然药物研究中心 | Use of erberry and its lignanoids compound in drug for osteoporosis |
| CN1749262A (en) * | 2005-04-20 | 2006-03-22 | 中国药科大学 | Process for preparing flaxseed lignan total glycoside extract and use thereof |
| CN100999754A (en) * | 2006-11-16 | 2007-07-18 | 中国科学院长春应用化学研究所 | Preparation process of plant estrin-enterodiol |
| CN101002814A (en) * | 2007-01-12 | 2007-07-25 | 苏州大学 | Medical use of burdock total lignanoid |
| CN102106884A (en) * | 2009-12-25 | 2011-06-29 | 财团法人工业技术研究院 | Medicinal composition having immunity-regulating function |
| CN102557893A (en) * | 2010-12-07 | 2012-07-11 | 中国医学科学院药物研究所 | Lignan compounds with glucokinase (GK) activation effect |
| CN104610025A (en) * | 2015-01-04 | 2015-05-13 | 同济大学 | Lignans compounds separated from rhizoma acori graminei as well as preparation and application thereof |
-
2015
- 2015-07-29 CN CN201510456284.XA patent/CN105055381B/en not_active Expired - Fee Related
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1634905A (en) * | 2004-09-27 | 2005-07-06 | 深圳中药及天然药物研究中心 | Use of Lignans compound used for anti-osteoporosis medicine |
| CN1634025A (en) * | 2004-09-27 | 2005-07-06 | 深圳中药及天然药物研究中心 | Use of erberry and its lignanoids compound in drug for osteoporosis |
| CN1749262A (en) * | 2005-04-20 | 2006-03-22 | 中国药科大学 | Process for preparing flaxseed lignan total glycoside extract and use thereof |
| CN100999754A (en) * | 2006-11-16 | 2007-07-18 | 中国科学院长春应用化学研究所 | Preparation process of plant estrin-enterodiol |
| CN101002814A (en) * | 2007-01-12 | 2007-07-25 | 苏州大学 | Medical use of burdock total lignanoid |
| CN102106884A (en) * | 2009-12-25 | 2011-06-29 | 财团法人工业技术研究院 | Medicinal composition having immunity-regulating function |
| CN102557893A (en) * | 2010-12-07 | 2012-07-11 | 中国医学科学院药物研究所 | Lignan compounds with glucokinase (GK) activation effect |
| CN104610025A (en) * | 2015-01-04 | 2015-05-13 | 同济大学 | Lignans compounds separated from rhizoma acori graminei as well as preparation and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105055381A (en) | 2015-11-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113181339B (en) | Medicinal application of aldehyde compound | |
| CN109294980A (en) | Root of kirilow rhodiola and rhodioside are divided into the application in cardiac-like muscle cell in stem cell directional | |
| CN1187369A (en) | Nitrogen oxide generation inhibitor | |
| Li et al. | Sclareol inhibits RANKL-induced osteoclastogenesis and promotes osteoblastogenesis through promoting CCN1 expression via repressing the MAPK pathway | |
| CN110876747A (en) | Application of urolithin A in preparation of medicine for preventing and treating diseases caused by overactivation of osteoclasts | |
| CN105055381B (en) | The pharmacy application of Lignanoids compounds and pharmaceutical composition | |
| CN102824400A (en) | Composition containing eucommia ulmoides and teasel roots and application of composition for treating osteoporosis | |
| EP2102149A1 (en) | Stilbene derivatives for adp-ribosyl cyclase inhibitors | |
| CN107496428B (en) | Calycosin derivative promotes the application in endothelial cell proliferation drug in preparation | |
| CN106389432B (en) | Nitidine Chloride is preparing the application in anti-osteoporosis and bone loss diseases | |
| CN112933129A (en) | Application of scandent scab extract | |
| CN104666313A (en) | Application of ginkgolic acid in preparation of medicine for preventing and/or treating diseases caused by overactivity of osteoclast | |
| CN109106698A (en) | Kirenol inhibits the application in osteoclast formation and/or osteoclast activity drug in preparation | |
| CN109758449A (en) | Myricetin is preparing the application in the drug for treating pulmonary fibrosis disease | |
| CN115634222B (en) | Application of hovenia dulcis thunb biflavone A in preparation of medicines with anti-hepatic fibrosis effect | |
| CN109806255A (en) | Diosmetin is in preparation for treating the application in pulmonary fibrosis disease drug | |
| CN109793747A (en) | Application of the Vaccarin in terms of the drug of preparation prophylactic treatment bone dissolubility disease | |
| CN113908148B (en) | Application of nobiletin in preparation of anti-cholangiocarcinoma drugs | |
| CN107281170A (en) | Application of the vanillic aldehyde in the medicine for preparing treatment/prevention bone metabolic disease | |
| CN103788058B (en) | A kind of Lignanoids compounds and the application in control Alzheimer's disease thereof | |
| CN102058579A (en) | Application of dehydrocostuslactone to preparing drug for inhibiting angiogenesis | |
| CN101838254B (en) | L-arginine derivative epimedium herb flavone combination and preparation method thereof | |
| CN106890182A (en) | A kind of combination of oral medication of vascular endothelial growth factor receptor inhibitors hydrochloride | |
| CN101343265B (en) | Extraction method of effective ingredients of cave flower | |
| CN106138033A (en) | Marine source nitro phenyl ester sesquiterpenoids is in the application of preparation osteoclast differentiation inhibitor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170829 Termination date: 20200729 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |