CN105044350A - ELISA detection kit for porcine pseudorabies virus gG - Google Patents
ELISA detection kit for porcine pseudorabies virus gG Download PDFInfo
- Publication number
- CN105044350A CN105044350A CN201510369986.4A CN201510369986A CN105044350A CN 105044350 A CN105044350 A CN 105044350A CN 201510369986 A CN201510369986 A CN 201510369986A CN 105044350 A CN105044350 A CN 105044350A
- Authority
- CN
- China
- Prior art keywords
- hole
- protein
- elisa plate
- liquid
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
- G01N33/56994—Herpetoviridae, e.g. cytomegalovirus, Epstein-Barr virus
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2469/00—Immunoassays for the detection of microorganisms
- G01N2469/20—Detection of antibodies in sample from host which are directed against antigens from microorganisms
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Tropical Medicine & Parasitology (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the field of biological detection, and particularly provides an ELISA detection kit for porcine pseudorabies virus gG. The kit comprises an elisa plate coated with a porcine pseudorabies virus gG protein recombined antigen. A preparation method for the gG protein recombined antigen comprises the following steps: performing amplification by a primer pair to obtain a gG protein gene fragment by taking a gG protein encoding gene as a template, constructing a recombined expression carrier, and expressing the gG protein recombined antigen by a prokaryotic system. The primer pair comprises an upstream primer: ATGAATTCAGAGAGGCCCCTCGGGA and a downstream primer: TAAAGCTTGGCCGCGGGCGAGCCCAC.
Description
Technical field
The present invention relates to field of biological detection, specifically, relate to the ELISA detection kit of a kind of PRV gG.
Background technology
Pseudoabies (Pseudorabies, PR) be by Pseudorabies virus (Pseudorabiesvirus, PRV) one caused with heating, very to itch (except pig) and encephalomyelitis is the acute infectious disease of cardinal symptom, normal infected pigs, ox, sheep, mouse etc., pig is the main host of this virus, it mainly causes sow breeding difficulty, shows as miscarriage, stillborn foetus, mummy tire etc.; When newborn piglet occurs to infect, mortality ratio can reach 100%.This disease is the disease of natural focus of extremely difficult epidemic prevention, and because its velocity of propagation is fast, mortality ratio is high, Epidemic Scope is wide, route of transmission is many, pathogen persistent infection in animal body, International Animal Health tissue (OIE) is classified as two class infectious diseases.There is this disease in existing 31 provinces and cities of China, causes serious economic loss to animal husbandry.
The application of pseudorabies gene delection marker vaccine and supporting differential diagnosis kit is the effective way that this disease is eradicated in purification.At present, China uses gene-deleted vaccine to be mainly the Bartha-k61 strain live vaccine of disappearance gE gene.In addition, the gG gene-deleted strain vaccine of domestic independent research is also extended volume growth gradually, this vaccine there is no supporting differential diagnosis kit, wild virus infection or the swinery of vaccine immunity cannot be distinguished by commercially available detection kit after vaccine immunity, therefore need the differential diagnosis kit can distinguishing vaccine immunity and wild virus infection badly.
Summary of the invention
In order to solve problems of the prior art, the object of this invention is to provide the ELISA detection kit of a kind of PRV gG.
In order to realize the object of the invention, technical scheme of the present invention is as follows:
An ELISA detection kit of PRV gG, described kit comprises the ELISA Plate being coated with PRV gG Protein reconstitution antigen;
The preparation method of described gG Protein reconstitution antigen is as follows: with gG protein coding gene for template, utilizes primer pair amplifies to obtain gG protein gene fragment, builds recombinant expression carrier, expresses gG Protein reconstitution antigen by prokaryotic system;
Described primer pair comprises:
Upstream primer: ATGAATTCAGAGAGGCCCCTCGGGA;
Downstream primer: TAAAGCTTGGCCGCGGGCGAGCCCAC.
Further, described recombinant expression carrier is transformed in Escherichia coli Rosetta (DE3), adds IPTG and carry out abduction delivering; By expression product by after His-Tag affinity chromatography method purifying, obtain the gG Protein reconstitution antigen of purifying.
As preferably, the package amount of described gG Protein reconstitution antigen is 0.1-1ug/ hole.
Further, the preparation method being coated with the ELISA Plate of PRV gG Protein reconstitution antigen described in comprises the steps:
1) by the sodium carbonate buffer of gG Protein reconstitution antigen 0.05MpH9.6 dilution gG Protein reconstitution antigen, add in ELISA Plate hole, package amount is 0.1-1ug/ hole;
2) ELISA Plate shrouding film is covered, at being placed in 37 DEG C 30 minutes, then go to 4 DEG C and hatch and be not less than 12h;
3) discard liquid in ELISA Plate hole, in plate hole, add hand-hole cleansing solution, leave standstill 3 minutes, repeat 3 ~ 5 times; Discard liquid in hole during each washing, after last washing discards cleansing solution, residual liquid is patted dry on thieving paper;
4) with the phosphate buffer sealase target of the 0.01MpH7.4 containing the new cow's serum of 0.5-4%BSA, 2%-8%;
5) 1h at ELISA Plate being placed in 37 DEG C, discards liquid in hole after hatching, thieving paper pats dry;
6) add the phosphate buffer incubated at room 3-5h of the 0.01MpH7.4 containing 5%-20% sucrose to ELISA Plate plate hole, discard liquid in hole, after naturally drying, vacuumize sealing with the packaging bag adding drying agent and preserve.
Further, described kit comprises enzyme labelled antibody, and described enzyme labelled antibody is the anti-pig IgG of goat of horseradish peroxidase-labeled.Described enzyme labelled antibody sample diluting liquid does 1: 25000 times of dilution, is packed as 25ml/ bottle.
Further, described kit also comprises: sample diluting liquid, cleansing solution, negative control sera, positive control serum, substrate nitrite ion A, B and stop buffer.
Further, described positive control serum is after gG Protein reconstitution antigen immune pig, gathers the Swine serum containing gG antibody.
Further, ProClin300 is contained as antiseptic in described sample diluting liquid and cleansing solution.
Described negative control sera is the health pig serum not infecting PRV.
Particularly, the composition of described sample diluting liquid, cleansing solution, substrate nitrite ion A, B and stop buffer and content as follows:
Sample diluting liquid: take NaCl8.0g, KCl0.2g, Na
2hPO
412H
2o2.9g, BSA1.0g, ProClin3001.0ml adding distil water 900ml dissolves, and adding distil water is settled to 1000ml, is packed as 40ml/ bottle.
10 times of concentrated cleaning solutions (0.1MpH7.4 phosphate buffer): take NaCl80g, KCl2.0g, Na
2hPO
412H
2o29g, ProClin3001.0ml adding distil water 900ml dissolves, then adds Tween-205ml, and adding distil water is settled to 1000ml, is packed as 60ml/ bottle.During use, can use with after distilled water 10 times dilution.
Substrate colour developing A liquid: sodium acetate 13.6g, citric acid 1.6g, 30% hydrogen peroxide 0.3ml, distilled water adds to 500ml, is packed as 15ml/ bottle.
Substrate colour developing B liquid: disodium ethylene diamine tetraacetate 0.2g, citric acid 0.95g, glycerine 50ml, get 0.15gTMB and be dissolved in 3mlDMSO, distilled water adds to 500ml, is packed as 15ml/ bottle.
Stop buffer: dropwise add the concentrated sulphuric acid (98%) 108.7ml in 891.3ml distilled water, obtain the H of 2mol/L
2sO
4aqueous solution, be packed as 15ml/ bottle after mixing, room temperature preservation.
The present invention still further provides described kit and is detecting the application in Swine serum in gG antibody.
Described application is specially:
1) from kit, ELISA Plate (having wrapped by 96 hole ELISA Plate of gG Protein reconstitution antigen) is taken out, with sample diluting liquid by serum sample to be checked 40 times dilution (such as: the sample of 5ul adds 195ul Sample dilution).Draw 100ul mixed liquor in ELISA Plate with pipettor, positive control serum and each holes of negative control sera are set, every hole 100ul simultaneously;
2) under 37 DEG C of conditions, 60 minutes are hatched;
3) discard liquid in hole, in orifice plate, add about 300ul/ hole cleansing solution (10 times of concentrate distilled water dilutings are 1 times of working fluid), leave standstill 3 minutes, repeat 3-5 time.All should discard liquid in hole during each washing, after last washing discards cleansing solution, residual liquid be patted dry on thieving paper;
4) every hole adds 100ul enzyme labelled antibody;
5) under 37 DEG C of conditions, 30 minutes are hatched;
6) step 3 is repeated);
7) every hole adds substrate nitrite ion A and each 50ul of substrate nitrite ion B, slightly shakes mixing, avoids overflow in hole;
8) under 37 DEG C of conditions, 15 minutes are hatched;
9) every hole adds 50ul stop buffer, makes reaction terminating;
10) measure and record the OD value (450nm) of test sample and contrast.
Kit criterion of the present invention: the mean value OD of negative control
450nmbe less than 0.25, the mean value of positive control is greater than 1.0 tests can be effective.S=sample OD
450nmvalue, the OD of P=positive control
450nmmean value,
If S/P value is greater than 0.5, sample should be judged to be PRV gG antibody positive.If S/P value is less than or equal to 0.5, but is greater than 0.4, sample should be resurveyed.As test findings is constant, after answering separated in time, resampling detects.If S/P value is less than 0.5, sample should be judged to be PRV gG negative antibody.If invalidate the test, test operation may be wrong, and test should be reformed.
Beneficial effect of the present invention is:
The present invention's application prokaryotic system expresses PRV gG Protein reconstitution antigen, coated elisa plate prepares ELISA detection kit, the immunity of gG Gene deletion mutation and the antibody test of wild virus infection can be distinguished, can be gG deletion of vaccine strain and antidiastole technology is provided.The method has that susceptibility is high, the feature of high specificity, and method is simple to operate, detection time is short, can go out result of determination in 2 hours, eradicates pseudoabies provide powerful guarantee for purification.
Embodiment
Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.
The preparation of embodiment 1gG Protein reconstitution antigen
1) PRV (PRV) genome is extracted, according to the PRV Chinese epidemic strain gene order that GenBank delivers, the major antigenic sites zone design amplimer for gG protein coding gene:
Upstream primer: ATGAATTCAGAGAGGCCCCTCGGGA;
Downstream primer: TAAAGCTTGGCCGCGGGCGAGCCCAC.
2) with PRV genome for template, according to above-mentioned primer amplification gG protein gene fragment, by gG gene fragment clone in carrier T, and then gene is inserted cloning vector pET-32a, build recombinant expression carrier, called after pET32a-gG.
3) the pET32a-gG recombinant expression carrier of structure is transformed in Escherichia coli Rosetta (DE3), adds IPTG and carry out abduction delivering.
4), after expression product being passed through His-Tag affinity chromatography method purifying, the gG Protein reconstitution antigen of purifying is obtained.
Embodiment 2 is wrapped by the preparation of the ELISA Plate of gG Protein reconstitution antigen
1) the gG Protein reconstitution antigen after purifying embodiment 1 obtained, with 0.05MpH9.6 sodium carbonate buffer dilution recombinant antigen, dilution final concentration is 5.6ug/ml, and the recombinant antigen drawn after dilution adds in ELISA Plate hole, every hole 100ul, namely package amount is 0.56ug/ hole.
2) bag by condition: by ELISA Plate with shrouding film cover, be placed in 37 DEG C 30 minutes, then go to 4 DEG C of night incubation (being not less than 12h).
3) discard liquid in ELISA Plate hole, in plate hole, then add about 300ul/ hole cleansing solution (the 10 times of dilutions of 10 times of concentrate distilled water are working fluid), leave standstill 3 minutes, repeat 3-5 time.All should discard liquid in hole during each washing, after last washing discards cleansing solution, residual liquid be patted dry on thieving paper.
4) close: with the phosphate buffer sealase target of the 0.01MpH7.4 containing 2%BSA (mass concentration), 5% new cow's serum (volumetric concentration), every hole 100ul.
5) sealing condition: the above-mentioned ELISA Plate adding confining liquid is placed in 37 DEG C of 1h, after hatching, liquid in hole is discarded, thieving paper pats dry.
6) ELISA Plate hole is added the phosphate buffer incubated at room 3h of the 0.01MpH7.4 containing 5% sucrose (mass concentration), discard liquid in hole, after naturally drying, ELISA Plate vacuumizes sealing with the packaging bag adding drying agent and preserves.
The preparation of the ELISA detection kit of embodiment 3 PRV gG
1, material:
The bag prepared except embodiment 2 is by except the ELISA Plate of gG Protein reconstitution antigen, and kit also comprises sample diluting liquid, 10 times of concentrated cleaning solutions, negative control sera, positive control serum, substrate nitrite ion A, B, enzyme labelled antibody, stop buffer.
2, preparation method
1) sample diluting liquid preparation: take NaCl8.0g, KCl0.2g, Na
2hPO
412H
2o2.9g, BSA1.0g, ProClin3001.0ml adding distil water 900ml dissolves, and adding distil water is settled to 1000ml, is packed as 40ml/ bottle.
2) 10 times of concentrated cleaning solutions (0.1MpH7.4 phosphate buffer): take NaCl80g, KCl2.0g, Na
2hPO
412H
2o29g, ProClin3001ml adding distil water 900ml dissolves, then adds Tween-205ml, and adding distil water is settled to 1000ml, is packed as 60ml/ bottle.
3) negative control sera preparation: gather the health pig serum not infecting PRV, do 20 times of dilutions with above-mentioned sample diluting liquid, packing 1ml/ bottle.
4) positive control serum preparation: after gG Protein reconstitution antigen immune pig, gathers the Swine serum containing gG antibody, makes 20 times of dilution preparation pig positive control serums, packing 1ml/ bottle with above-mentioned sample diluting liquid.
5) substrate nitrite ion preparation:
Substrate colour developing A liquid: sodium acetate 13.6g, citric acid 1.6g, 30% hydrogen peroxide 0.3ml, distilled water adds to 500ml, is packed as 15ml/ bottle.
Substrate colour developing B liquid: disodium ethylene diamine tetraacetate 0.2g, citric acid 0.95g, glycerine 50ml, get 0.15gTMB and be dissolved in 3mlDMSO, distilled water adds to 500ml, is packed as 15ml/ bottle.
6) enzyme labelled antibody preparation: the anti-pig IgG of goat of commercialization horseradish peroxidase-labeled, does 1: 25000 times of dilution with sample diluting liquid, is packed as 25ml/ bottle.
7) stop buffer preparation:
In 891.3ml distilled water, dropwise add the concentrated sulphuric acid (98%) 108.7ml, obtain the H of 2mol/L
2sO
4aqueous solution, be packed as 15ml/ bottle after mixing, room temperature preservation.
8) kit assembling:
Each component is prepared according to above-mentioned preparation method, by each kit configuration packet by the ELISA Plate 2 pieces sealed, sample diluting liquid, 10 times of concentrated cleaning solutions, negative control sera, positive control serum, substrate display liquid A, each 1 bottle of substrate nitrite ion B, enzyme labelled antibody, stop buffer, and operational manual 1 part carries out mounted box.
The application of embodiment 4 PRV gG-ELISA detection kit
1) from kit, ELISA Plate is taken out, with sample diluting liquid by serum sample to be checked 40 times dilution (such as: the sample of 5ul adds 195ul Sample dilution).Draw 100ul mixed liquor in ELISA Plate with pipettor, positive control serum and each holes of negative control sera are set, every hole 100ul simultaneously.
2) under 37 DEG C of conditions, 60 minutes are hatched.
3) discard liquid in hole, in orifice plate, add about 300ul/ hole cleansing solution (it is 1 times of working fluid that 10 times of concentrate distilled water do 10 times of dilutions), leave standstill 3 minutes, repeat 3-5 time.All should discard liquid in hole during each washing, after last washing discards cleansing solution, residual liquid be patted dry on thieving paper.
4) every hole adds 100ul enzyme labelled antibody.
5) under 37 DEG C of conditions, 30 minutes are hatched.
6) step 3 is repeated.
7) every hole adds substrate nitrite ion A and each 50ul of substrate nitrite ion B, slightly shakes mixing, avoids overflow in hole.
8) under 37 DEG C of conditions, 15 minutes are hatched.
9) every hole adds 50ul stop buffer, makes reaction terminating.
10) measure and record the OD value (450nm) of test sample and contrast.
Kit criterion of the present invention: the mean value OD of negative control
450nmbe less than 0.25, the mean value of positive control is greater than 1.0 tests can be effective.S=sample OD
450nmvalue, the OD of P=positive control
450nmmean value,
If S/P value is greater than 0.5, sample should be judged to be PRV gG antibody positive.If S/P value is less than or equal to 0.5, but is greater than 0.4, sample should be resurveyed.As test findings is constant, answer from new sampling after separated in time, detect.If S/P value is less than 0.4, sample should be judged to be PRV gG negative antibody.
Embodiment 5 PRV gG-ELISA detection kit specific detection
Application porcine pseudorabies, pig japanese b encephalitis, swine fever, pig are breathed and breeding difficulty syndrome, pig parvoviral, the standard positive serum of Schweineseuche (O type) and porcine pseudorabies negative serum, detect with PRV gG-ELISA detection kit.Testing result is as following table, and result shows: porcine pseudorabies standard positive serum S/P value is that the 1.0> positive judges critical value 0.5, and all the other S/P values are all remarkable in negative critical value 0.4.Show that this kit detection specificity is good.
Table 1 PRV gG-ELISA detection kit serological specificity testing result
| Serum title | PRV | JEV | CSFV | PRRSV | PPV | FMD | PRV negative serum |
| S/P | 1.16 | 0.18 | 0.19 | 0.14 | 0.20 | 0.14 | 0.15 |
| OD 450nm | 1.45 | 0.22 | 0.24 | 0.18 | 0.25 | 0.17 | 0.19 |
Comparative example 1 different gG Protein reconstitution antigen ELISA Plate Detection results compares
One, gG2, gG3 Protein reconstitution antigen preparation
1) with embodiment 1 in like manner: extract PRV (PRV) genome, according to the PRV Chinese epidemic strain gene order that GenBank delivers, the major antigenic sites zone design two pairs of amplimers for gG protein coding gene:
GG2 upstream primer: ATGAATTCAAGTGGGCAACGTGGATCCT
GG2 downstream primer: TAAAGCTTGTCGTAGTAGTCGGCGTAGTCG
GG3 upstream primer: ATGAATTCGCCACCCTCCCGCCCATC
GG3 downstream primer: TAAAGCTTTCAGGCGGAGGCCACGT
2) with PRV genome for template, according to above-mentioned primer amplification gG protein gene fragment, by gG gene fragment clone in carrier T, and then gene is inserted cloning vector pET-32a, build recombinant expression carrier, respectively called after pET32a-gG2, pET32a-gG3.
3) pET32a-gG2 will built, pET32a-gG3 recombinant expression carrier is transformed in Escherichia coli Rosetta (DE3), adds IPTG and carries out abduction delivering.
4), after expression product being passed through His-Tag affinity chromatography method purifying, the gG2 of purifying is obtained, gG3 Protein reconstitution antigen.
Two, wrap by the preparation of the ELISA Plate of gG2, gG3 Protein reconstitution antigen (with embodiment 2 in like manner)
1) gG2 after purifying embodiment 1 obtained, gG3 Protein reconstitution antigen, with 0.05MpH9.6 sodium carbonate buffer dilution recombinant antigen, dilution final concentration is 5.6ug/ml, the recombinant antigen drawn after dilution adds in ELISA Plate hole, and every hole 100ul, namely package amount is 0.56ug/ hole.
2) bag by condition: by ELISA Plate with shrouding film cover, be placed in 37 DEG C 30 minutes, then go to 4 DEG C of night incubation (being not less than 12h).
3) discard liquid in ELISA Plate hole, in plate hole, then add about 300ul/ hole cleansing solution (the 10 times of dilutions of 10 times of concentrate distilled water are working fluid), leave standstill 3 minutes, repeat 3-5 time.All should discard liquid in hole during each washing, after last washing discards cleansing solution, residual liquid be patted dry on thieving paper.
4) close: with the phosphate buffer sealase target of the 0.01MpH7.4 containing 2%BSA (mass concentration), 5% new cow's serum (volumetric concentration), every hole 100ul.
5) sealing condition: the above-mentioned ELISA Plate adding confining liquid is placed in 37 DEG C of 1h, after hatching, liquid in hole is discarded, thieving paper pats dry.
6) ELISA Plate hole is added the phosphate buffer incubated at room 3h of the 0.01MpH7.4 containing 5% sucrose (mass concentration), discard liquid in hole, after naturally drying, ELISA Plate vacuumizes sealing with the packaging bag adding drying agent and saves backup.
Three, three kinds of antigen coated ELISA Plate of gG Protein reconstitution compare for clinical sample susceptibility and specific detection
Application is diagnosed as PRV Positive Sera 56 parts and porcine pseudorabies negative serum 38 parts, all detects with PRV gG-ELISA detection kit, compares three kinds of not synantigen Detection results.Testing result is as following table 2-4, and result shows: gG recombinant protein ELISA Plate detection sensitivity of the present invention and specificity are all better than gG2, gG3 recombinant protein antigen ELISA Plate.
Table 2
Table 3
Table 4
Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, all belong to the scope of protection of present invention.
Claims (10)
1. an ELISA detection kit of PRV gG, is characterized in that, described kit comprises the ELISA Plate being coated with PRV gG Protein reconstitution antigen;
The preparation method of described gG Protein reconstitution antigen is as follows: with gG protein coding gene for template, utilizes primer pair amplifies to obtain gG protein gene fragment, builds recombinant expression carrier, expresses gG Protein reconstitution antigen by prokaryotic system;
Described primer pair comprises:
Upstream primer: ATGAATTCAGAGAGGCCCCTCGGGA;
Downstream primer: TAAAGCTTGGCCGCGGGCGAGCCCAC.
2. kit according to claim 1, is characterized in that, is transformed into by described recombinant expression carrier in Escherichia coli Rosetta (DE3), adds IPTG and carries out abduction delivering; By expression product by after His-Tag affinity chromatography method purifying, obtain the gG Protein reconstitution antigen of purifying.
3. kit according to claim 2, is characterized in that, the package amount of described gG Protein reconstitution antigen is 0.1-1ug/ hole.
4. kit according to claim 3, is characterized in that, described in be coated with the ELISA Plate of PRV gG Protein reconstitution antigen preparation method comprise the steps:
1) by the sodium carbonate buffer of gG Protein reconstitution antigen 0.05MpH9.6 dilution gG Protein reconstitution antigen, add in ELISA Plate hole, package amount is 0.1-1ug/ hole;
2) ELISA Plate shrouding film is covered, at being placed in 37 DEG C 30 minutes, then go to 4 DEG C and hatch and be not less than 12h;
3) discard liquid in ELISA Plate hole, in plate hole, add hand-hole cleansing solution, leave standstill 3 minutes, repeat 3 ~ 5 times; Discard liquid in hole during each washing, after last washing discards cleansing solution, residual liquid is patted dry on thieving paper;
4) with the phosphate buffer sealase target of the 0.01MpH7.4 containing the new cow's serum of 0.5-4%BSA, 2%-8%;
5) 1h at ELISA Plate being placed in 37 DEG C, discards liquid in hole after hatching, thieving paper pats dry;
6) add the phosphate buffer incubated at room 3-5h of the 0.01MpH7.4 containing 5%-20% sucrose to ELISA Plate plate hole, discard liquid in hole, after naturally drying, vacuumize sealing with the packaging bag adding drying agent and preserve.
5. the kit according to any one of claim 1-4, is characterized in that, described kit comprises enzyme labelled antibody, and described enzyme labelled antibody is the anti-pig IgG of goat of horseradish peroxidase-labeled.
6. kit according to claim 5, is characterized in that, described kit also comprises: sample diluting liquid, cleansing solution, negative control sera, positive control serum, substrate nitrite ion A, B and stop buffer.
7. kit according to claim 6, is characterized in that, described positive control serum is after gG Protein reconstitution antigen immune pig, gathers the Swine serum containing gG antibody.
8. the kit according to claim 5 or 6, is characterized in that, contains ProClin300 as antiseptic in described sample diluting liquid and cleansing solution.
9. the kit described in any one of claim 1-8 is detecting the application in Swine serum in gG antibody.
10. application according to claim 9, is characterized in that, described application is specially:
1) with sample diluting liquid by serum sample to be checked 40 times dilution, draw 100ul mixed liquor in ELISA Plate with pipettor, positive control serum and each holes of negative control sera be set, every hole 100ul simultaneously;
2) under 37 DEG C of conditions, 60 minutes are hatched;
3) discard liquid in hole, in orifice plate, add about 300ul/ hole cleansing solution, leave standstill 3 minutes, repeat 3 ~ 5 times, during each washing, discard liquid in hole, after last washing discards cleansing solution, residual liquid is patted dry on thieving paper;
4) every hole adds 100ul enzyme labelled antibody;
5) under 37 DEG C of conditions, 30 minutes are hatched;
6) step 3 is repeated);
7) every hole adds substrate nitrite ion A and each 50ul of substrate nitrite ion B, slightly shakes mixing, avoids overflow in hole;
8) under 37 DEG C of conditions, 15 minutes are hatched;
9) every hole adds 50ul stop buffer, makes reaction terminating;
10) measure and record the OD value of test sample and contrast.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510369986.4A CN105044350B (en) | 2015-06-29 | 2015-06-29 | PRV gG ELISA detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510369986.4A CN105044350B (en) | 2015-06-29 | 2015-06-29 | PRV gG ELISA detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105044350A true CN105044350A (en) | 2015-11-11 |
| CN105044350B CN105044350B (en) | 2017-08-08 |
Family
ID=54451053
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510369986.4A Active CN105044350B (en) | 2015-06-29 | 2015-06-29 | PRV gG ELISA detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105044350B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105505881A (en) * | 2016-01-05 | 2016-04-20 | 吉林大学 | Suppressor cell system of porcine pseudorabies virus |
| CN106771179A (en) * | 2016-11-22 | 2017-05-31 | 无锡艾科瑞思产品设计与研究有限公司 | A kind of detection method of PRV |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101413948A (en) * | 2008-11-13 | 2009-04-22 | 浙江大学 | Rabies virus NP-ELISA antibody detection reagent kit |
| CN102353783A (en) * | 2011-06-29 | 2012-02-15 | 武汉科前动物生物制品有限责任公司 | Kit for detecting pig pseudorabies virus antibodies and block enzyme-linked immuno sorbent assay (ELISA) method |
| CN104181297A (en) * | 2014-08-25 | 2014-12-03 | 山东省滨州畜牧兽医研究院 | Enzyme-linked immuno sorbent assay (ELISA) kit for detecting sheep pseudo rabies virus (PRV) antibody |
-
2015
- 2015-06-29 CN CN201510369986.4A patent/CN105044350B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101413948A (en) * | 2008-11-13 | 2009-04-22 | 浙江大学 | Rabies virus NP-ELISA antibody detection reagent kit |
| CN102353783A (en) * | 2011-06-29 | 2012-02-15 | 武汉科前动物生物制品有限责任公司 | Kit for detecting pig pseudorabies virus antibodies and block enzyme-linked immuno sorbent assay (ELISA) method |
| CN104181297A (en) * | 2014-08-25 | 2014-12-03 | 山东省滨州畜牧兽医研究院 | Enzyme-linked immuno sorbent assay (ELISA) kit for detecting sheep pseudo rabies virus (PRV) antibody |
Non-Patent Citations (2)
| Title |
|---|
| 唐勇等: "伪狂犬病gG-ELISA鉴别诊断方法的建立及其应用", 《畜牧兽医学报》 * |
| 唐勇等: "伪狂犬病毒gG基因的表达及gG-LAT诊断方法的建立", 《畜牧兽医学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105505881A (en) * | 2016-01-05 | 2016-04-20 | 吉林大学 | Suppressor cell system of porcine pseudorabies virus |
| CN105505881B (en) * | 2016-01-05 | 2019-02-19 | 吉林大学 | A kind of inhibition cell line of porcine pseudorabies virus |
| CN106771179A (en) * | 2016-11-22 | 2017-05-31 | 无锡艾科瑞思产品设计与研究有限公司 | A kind of detection method of PRV |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105044350B (en) | 2017-08-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Klaumann et al. | Current knowledge on porcine circovirus 3 (PCV-3): a novel virus with a yet unknown impact on the swine industry | |
| Niskanen et al. | Determination of level of antibodies to bovine virus diarrhoea virus (BVDV) in bulk tank milk as a tool in the diagnosis and prophylaxis of BVDV infections in dairy herds | |
| Hasoksuz et al. | Biologic, antigenic, and full-length genomic characterization of a bovine-like coronavirus isolated from a giraffe | |
| Alenius et al. | Bovine coronavirus as the causative agent of winter dysentery: serological evidence | |
| CN105527442B (en) | A kind of hog cholera antibody detecting system and preparation method thereof | |
| Bauermann et al. | Generation of calves persistently infected with HoBi-like pestivirus and comparison of methods for detection of these persistent infections | |
| Kirkland et al. | Pestiviruses | |
| CN113009154A (en) | One-step method novel magnetic microsphere detection kit for coronavirus neutralizing antibody and application thereof | |
| CN103308684A (en) | ELISA (enzyme-linked immuno sorbent assay) detection kit of porcine pseudorabies virus IgM antibody | |
| Garcia‐Ispierto et al. | Does C oxiella burnetii Affect Reproduction in Cattle? A Clinical Update | |
| CN106706923A (en) | Method for detecting specific IgA antibody of O-type foot-and-mouth disease virus of pig and detection kit thereof | |
| CN106706903A (en) | Detection method and detection kit for porcine type A foot-and-mouth disease virus specific IgA antibody | |
| Kameyama et al. | Development of an immunochromatographic test kit for rapid detection of bovine viral diarrhea virus antigen | |
| Fulton et al. | Multiple diagnostic tests to identify cattle with Bovine viral diarrhea virus and duration of positive test results in persistently infected cattle | |
| CN103308688A (en) | ELISA (Enzyme-Linked Immunosorbent Assay) detection kit for porcine circovirus type 2 IgM antibody and preparation method of ELISA detection kit | |
| Kawanishi et al. | First isolation of border disease virus in Japan is from a pig farm with no ruminants | |
| CN103698514B (en) | Detect the ELISA kit of pig Lawsonia intracellularis antibody | |
| CN105044350A (en) | ELISA detection kit for porcine pseudorabies virus gG | |
| CN1588076A (en) | Indirect ELISA diagnostic reagent kit for pig B type circular virus antibody | |
| Pignatelli et al. | Molecular characterization of a new PToV strain. Evolutionary implications | |
| CN101303349B (en) | Cysticercosis cellulosae indirect ELISA testing kit and preparation method thereof | |
| Sarma et al. | Classical swine fever in pigs and its status in India: A review | |
| Yilmaz | Prevalence of antibodies to Bovine Viral Diarrhea Virus (BVDV) in blood and milk serum in dairy cattle in Kars district of Turkey | |
| Qing et al. | The recombinant nonstructural polyprotein NS1 of porcine parvovirus (PPV) as diagnostic antigen in ELISA to differentiate infected from vaccinated pigs | |
| CN104678104A (en) | ELISA immunoassay kit for detecting American-type PRRS antibodies |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |