CN105044368A - Indirect ELISA detection kit for antibody level of porcine circovirus PCV2 in immunized rabbit serum, detection method and application thereof - Google Patents
Indirect ELISA detection kit for antibody level of porcine circovirus PCV2 in immunized rabbit serum, detection method and application thereof Download PDFInfo
- Publication number
- CN105044368A CN105044368A CN201510141663.XA CN201510141663A CN105044368A CN 105044368 A CN105044368 A CN 105044368A CN 201510141663 A CN201510141663 A CN 201510141663A CN 105044368 A CN105044368 A CN 105044368A
- Authority
- CN
- China
- Prior art keywords
- pcv2
- antibody
- pet30a
- kit
- dilution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Urology & Nephrology (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Pathology (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an indirect ELISA detection kit for antibody level of porcine circovirus PCV2 in immunized rabbit serum, wherein a recombinant protein encoded by an open reading frame ORF2 in the genome of the PCV2 is employed as a coating antigen in the kit. The invention also provides the detection method and the application of the kit. The indirect ELISA method for detecting the antibody level of the PCV2 in the immunized rabbit serum can be used for fully assaying the antibody level aiming to the PCV2 in the immunized rabbit serum.
Description
Technical field
The present invention relates to the indirect Elisa detection kit of pig circular ring virus PCV 2 antibody horizontal in immunize rabbit serum and detection method thereof and application.
Background technology
Pig circular ring virus (Porcinecircovirus, PCV) is a kind of minimum animal virus found up to now.Existing known PCV has two serotypes, i.e. PCV1 and PCV2.PCV1 is the virus of non-pathogenic.PCV2 is pathogenic virus, and it is the main pathogen of pmws.PCV2 is a kind of DNA virus, and the mechanism of causing a disease at present about PCV2 is not clear.Diagnose effectively controlling epidemic disease significant quickly.Antibody is the most base substance material analyzed PCV2 mechanism of causing a disease and set up corresponding diagnostic method, immunize rabbit serum is modal a kind of type antibodies, detected the validity of immunize rabbit serum antibody by recombinant antigen, to fully ensure antibody so that the reliability of other detection method set up on this basis significant.
PCV2 virion diameter 14-17nm, in 20 body symmetrical structures, without cyst membrane, containing covalence closed sub-thread ring-type minus-strand dna.Full-length genome is 1768bp or 1767bp, and the nucleotide sequence homology between strain is greater than 96%.Genome has two main open reading frame (openreadingframe, ORF), i.e. ORF1 and ORF2.The replicase of ORF1 encode viral, with virus copy transcribe relevant.The structural proteins of ORF2 encode viral and capsid protein Cap, can react with the antiserum of PCV2.So Cap recombinant protein is usually for the diagnosis and detection of antibody.
The method mainly ELISA adsorption analysis method (enzyme-linkedimmunoadsorbentassay of current detection PCV2 antibody horizontal, ELISA), the method replaces traditional agar diffusion method gradually due to the advantage such as easy, quick, sensitive, special.Rabbit is one of primary animal preparing immune serum, the antibody of high-titer can be produced by immunity repeatedly, these antiserums, through purifying and after further marking, may be used for the immune analysis such as ELISA, SABC, flow cytometry and laser co-focusing.So, first set up the ELISA method fully can evaluating immunize rabbit serum significant.
Summary of the invention
The invention provides the indirect Elisa detection kit of pig circular ring virus PCV 2 antibody horizontal in immunize rabbit serum, can be good at detecting the antibody horizontal in immunize rabbit serum, for this reason, the present invention also provides its detection method and application.
The invention provides the indirect Elisa detection kit of pig circular ring virus PCV 2 antibody horizontal in immunize rabbit serum, described kit develops the recombinant protein of reading frame ORF2 coding for envelope antigen with PCV2 viral genome.
Preferably, the amino acid sequence of described recombinant protein is see SEQIDNo.2.
Further, the preparation method of described recombinant protein is: the multiple clone site place Cap encoding gene of PCV2 being cloned into pET30a (+) expression vector, obtain recombinant expression plasmid, recombinant plasmid is proceeded in host's competent cell, obtain recombinant strains through Screening and Identification, under IPTG induction, express PCV2-rCap, through affinity chromatography, obtain the PCV2-rCap of purifying.
Preferably, described kit comprises primary antibodie antibody diluent, and described primary antibodie antibody diluent is: containing 2%pET30a-E.Coli cellular lysate liquid, the PBST of 5% skimmed milk power and 5%BSA.Described number percent is mass volume ratio.
Preferably, described kit also comprises ELIAS secondary antibody, and described ELIAS secondary antibody is that goat antirabbit two resists, and described enzyme is horseradish peroxidase.
Further, the dilutability of described ELIAS secondary antibody is 1:2000.
Preferably, in described kit, the bag of envelope antigen by concentration is: 100ng/100 μ L.
Second object of the present invention is to provide the indirect Elisa detection method of pig circular ring virus PCV 2 antibody horizontal in immunize rabbit serum, and step is as follows:
(1) coated elisa plate: the PCV2-rCap-pET30a recombinant protein after purifying and pET30a-E.Coli mycoprotein are wrapped respectively by microwell plate, washing;
(2) sealase target, washing; The PBST of described sealer preferably containing 5% skimmed milk power;
(3) the rabbit anteserum primary antibodie after dilution is added, washing; Diluting rabbit anteserum primary antibodie dilution used is preferably containing 2%pET30a-E.Coli cellular lysate liquid, the PBST of 5% skimmed milk power and 5%BSA; Described number percent is mass volume ratio;
(4) ELIAS secondary antibody after dilution is added, 37 DEG C of constant temperature oven incubations 1 hour, washing; The PBST dilution of dilution preferably containing 5% skimmed milk power that dilution ELIAS secondary antibody is used; Select the dilution best results of this concentration.
(5) develop the color, stop and read OD in microplate reader
490nmabsorbance value.
Preferably, the purification process of described recombinant protein for: adopt recombinant protein described in affinity chromatography method purifying, be specially: first with inclusion body cleansing solution washing recombinant protein inclusion body, urea washes is used again after centrifugal reservation precipitation, then inclusion body precipitation is dissolved with bufferB, collected by centrifugation supernatant, adds the nickel post after balance by supernatant, room temperature combines; Priority BufferC and BufferD washes pillar afterwards, collects component, finally washes pillar with BufferE and collects component.
3rd object of the present invention is to provide mentioned reagent box and is detecting the application in immunize rabbit serum pig circular ring virus PCV 2 antibody horizontal.
Method of the present invention reduces except nonspecific reaction except adopting the antibody diluent process rabbit anteserum for rabbit anteserum, be also envelope antigen coated elisa plate with the cellular lysate liquid of the pET30a-E.Coli of appropriate (consistent with the amount of PCV2-rCap coated elisa plate) simultaneously, Parallel testing immunize rabbit antibody level of serum, get rid of the nonspecific reaction of immune serum to greatest extent, more fully can evaluate the PCV2 antibody titer of immunize rabbit serum.The indirect ELISA method of detection immunize rabbit blood-serum P CV2 antibody horizontal of the present invention may be used for fully evaluating the antibody horizontal for PCV2 in rabbit anteserum.
Accompanying drawing explanation
Accompanying drawing is used to provide a further understanding of the present invention, and forms a part for instructions, together with embodiments of the present invention for explaining the present invention, is not construed as limiting the invention.In the accompanying drawings:
Fig. 1 is pCV2-rCap (121-669bp)-pET30a [+] recombinant plasmid double digestion qualification collection of illustrative plates.M is nucleic acid molecules quality standard, and 1 for adopting the positive recombinant plasmid of BamHI and XhoI double digestion.
Fig. 2 is the abduction delivering of PCV2-rCap and purifying collection of illustrative plates .M is protein standard, and 1 is the mycoprotein containing the Host Strains of empty carrier and the IPTG abduction delivering of pET30a-BL21 (DE) 3; 2 for containing the recombinant expression carrier bacterial strain of PCV2-Cap gene and the non-abduction delivering mycoprotein of pET30a-PCV2-Cap-BL21 (DE) 3; 3 for containing the recombinant expression carrier bacterial strain of PCV2-Cap gene and the IPTG abduction delivering mycoprotein of pET30a-PCV2-Cap-BL21 (DE) 3; 4 for adopting the PCV2-rCap after affinity chromatography method purifying.
Fig. 3 is the different rabbit anteserum antibody diluent dilution standard rabbit anteserum of employing three kinds, and the ELISA carrying out PCV2-rCap and pET30a-E.Coli bag quilt respectively detects.Ordinate represents the absorbance value of OD492nm, horizontal ordinate represents different rabbit anteserum antibody diluent classifications, wherein " 1 " represents the first antibody diluent namely containing 10% horse serum, 2%pET30a-E.Coli cellular lysate liquid, the PBST of 5% skimmed milk power and 5%BSA; " 2 " represent the second antibody diluent and are containing 2%pET30a-E.Coli cellular lysate liquid, the PBST of 5% skimmed milk power and 5%BSA; Namely " 3 " represent the third antibody diluent is the PBST containing 5% skimmed milk power and 5%BSA.The inner representative of the column diagram with twill bag is carried out ELISA examination criteria rabbit anteserum (1:1000 dilution) by PCV2-rCap, and the inner representative of the column diagram with grid bag is carried out ELISA examination criteria rabbit anteserum (1:1000 dilution) by pET30a-E.Coli.
Embodiment
Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is conventional method.Test material used in following embodiment, if no special instructions, is and purchases available from routine biochemistry reagent shop.
Embodiment 1 is recombinated the capsid protein of PCV2 and the preparation of PCV2-rCap
The construction of recombinant expression plasmid of 1.PCV2-rCap
With the plasmid containing complete PCV2 encoding gene (altogether 1767bp) of laboratory preservation for template, with
P163-F (5-cgc
ggatccatgaaaaatggcatcttcaacacccgcct-3, increases the weight of and attached underscore represents BamHI restriction enzyme site) and P164-R (5-ccg
ctcgagttctctgaattgtacatacatggt-3, to increase the weight of and attached underscore represents XhoI restriction enzyme site) carry out standard PCR amplification for primer, PCR reaction system is: the plasmid that 1 μ L1:10 doubly dilutes is template, 10 μm of each 1 μ L of ol/L upstream and downstream primer, 2.5mmol/LdNTPs2 μ L, EXTaqDNA polymerase 0.2 μ L, 10 × PCR damping fluid 2 μ L, adds ddH
2o to 20 μ L.PCR response procedures is as follows: 95 DEG C of 5min, then 94 DEG C of 1min, 56 DEG C of 1min, 72 DEG C of 1min, and 30 circulations, 72 DEG C extend 10min again.
Obtain the encoding gene segment 121-669bp removing the PCV2 Cap Cap of signal peptide, introduce BamHI restriction enzyme site in upstream simultaneously, XhoI restriction enzyme site is introduced in downstream, adopt PCR primer and commercial pET30a (+) recombinant expression carrier of BamHI and XhoI simultaneously double digestion process purifying, after T4DNA ligase connects, to connect product imports in e. coli bl21 (DE3) pLys competent cell, transformant even spread is on the LA solid agar sugar flat board containing kalamycin resistance, grow overnight, the bacterium colony with kanamycins antibody of picking growth, carry out culture & identification.Shake bacterium and extract the plasmid of candidate's bacterium colony, adopt BamHI and XhoI double digestion to detect, result discharges the DNA fragmentation (see Fig. 1) estimating size.The plasmid of extraction is carried out sequencing analysis, result shows that recombinant plasmid (called after PCV2-rCap-pET30a [+]) is containing genes of interest and corresponding restriction enzyme site, concrete nucleotide sequence see SEQ ID No .1, its coding amino acid sequence see SEQ ID No .2.
2.PCV2-rCap abduction delivering and purifying
Qualification is inoculated in the LB nutrient culture media containing kanamycins containing the positive transformant of recombinant plasmid PCV2-rCap-pET30a [+], 37 DEG C, carry out shaking table concussion under 200rpm condition and cultivate, as bacterium liquid OD
600when reaching 0.6-0.8, adding final concentration is 1.0mMIPTG, 37 DEG C of abduction delivering 6-10h, collects fermentation liquor, and the centrifugal 5min of 12000rpm collects thalline, thalline ddH
2o washes twice settling flux, ultrasonic disruption thalline, and the supernatant after centrifuging fragmentation and precipitation use a little ddH
2o suspends precipitation, prepares electrophoresis detection.The sample getting different piece adds 2x albumen sample-loading buffer, boiling water boiling 5min, get centrifugal after supernatant carry out the detection of 12%SDS-PAGE protein electrophoresis, result shows PCV2-rCap with inclusion bodies by Escherichia coli successful expression, the results are shown in Figure 2.
Because restructuring PCV2-rCap albumen contains histidine-tagged, so, adopt this recombinant protein of affinity chromatography method purifying.Process is as follows: first with the inclusion body that inclusion body cleansing solution washing ultrasonic disruption is collected, wash use centrifuge at every turn, 10000 revs/min, 10 minutes, abandon supernatant and retain precipitation, use 2M urea washes again 2 times, then dissolve inclusion body precipitation, the supernatant that collected by centrifugation dissolves with bufferB, then supernatant is added the nickel post after by bufferB balance, room temperature, in conjunction with 40min, allows albumen and resin hatch combination.Wash pillar with 5 times of BufferC to applied sample amount volume afterwards, wash altogether 3 times; Wash pillar with 500 μ lBufferD again, wash 8-10 time and collect component, finally wash pillar with 500 μ lBufferE, generally wash 10 times and collect component, 12%SDS-PAGE gel detection purifying protein, the results are shown in Figure 2.Solution preparation method is with reference to " Molecular Cloning: A Laboratory guide ".
Inclusion body lavation buffer solution: 50mMTris-Cl (pH8.0), 10mMEDTA (pH8.0), 100mMNaCl, 0.05%TritonX-100;
BufferB (lysate/binding buffer liquid): 8M urea, 0.1M sodium phosphate buffer, 0.01MTris-Cl, pH8.0;
BufferC (lavation buffer solution): 8M urea, 0.1M sodium phosphate buffer, 0.01MTris-ClpH6.3;
BufferD (elution buffer): 8M urea, 0.1M sodium phosphate buffer, 0.01MTris-ClpH5.9;
BufferE (elution buffer): 8M urea, 0.1M sodium phosphate buffer, 0.01MTris-ClpH4.5.
Embodiment 2 detects the foundation of the Immunofluorescent antibody analytical approach (ELISA) of immunize rabbit blood-serum P CV2 antibody horizontal
On the PCV2-rCap basis of above-mentioned purifying, with commercial PCV2 rabbit anteserum for standard positive serum, with not immune rabbit anteserum for standard female serum, by Optimal reaction conditions, set up the indirect ELISA method detecting immunize rabbit blood-serum P CV2 antibody horizontal.
1. determine rabbit anteserum antibody diluent
Antibody diluent, especially the antibody diluent of primary antibodie, play an important role in the indirect ELISA method setting up detection immunize rabbit blood-serum P CV2 antibody horizontal, first by using different primary antibodie antibody dilutions, wrapping by the ELISA Plate of PCV2-rCap and pET30a-E.Coli respectively, by the detection to standard positive rabbit anteserum, the primary antibodie antibody diluent be suitable for is determined in screening.By the com-parison and analysis to different antibodies dilution, finally determine containing 2%pET30a-E.Coli cellular lysate liquid, the PBST of 5% skimmed milk power and 5%BSA is optimum rabbit anteserum antibody diluent, adopts this antibody diluent to greatly reduce the nonspecific reaction (see Fig. 3) of PCV2 rabbit anteserum and pET30a-E.Coli mycoprotein.
Determine that the process of the suitableeest antibody diluent is as follows: (1) coated elisa plate: the PCV2-rCap-pET30a recombinant protein and the pET30a-E.Coli mycoprotein concentration that first adopt the BCA protein quantification kit measurement purifying of Pierce company, with the coating buffer diluted protein of Sigma company, with 200ng/100 μ L/ pore system bag by microwell plate, 4 DEG C of bags are spent the night; (2) detersive enzyme target: take out bag by good ELISA Plate, abandon supernatant, PBST liquid washes 2 times, and third time fills it up with hole, trace concussion instrument concussion 5min, dries liquid in hole, relaunders twice, third time fills it up with hole, and room temperature leaves standstill 5min, dries liquid in hole; (3) sealase target: add the PBST containing 5% skimmed milk power, 300 μ l/ holes, incubated at room 1 hour; (4) detersive enzyme target: as the washing of step 2 method; (5) add primary antibodie: adopt following three kinds of different antibody diluents to dilute the PCV2 rabbit anteserum of Abcam company with 1:1000,100 μ L/ holes, be added in the ELISA Plate closed, 37 DEG C of constant temperature oven incubations 1 hour.Three kinds of antibody diluents are respectively: the first is containing 10% horse serum, 2%pET30a-E.Coli cellular lysate liquid (namely adopting the coli somatic ultrasonic treatment liquid of BL21 (DE3) pLys containing pET30a (+) empty carrier of IPTG abduction delivering), the PBST of 5% skimmed milk power and 5%BSA, the second is containing 2%pET30a-E.Coli cellular lysate liquid, the PBST of 5% skimmed milk power and 5%BSA, the third is the PBST containing 5% skimmed milk power and 5%BSA; (6) microwell plate is washed: as the washing of step 2 method; (7) ELIAS secondary antibody is added: the goat antirabbit two anti-(Sigma company) diluting horseradish peroxidase-labeled with the PBST dilution containing 5% skimmed milk power with 1:2000,100 μ L/ holes, 37 DEG C of constant temperature oven incubations 1 hour; (8) microwell plate is washed: as the washing of step 2 method; (9) develop the color: (6mlOPD liquid adds 10 μ LH to the o-phenylenediamine OPD nitrite ion adding containing hydrogen peroxide
2o
2), 100 μ L/ holes, hatch 30min for 37 DEG C; (10) cessation reaction read value: take out colour developing ELISA Plate, directly add the sulfuric acid stop buffer cessation reaction of 1.5M, 50 μ L/ holes, are namely engraved in microplate reader and read OD
490the absorbance value of nm.Each sample repeats for 4 times, gets its average.
The normal rabbit serum of different rabbit anteserum antibody diluent dilution is adopted to react at the ELISA being envelope antigen with PCV2-rCap and pET30a-E.Coli respectively by comparing simultaneously, can find out, the second antibody diluent is namely containing 2%pET30a-E.Coli cellular lysate liquid, the PBST of 5% skimmed milk power and 5%BSA is optimum rabbit anteserum antibody diluent, because with the nonspecific reaction greatly reducing PCV2 rabbit anteserum and pET30a-E.Coli mycoprotein after this liquid diluting rabbit anteserum, reacting value is about 0.1, and still remain on higher level with the reaction of PCV2-rCap, reacting value is at about 1.0 (see Fig. 3).Non-immune rabbit anteserum is with to be equal to the ELISA reacting value that is envelope antigen with PCV2-rCap and pET30a-E.Coli after the dilution of this antibody dilution or lower than 0.1.All higher with the ELISA reacting value taking pET30a-E.Coli as envelope antigen with the normal rabbit serum of other two kinds of antibody diluents dilution, close to or higher than 0.3, disturb the judgement to rabbit anteserum PCV2 antibody horizontal.
2. determine the package amount of PCV2-rCap
After determining the suitableeest rabbit anteserum antibody diluent, the bag of further optimization PCV2-rCap is by concentration, by PCV2-rCap according to 800,400,200,100,50, coated elisa plate hole, 25ng/100 μ L/ hole, carries out ELISA reaction by above-mentioned flow process, and result shows that the optimum bag of PCV2-rCap is 100ng/100 μ L/ hole by concentration.
3. determine the working concentration of ELIAS secondary antibody
After determining that the bag of the suitableeest rabbit anteserum antibody diluent and PCV2-rCap is by concentration, optimize the reaction density of ELIAS secondary antibody further, by the goat antirabbit two anti-(Sigma company) of horseradish peroxidase-labeled according to 1:8000,1:4000; Add reacting hole after 1:2000,1:1000 and 1:500 dilution, carry out ELISA reaction by above-mentioned flow process, result shows that the optimum dilution degree of ELIAS secondary antibody is 1:2000.
4. the indirect ELISA method detecting immunize rabbit blood-serum P CV2 antibody horizontal is set up
Through to the screening of rabbit anteserum antibody diluent and after determining that best PCV2-rCap bag is by the dilutability of concentration and ELIAS secondary antibody, establish the indirect ELISA method detecting immunize rabbit blood-serum P CV2 antibody horizontal, its program is as follows:
(1) coated elisa plate: PCV2-rCap-pET30a recombinant protein and pET30a-E.Coli mycoprotein coating buffer are diluted, respectively with the system bag in 100ng/100 μ L/ hole by microwell plate, 4 DEG C of bags are spent the night;
(2) detersive enzyme target: take out bag by good ELISA Plate, abandon supernatant, PBST liquid washes 2 times, and third time fills it up with hole, trace concussion instrument concussion 5min, dries liquid in hole, relaunders twice, third time fills it up with hole, and room temperature leaves standstill 5min, dries liquid in hole;
(3) sealase target: add the PBST containing 5% skimmed milk power, 300 μ l/ holes, incubated at room 1 hour;
(4) detersive enzyme target: as the washing of step 2 method;
(5) add rabbit anteserum primary antibodie: adopt containing 2%pET30a-E.Coli cellular lysate liquid, the PBST of 5% skimmed milk power and 5%BSA dilutes rabbit anteserum, 100 μ L/ holes, is added in the ELISA Plate closed, 37 DEG C of constant temperature oven incubations 1 hour;
(6) microwell plate is washed: as the washing of step 2 method;
(7) ELIAS secondary antibody is added: the goat antirabbit two anti-(Sigma company) diluting horseradish peroxidase-labeled with the PBST dilution containing 5% skimmed milk power with 1:2000,100 μ L/ holes, 37 DEG C of constant temperature oven incubations 1 hour;
(8) microwell plate is washed: as the washing of step 2 method;
(9) show: (6mlOPD liquid adds 10 μ LH to the o-phenylenediamine OPD nitrite ion adding containing hydrogen peroxide
2o
2), 100 μ L/ holes, hatch 30min for 37 DEG C;
(10) cessation reaction read value: take out colour developing ELISA Plate, directly add the sulfuric acid stop buffer cessation reaction of 1.5M, 50 μ L/ holes, are namely engraved in microplate reader and read OD
490nmabsorbance value.
After establishing the indirect ELISA method detecting immunize rabbit blood-serum P CV2 antibody horizontal as mentioned above, the method can be adopted to evaluate the PCV2 antibody horizontal of immunize rabbit serum.
Embodiment three: the application of the indirect ELISA method of the detection immunize rabbit blood-serum P CV2 antibody horizontal of foundation
1. immunize rabbit serum preparation
Adopt PCV2 inactivated vaccine circle Bi Jing (production of Shanghai Hai Li company) immune adult male New Zealand White Rabbit 3, every rabbit immunity 1 milliliter at every turn, divide multi-point injection at dorsal sc, every two weeks booster immunizations once, continuous immunity 3 months, before each immunity, gather ear source venous blood after one month, collect serum ,-20 DEG C of preservations.
2. the detection of immunize rabbit serum antibody titer
The indirect ELISA method of the detection immunize rabbit blood-serum P CV2 antibody horizontal set up by embodiment 2 detects the immunity rabbit anteserum antibody horizontal of deactivation PCV2 vaccine: respectively by PCV2-rCap and pET30a-E.Coli mycoprotein by 100ng/100 μ L/ hole coated elisa plate, add after closing with containing 2%pET30a-E.Coli cellular lysate liquid, the immunize rabbit serum of the PBST antibody diluent serial dilution of 5% skimmed milk power and 5%BSA, 1:2000 ELIAS secondary antibody is added after hatching end, add zymolyte display, read OD
490nmabsorbance value.Each dilutability 3 repetition, gets its average, and testing result is as shown in table 1-table 3.
Table 1 adopts indirect ELISA method to detect first PCV2 vaccine immunity rabbit serum antibody titer
Table 1 result shows, first PCV2 inactivated vaccine immune rabbit serum antibody titer eight is the highest after exempting from can reach about 1:6400.This rabbit is along with the increase antibody horizontal of immune time is in increasing trend gradually, and after exempting to terminate eight, the serum antibody titer of immune rabbit PCV2 reaches the highest, when diluting with 1:6400, and OD
492nmread value and reach more than 0.8, and with the reacting value of pET30a-E.Coli about 0.1.With the reacting value of antibody and target protein PCV2-rCap about 0.8, and be no more than 0.2 for standard is as the antibody titer judging immune serum with the reacting value of pET30a-E.Coli, so the PCV2 serum antibody titer of first rabbit is the highest can reach more than 1:6000.
Table 2 adopts indirect ELISA method to detect second PCV2 vaccine immunity rabbit serum antibody titer
Table 2 result shows, second PCV2 inactivated vaccine immune rabbit serum antibody titer is the highest can reach more than 1:10000.This rabbit 2 weeks antibody titers after second time immunity obviously raise, and reading value after 1:3200 dilution can reach more than 0.8.Afterwards along with the increase of immune time, three exempting from, four exempt to have occurred when exempting from five that antibody horizontal once declines, again start lifting after exempting from 2 weeks afterwards six, after exempting to terminate eight, the serum antibody titer of immune rabbit PCV2 reaches the highest, when diluting with 1:12800, OD
492nmread value and reach about 1.0, and with the reacting value of pET30a-E.Coli about 0.1.
Table 3 adopts indirect ELISA method to detect the 3rd PCV2 vaccine immunity rabbit serum antibody titer
Table 3 result shows, the 3rd PCV2 inactivated vaccine immune rabbit serum antibody titer can reach more than 1:2000 after exempting from eight.Along with the increase of immune time, the antibody level of serum of the PCV2 of this immune rabbit slowly increases gradually, six to exempt from front antibody horizontal always very low, after exempting from six, antibody horizontal starts obvious rising, eight serum of exempting from rear bloodletting dilute with 1:1600, with the reacting value of PCV2-rCap about 0.9, and be no more than 0.15 with the reacting value of pET30a-E.Coli.With the reacting value of antibody and target protein PCV2-rCap about 0.8, and be no more than 0.2 for standard is as the antibody titer judging immune serum with the reacting value of pET30a-E.Coli, so the PCV2 serum antibody titer of the 3rd rabbit can reach more than 1:2000.
Adopt the serum antibody of newly-established PCV2-rCapELISA and pET30a-E.ColiELISA method to three PCV2 inactivated vaccine immune rabbits to carry out and detect analysis, result shows that the immune effect of second rabbit is best, after the 8th immunity, serum antibody titer can reach 1:10000, and the immune effect of the 3rd rabbit is the poorest, after eight immunity, most high-titer is only about 1:2000.The immune effect of first rabbit is good, and eight exempt from rear antibody titer can reach 1:6400.By the detection of dynamic to three immune rabbit PCV2 antibody level of serums, result shows, the indirect ELISA method for detection immunize rabbit blood-serum P CV2 antibody horizontal of foundation is reliable, fully can evaluate the antibody horizontal of serum.
Last it is noted that the foregoing is only the preferred embodiments of the present invention, be not limited to the present invention, although with reference to previous embodiment to invention has been detailed description, for a person skilled in the art, it still can be modified to the technical scheme described in foregoing embodiments, or carries out equivalent replacement to wherein portion of techniques feature.Within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.
Sequence table
<110> Lanzhou Veterinary Inst., Chinese Acedemy of Agaricultural Sciences
The indirect Elisa detection kit of pig circular ring virus PCV 2 antibody horizontal and detection method thereof and application in <120> immunize rabbit serum
<170>PatentInversion3.5
<210>1
<211>561
<212>DNA
<213> artificial sequence
<400>1
ggatccaaaaatggcatcttcaacacccgcctctcccgcaccatcggttatactgtcaag60
aaaaccacagtcagaacgccctcctggaatgtggacatgatgagatttaatattaatgat120
tttcttcccccaggagggggctcaaaccccctcactgtgccctttgaatactacagaata180
aggaaggttaaggttgaattctggccctgctccccaatcacccagggtgacaggggagtg240
ggctccactgctgttattctagatgataactttgtaacaaaggccaatgccctaacctat300
gacccctatgtaaactactcctcccgccataccataacccagcccttctcctaccactcc360
cggtactttaccccgaaacctgtccttgataggacaatcgattacttccaacccaataac420
aaaagaaatcaactctggctgagactacaaactactggaaatgtagaccatgtaggcctc480
ggcactgcgttcgaaaacagtatatacgaccaggactacaatatccgtataaccatgtat540
gtacaattcagagaactcgag561
<210>2
<211>187
<212>PRT
<213> artificial protein
<400>2
GlySerLysAsnGlyIlePheAsnThrArgLeuSerArgThrIleGly
151015
TyrThrValLysLysThrThrValArgThrProSerTrpAsnValAsp
202530
MetMetArgPheAsnIleAsnAspPheLeuProProGlyGlyGlySer
354045
AsnProLeuThrValProPheGluTyrTyrArgIleArgLysValLys
505560
ValGluPheTrpProCysSerProIleThrGlnGlyAspArgGlyVal
65707580
GlySerThrAlaValIleLeuAspAspAsnPheValThrLysAlaAsn
859095
AlaLeuThrTyrAspProTyrValAsnTyrSerSerArgHisThrIle
100105110
ThrGlnProPheSerTyrHisSerArgTyrPheThrProLysProVal
115120125
LeuAspArgThrIleAspTyrPheGlnProAsnAsnLysArgAsnGln
130135140
LeuTrpLeuArgLeuGlnThrThrGlyAsnValAspHisValGlyLeu
145150155160
GlyThrAlaPheGluAsnSerIleTyrAspGlnAspTyrAsnIleArg
165170175
IleThrMetTyrValGlnPheArgGluLeuGlu
180185
Claims (10)
1. the indirect Elisa detection kit of pig circular ring virus PCV 2 antibody horizontal in immunize rabbit serum, is characterized in that: the recombinant protein that described kit is encoded with PCV2 viral genome open reading frame ORF2 is for envelope antigen.
2. kit according to claim 1, is characterized in that: the amino acid sequence of described recombinant protein is see SEQIDNo.2.
3. kit according to claim 2, it is characterized in that: the preparation method of described recombinant protein is: the multiple clone site place Cap encoding gene of PCV2 being cloned into pET30a (+) expression vector, obtain recombinant expression plasmid, recombinant plasmid is proceeded in host's competent cell, obtain recombinant strains through Screening and Identification, under IPTG induction, express PCV2-rCap, through affinity chromatography, obtain the PCV2-rCap of purifying.
4. kit according to claim 1, is characterized in that: described kit comprises primary antibodie antibody diluent, and described primary antibodie antibody diluent is: containing 2%pET30a-
e.Colicellular lysate liquid, the PBST of 5% skimmed milk power and 5%BSA; Described number percent is mass volume ratio.
5. kit according to claim 1, is characterized in that: described kit also comprises ELIAS secondary antibody, and described ELIAS secondary antibody is that goat antirabbit two resists, and described enzyme is horseradish peroxidase.
6. kit according to claim 4, is characterized in that: the dilutability of described ELIAS secondary antibody is 1:2000.
7. kit according to claim 1, is characterized in that: in described kit, the bag of envelope antigen by concentration is: 100ng/100 μ L.
8. the indirect Elisa detection method of pig circular ring virus PCV 2 antibody horizontal in immunize rabbit serum, is characterized in that: step is as follows:
(1) coated elisa plate: by the PCV2-rCap-pET30a recombinant protein after purifying and pET30a-
e.Colimycoprotein wraps respectively by microwell plate, washing;
(2) sealase target, washing; The PBST of described sealer preferably containing 5% skimmed milk power;
(3) the rabbit anteserum primary antibodie after dilution is added, washing; Dilute rabbit anteserum primary antibodie dilution used to be preferably containing 2%pET30a-
e.Colicellular lysate liquid, the PBST of 5% skimmed milk power and 5%BSA; Described number percent is mass volume ratio;
(4) ELIAS secondary antibody after dilution is added, 37 DEG C of constant temperature oven incubations 1 hour, washing; The PBST dilution of dilution preferably containing 5% skimmed milk power that dilution ELIAS secondary antibody is used;
(5) develop the color, stop and read OD in microplate reader
490nmabsorbance value.
9. method according to claim 8, it is characterized in that: adopt recombinant protein described in affinity chromatography method purifying, be specially: first with inclusion body cleansing solution washing recombinant protein inclusion body, urea washes is used again after centrifugal reservation precipitation, then inclusion body precipitation is dissolved with bufferB, collected by centrifugation supernatant, adds the nickel post after balance by supernatant, room temperature combines; Priority BufferC and BufferD washes pillar afterwards, collects component, finally washes pillar with BufferE and collects component.
10. the arbitrary described kit of claim 1-7 is detecting the application in immunize rabbit serum pig circular ring virus PCV 2 antibody horizontal.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510141663.XA CN105044368B (en) | 2015-03-27 | 2015-03-27 | The indirect Elisa detection kits of pig circular ring virus PCV 2 antibody level and its detection method and application in immune rabbit anteserum |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510141663.XA CN105044368B (en) | 2015-03-27 | 2015-03-27 | The indirect Elisa detection kits of pig circular ring virus PCV 2 antibody level and its detection method and application in immune rabbit anteserum |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105044368A true CN105044368A (en) | 2015-11-11 |
CN105044368B CN105044368B (en) | 2017-08-29 |
Family
ID=54451070
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510141663.XA Active CN105044368B (en) | 2015-03-27 | 2015-03-27 | The indirect Elisa detection kits of pig circular ring virus PCV 2 antibody level and its detection method and application in immune rabbit anteserum |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105044368B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109001461A (en) * | 2018-06-26 | 2018-12-14 | 安阳工学院 | The immune quick testing reagent box of PCV-3 immunity evaluation and wild virus infection diagnosis |
CN109060972A (en) * | 2018-05-16 | 2018-12-21 | 苏州药明泽康生物科技有限公司 | Application of the rabbit blood in preparation human disease's external diagnosis reagent case |
Citations (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1588076A (en) * | 2004-09-28 | 2005-03-02 | 浙江大学 | Indirect ELISA diagnostic reagent kit for pig B type circular virus antibody |
CN200962112Y (en) * | 2006-06-07 | 2007-10-17 | 浙江大学 | Pig circovirus II type antibody detection reagent box |
KR20080087317A (en) * | 2007-03-26 | 2008-10-01 | 전남대학교산학협력단 | Protein chip for diagnosing porcine circovirus and method of diagnosing porcine circovirus using the chip |
WO2009000459A1 (en) * | 2007-06-22 | 2008-12-31 | Ghent University | Methods and compositions in the treatment of porcine circoviral infection |
CN101629956A (en) * | 2009-07-09 | 2010-01-20 | 湖南农业大学 | ELISA kit for detecting porcine circovirus antibody II |
CN101799471A (en) * | 2009-12-23 | 2010-08-11 | 湖南农业大学 | Indirect ELISA (Enzyme-Linked Immuno Sorbent Assay) method established based on classical swine fever virus NS3 |
CN103033614A (en) * | 2012-12-19 | 2013-04-10 | 北京伟嘉人生物技术有限公司 | ELISA kit for porcine circovirus type 2 antibody detection |
KR20140118626A (en) * | 2013-03-29 | 2014-10-08 | 고려대학교 산학협력단 | PCV2 ORF3-specific primer/probe sets and the method for quantitative analysis of PCV2 DNA in the porcine blood using the same |
CN104725490A (en) * | 2015-03-23 | 2015-06-24 | 湖北省农业科学院畜牧兽医研究所 | Porcine circovirus 2 type ELISA antibody detection kit |
-
2015
- 2015-03-27 CN CN201510141663.XA patent/CN105044368B/en active Active
Patent Citations (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1588076A (en) * | 2004-09-28 | 2005-03-02 | 浙江大学 | Indirect ELISA diagnostic reagent kit for pig B type circular virus antibody |
CN200962112Y (en) * | 2006-06-07 | 2007-10-17 | 浙江大学 | Pig circovirus II type antibody detection reagent box |
KR20080087317A (en) * | 2007-03-26 | 2008-10-01 | 전남대학교산학협력단 | Protein chip for diagnosing porcine circovirus and method of diagnosing porcine circovirus using the chip |
WO2009000459A1 (en) * | 2007-06-22 | 2008-12-31 | Ghent University | Methods and compositions in the treatment of porcine circoviral infection |
CN101629956A (en) * | 2009-07-09 | 2010-01-20 | 湖南农业大学 | ELISA kit for detecting porcine circovirus antibody II |
CN101799471A (en) * | 2009-12-23 | 2010-08-11 | 湖南农业大学 | Indirect ELISA (Enzyme-Linked Immuno Sorbent Assay) method established based on classical swine fever virus NS3 |
CN103033614A (en) * | 2012-12-19 | 2013-04-10 | 北京伟嘉人生物技术有限公司 | ELISA kit for porcine circovirus type 2 antibody detection |
KR20140118626A (en) * | 2013-03-29 | 2014-10-08 | 고려대학교 산학협력단 | PCV2 ORF3-specific primer/probe sets and the method for quantitative analysis of PCV2 DNA in the porcine blood using the same |
CN104725490A (en) * | 2015-03-23 | 2015-06-24 | 湖北省农业科学院畜牧兽医研究所 | Porcine circovirus 2 type ELISA antibody detection kit |
Non-Patent Citations (2)
Title |
---|
商绍彬 等: "重组表达猪圆环病毒2 型衣壳蛋白的抗原特性分析", 《微生物学报》 * |
董林: "猪圆环病毒2型诊断试剂盒的研制与应用", 《中国博士学位论文全文数据库》 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109060972A (en) * | 2018-05-16 | 2018-12-21 | 苏州药明泽康生物科技有限公司 | Application of the rabbit blood in preparation human disease's external diagnosis reagent case |
CN109060972B (en) * | 2018-05-16 | 2021-09-24 | 苏州药明泽康生物科技有限公司 | Application of rabbit blood in preparing human disease in-vitro diagnosis kit |
CN109001461A (en) * | 2018-06-26 | 2018-12-14 | 安阳工学院 | The immune quick testing reagent box of PCV-3 immunity evaluation and wild virus infection diagnosis |
CN109001461B (en) * | 2018-06-26 | 2024-02-02 | 安阳工学院 | Immune rapid test kit for PCV-3 immune evaluation and wild virus infection diagnosis |
Also Published As
Publication number | Publication date |
---|---|
CN105044368B (en) | 2017-08-29 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Emerson et al. | Putative neutralization epitopes and broad cross-genotype neutralization of Hepatitis E virus confirmed by a quantitative cell-culture assay | |
Zhao et al. | Development and application of an indirect ELISA for detection of antibodies against avian hepatitis E virus | |
Yu et al. | Establishment of a blocking ELISA detection method for against African swine fever virus p30 antibody | |
CN112877348B (en) | African swine fever virus CD2v extracellular domain recombinant protein and application thereof | |
KR20160097219A (en) | Improved diagnostic test for csfv antibodies | |
CN102731615A (en) | Detection reagent and detection method for PRRSV | |
CN109402069A (en) | A kind of pseudovirion and its preparation method and application | |
CN113684189A (en) | Novel chicken circovirus type 3 strain and detection system based on same | |
Ji et al. | An improved indirect ELISA for specific detection of antibodies against classical swine fever virus based on structurally designed E2 protein expressed in suspension mammalian cells | |
CN106518989B (en) | Polypeptide for detecting porcine Delta coronavirus antibody, preparation method and application thereof | |
CN105044368A (en) | Indirect ELISA detection kit for antibody level of porcine circovirus PCV2 in immunized rabbit serum, detection method and application thereof | |
Ran et al. | Development and validation of a competitive ELISA based on bacterium-original virus-like particles of serotype O foot-and-mouth disease virus for detecting serum antibodies | |
CN111848748B (en) | African swine fever virus truncated protein and application thereof in preparation of ELISA (enzyme-linked immunosorbent assay) detection kit | |
CN102533663B (en) | Foot-and-mouth disease hybridoma cell line, monoclonal antibody, detection reagent and test kit | |
CN114152748A (en) | Double-antibody sandwich ELISA diagnostic kit for detecting African swine fever virus and method thereof | |
CN103235121A (en) | Indirect ELISA kit for detecting porcine transfusion transmitted virus 2 (TTV2) antibody | |
CN103063838B (en) | Primer and kit for identifying foot-and-mouth disease and immunity of entry animal | |
CN110684085A (en) | ASFV-P54 protein recombination method and sandwich ELISA kit prepared by using same | |
CN116023506B (en) | ASFV nonstructural protein dominant antigen epitope fusion protein, kit and application thereof | |
CN107064488B (en) | A kind of total antibody solid phase of swine fever virus serum blocks the preparation method of antigen used in ELISA kit | |
Tripathi et al. | Production, purification and characterization of recombinant dengue multiepitope protein | |
Kunita et al. | Simultaneous detection of antibodies to mouse hepatitis virus recombinant structural proteins by a microsphere-based multiplex fluorescence immunoassay | |
CN104297493A (en) | Application of soluble I-type duck hepatitis virus 3D protein to preparation of ELISA reagent and ELISA kit | |
CN114113634A (en) | ELISA detection kit for detecting African swine fever virus antibody and application of protein L | |
CN110698542B (en) | Artificially-modified porcine circovirus type 2 Rep' protein, ELISA (enzyme-linked immuno sorbent assay) detection kit and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |