CN105040110A - Gene chip for detecting transmissible gastroenteritis virus and detection method of gene chip - Google Patents

Abstract

The invention discloses a gene chip for detecting a transmissible gastroenteritis virus and a detection method of the gene chip, and provides a probe and a PCR primer. The PCR primer is designed by analyzing the genomic sequence of a standard virus strain, cloning and sequencing analysis are conducted on a target gene, the specific probe is then designed, and the transmissible gastroenteritis virus can be authenticated. The invention aims at establishing a chip method for detecting the transmissible gastroenteritis virus, and the chip method is high in sensitivity and specificity, saves time and labor and is beneficial to result observation.

Description

For detecting gene chip and the detection method thereof of transmissible gastro-enteritis virus

Technical field

The invention belongs to biochip field.Specifically, the present invention relates to the chip-detecting apparatus of a kind of transmissible gastro-enteritis virus.

Background technology

Transmissible gastroenteritis of swine (porcinetransmissiblegastroenteritis, TGE) be by transmissible gastro-enteritis virus (porcinetransmissiblegastroenteritisvirus, what TGEV) cause vomits with pig, suffers from diarrhoea, dewaters as the high degree in contact sexually transmitted disease of feature, causes huge loss to pig industry.This disease can infect the pig of different ages, but to the lethality rate of newborn piglet up to 100%, and it is gentle that Adult Pig infects sequela, may occur the phenomenon such as retardation of growth and agalasisa.In recent years, this disease occurs again and again all over the world, and multiple areas such as China Sichuan, Hubei, Jilin, Shaanxi, Taiwan, Beijing, Guangzhou also all have popular, and in rising trend.Because TGEV is frequent and other virus mixed infections, or the secondary infection of normal companion bacterium, make clinical symptom complexity various, polyinfection and secondary infection considerably increase the difficulty of TGEV diagnosis.

Transmissible gastro-enteritis virus (porcinetransmissiblegastroenteritisvirus, TGEV) belongs to the single strand plus RNA virus of non-segmented negative of shell type virales, coronaviridae, coronavirus genus.TGEV genome is made up of 7 open reading frame (ORF1-ORF7), and 5 ' end has methylated cap sequence, and 3 ' end has PloyA tail, makes viral RNA have infectivity.TGEV can not only cause acute enteritis, and is often persistent infection, namely after infection 100d, the existence of virus still can be detected, had a strong impact on the sustainable and healthy development of pig industry in the respiratory tract of rehabilitation pig.Pig is to TGEV susceptible the most, and animal cat, dog, fox etc. beyond pig is not pathogenic, but can be with poison, toxin expelling.A large amount of band poison animals facilitates the outburst of transmissible gastroenteritis of swine.Therefore, set up a kind of method that is quick, accurately this virus of detection, be conducive to the development ensureing China's pig industry.Also play an important role in the entry and exit rapid detection to other animal or meat product.

Gene chip (Genechip) is the probe array formed at the solid support through covalent attachment aldehyde radical, amino or poly-lysine by DNA or oligonucleotide probe dense arrangement, under suitable temperature, humidity condition, specific probe is utilized to be hybridized by base pair complementarity with the measuring samples DNA marked through appropriate ways, then by corresponding test set, detect position and the power of hybridization signal, judgement sample kind, completes the work of the aspect such as disease detection and fundamental research.The method has the advantage of high-throughput, parallelization, milligram ammonia, automatization, low cost.Therefore, this technology is widely used in the numerous areas such as diagnostic detection, Differential expression analysis, order-checking.At present, gene chip detecting technique has been applied to the detection of various diseases, but lacks the detection method of transmissible gastro-enteritis virus gene chip.The advantage of comprehensive oligonucleotide microarray, the present invention set up a kind of fast, the gene chip detecting technique of precise Identification transmissible gastro-enteritis virus, for controlling the propagation of transmissible gastro-enteritis virus and the quarantine of animal of passing in and out has vital role.

Summary of the invention

Laborsaving and be easy to the gene chip of the detection transmissible gastro-enteritis virus of observations when the object of the invention is to set up a kind of highly sensitive, high specificity, joint.

The present invention adopts following technical scheme to achieve these goals: for detecting the gene chip of transmissible gastro-enteritis virus, comprising: PCR reaction mixture, Taq polysaccharase, PCR positive control, PCR negative control, ddH ₂the point sample distribution of O, detection chip, chip probe, chip cover plate, hybridization solution, hybridization positive control, hybridizing box, adopt gene chip micro-sampling technology, testing sample probe and each special quality control probe are fixed on the substrate of chemically modified, the microarray formed, it is characterized in that: described microarray comprises Quality Control probe region and testing sample probe region, in wherein said Quality Control probe region, following subregion be set:

Point sample position Quality Control subregion (P1), comprises at least one point sample position Quality Control probe: SEQIDNO.2;

Hybridization positive quality control subregion (P2), comprises at least one hybridization positive quality control probe: SEQIDNO.3;

Hybridize negative Quality Control subregion (N), comprise spotting buffer;

Arrange at least one transmissible gastro-enteritis virus probe subregion in described testing sample probe region, wherein transmissible gastro-enteritis virus DNA probe sequence is SEQIDNO.1.

Utilize the detection method of said gene chip detection transmissible gastro-enteritis virus, comprise the steps:

(1) testing sample preparation: extract according to commercialization RNA the full-length genome RNA that test kit working instructions extract the tissue of infected animal or the cell proliferation liquid of virus, carry out reverse transcription, prepare testing sample cDNA;

(2) pcr amplification: 25 μ LPCR reaction solutions comprise rTaq enzyme 12.5 μ L, primer Mix:2.4 μ L, testing sample DNA5 μ L, nuclease free aqua sterilisa 5.1 μ L;

Wherein, institute primer Mix contains:

Sequence is 10 μm of ol/L transmissible gastro-enteritis virus upstream primer 0.2 μ L of SEQIDNO.4,

Sequence is 10 μm of ol/L transmissible gastro-enteritis virus downstream primer 0.2 μ L of SEQIDNO.5,

Sequence is 20 μm of ol/L universal primer upstream primer 1 μ L of SEQIDNO.6,

Sequence is 20 μm of ol/L universal primer downstream primer 1 μ L. of SEQIDNO.7

Increase as follows: 94 DEG C of 5min; 94 DEG C of 30sec, 56 DEG C of 30sec, 72 DEG C of 25sec circulate 12 times; 94 DEG C of 30sec, 50 DEG C of 30sec, 72 DEG C of 25sec circulate 30 times; 72 DEG C of 5min;

(3) hybridize: first preparing hybrid damping fluid: hybridization buffer 7.9 μ L, pcr amplification product 8 μ L, hybridization positive control 0.1 μ L, mix rear 95 DEG C of sex change 8min, place 5min on ice, then get 15 μ L hybridization solutions and hybridize;

(4) result interpretation: use micro-array chip scanner scanning analysis, removes negative control background, illustrates and contrast, result of determination with chip hybridization.

Tool of the present invention has the following advantages:

(1) successfully construct TGEV and detect gene chip: each bar screening probe that the gene chip prepared by the present invention adopts can carry out specific binding with corresponding pathogenic agent goal gene, and hybridization signal is comparatively strong and stable.

(2) the detection gene chip prepared has good Methodological characteristics.The present invention establishes that a species specificity is good, highly sensitive, stability is strong and joint time labour-saving gene chip detection method.

(3) structure of gene chip is detected, for the synchronous detection of polyinfection disease and differential diagnosis provide means fast and efficiently, for Animal Quarantine of entering and leaving the border from now on, entry and exit food safety and corresponding Blight control provide technical guarantee.To meeting Animal Quarantine requirements of one's work of passing in and out, control the propagation of transmissible gastro-enteritis virus, livestock industry safety, the sound development tool of guarantee China are of great significance.

Accompanying drawing explanation

Fig. 1 is chip probe distribution schematic diagram;

Fig. 2 is transmissible gastro-enteritis virus nucleic acid hybridization result;

In figure: P1-point sample position Quality Control subregion; P2-hybridizes positive quality control subregion; N-hybridizes negative Quality Control subregion; 1-Actinobacillus pleuropneumoniae probe subregion; 2-haemophilus parasuis probe subregion; 3-mycoplasma hyopneumoniae probe subregion; 4-porcine circovirus 2 type probe subregion; 5-porcine reproductive and respiratory syndrome virus probe subregion; 6-Pestivirus suis probe subregion; 7-transmissible gastro-enteritis virus probe subregion;

Hybridization illustrates: P1: positive control fixed by probe, and monitoring chip deposition process, all answers the positive before and after chip hybridization;

P2: hybridization positive control, monitoring chip crossover process, detects any sample and all answers the positive;

N: hybridization negative control, detects any sample and answers feminine gender;

Transmissible gastro-enteritis virus cDNA is through the results of hybridization of pcr amplification product: except Quality Control probe meets the requirements, and No. 7 probes are bright.

Embodiment

There is provided specific embodiment to set forth technical scheme of the present invention further below, but the application of the technology of the present invention is not limited to embodiment.

Embodiment 1, the present invention is respectively to transmissible gastro-enteritis virus cell proliferation, extracts virus genome RNA, and carries out reverse transcription.The special conserved sequence of transmissible gastro-enteritis virus is cloned, sequencing analysis, 1 oligonucleotide probe is devised according to sequencing result, specific binding can be carried out with the PCR primer of corresponding pathogenic agent, when PCR carries out genome amplification, upstream universal primer 5 ' end utilizes Cy3 fluorochrome to mark, and probe can be hybridized by product therewith at 42 DEG C.Judge results of hybridization according to fluorescent signal position, intensity, detect transmissible gastro-enteritis virus with this.PrimerPremier5.0 biosoftware is utilized to design PCR primer SEQIDNO.4 and SEQIDNO.5 according to the complete genome sequence of the transmissible gastro-enteritis virus that Genbank website is announced.Meanwhile, cloned gene sequence, and carry out checking order, compare of analysis, utilize fastPCR biosoftware to design 1 specific oligonucleotide probe SEQIDNO.1.By these 4 PCR primer and 1 specific probe, can be special, responsive rapid detection strain Transmissible gastroenteritis virus.According to Quality Control sequent synthesis the present invention Quality Control sequence SEQIDNO.2, SEQIDNO.3 that State Administration for Quality Supervision and Inspection and Quarantine's file (No. 2009.178) " notice---the A type influenza typing gene chip detection method of pig Influenza A H1N1 inspection and quarantine work of passing in and out about further reinforcement " provides.

5 ' end of every bar probe is all connected with an amino by 15 thymidylic acids, and concrete nucleotide sequence is as follows:

SEQIDNO.1 is:

5'-NH ₂-T ₁₅-GCACCATCCTTGGCAACCCAGACAACTCCATCTAATT；

SEQIDNO.2 is:

5'-NH ₂-T ₁₅-GCTGCCTCGGCAAGGAGT-TAMRA；

SEQIDNO.3 is:

5'-NH ₂-T ₁₅-GTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATT。

Embodiment 2, see Fig. 1, for the gene chip that transmissible gastro-enteritis virus detects, adopts gene chip micro-sampling technology, is fixed on the substrate of chemically modified by testing sample probe and each special quality control probe, form the microarray that 8 row × 7 arrange.On microarray, probe distribution is followed successively by from top to bottom: point sample position Quality Control subregion P1:1 is capable × and 8 points, hybridization positive quality control subregion P2:1 is capable × 4 points, hybridize negative Quality Control subregion N:1 capable × 4 points, Actinobacillus pleuropneumoniae detection probes subregion 1:1 is capable × 4 points, haemophilus parasuis detection probes subregion 2:1 is capable × 4 points, mycoplasma hyopneumoniae detection probes subregion 3:1 is capable × 4 points, porcine circovirus 2 type detection probes distinguish 4:1 capable × 4 points, porcine reproductive and respiratory syndrome virus detection probes subregion 5:1 is capable × 4 points, Pestivirus suis detection probes subregion 6:1 is capable × 4 points, transmissible gastro-enteritis virus probe subregion 7:1 is capable × 4 points, hybridize negative Quality Control subregion N:1 capable × 4 points, point sample position Quality Control subregion P1:1 is capable × 8 points.Often open on chip and have at least one above-mentioned microarray, each microarray can detect a sample.

Hybridize negative Quality Control subregion N, comprise spotting buffer, spotting buffer is commercially available prod, and such as Bo Aosheng company limited produces.All the other each subregions comprise corresponding detection probes and Quality Control probe.

Fig. 2 is the specific embodiment of the present invention, for transmissible gastro-enteritis virus cDNA is through the results of hybridization of pcr amplification product.

Embodiment 3, reagent prepare

1) chip washing lotion

As required and practical situation, by following proportions washings I and washings II.

Washing lotion I: SSC final concentration is 2 ×, SDS final concentration is 0.2%.As 600mL washing lotion I=528mL distilled water+60mL20 × SSC+12mL10%SDS, or prepare in proportion as required.

Washing lotion II: SSC final concentration is 0.2 ×.As 600mL washing lotion II=594mL distilled water+6mL20 × SSC, or prepare in proportion as required.

If 10%SDS produces white flock precipitate, please be placed in after mixing is dissolved in 42 DEG C of water-baths and prepare washing lotion.

2) dehydrated alcohol.

3) mixture of ice and water.

Embodiment 4, virus genomic extraction

Extract according to corresponding commodity RNA the full-length genome that test kit working instructions extract the tissue of infected animal or the cell proliferation liquid of virus, carry out reverse transcription, prepare sample cDNA.

Embodiment 5, pcr amplification full-length cDNA

1, PCR reaction system: in PCR dosing district, at thawed on ice primer Mix and cDNA, by following system preparation reaction solution.25 μ LPCR reaction solutions comprise rTaq enzyme 12.5 μ L, primer Mix:2.4 μ L, testing sample DNA5 μ L, nuclease free aqua sterilisa 5.1 μ L;

Wherein, described primer Mix contains:

Sequence is 10 μm of ol/L transmissible gastro-enteritis virus upstream primer 0.2 μ L of SEQIDNO.4,

Sequence is 10 μm of ol/L transmissible gastro-enteritis virus downstream primer 0.2 μ L of SEQIDNO.5,

Sequence is 20 μm of ol/L universal primer upstream primer 1 μ L of SEQIDNO.6,

Sequence is 20 μm of ol/L universal primer downstream primer 1 μ L. of SEQIDNO.7

Transmissible gastro-enteritis virus upstream primer SEQIDNO.4:

5′-AGGTGACACTATAGAATAAGGTGGTTCTTCTACTACTTAGG-3′；

Transmissible gastro-enteritis virus downstream primer SEQIDNO.5:

5′-GTACGACTCACTATAGGGAACTGTCATCCTTCTTGTTATTGG-3′；

General upstream primer SEQIDNO.6:5 '-cy3-AGGTGACACTATAGAATA-3 ';

General downstream primer SEQIDNO.7:5 '-GTACGACTCACTATAGGGA-3 '.

2, increase: the reaction solution configured is placed in PCR amplification instrument, carries out PCR reaction according to the PCR reaction cycle program of table 1.

Table 1PCR response procedures

PCR primer wants lucifuge to place.Short-term preservation places 4 DEG C of refrigerators.

Embodiment 6, interpretation

1, develop a film: hybridization buffer, 42 DEG C of thawings, presses system preparing hybrid liquid below, hybridization system mixed solution 95 DEG C of sex change 8 minutes, ice bath 5 minutes, for subsequent use.Prepare 16 μ L hybridization solutions: hybridization buffer 7.9 μ L, pcr amplification product 8 μ L, hybridization positive control 0.1 μ L.

Open chip hybridization box, hybridizing box is kept flat on the table, in hybridizing box bottom groove, add about 200 μ L aqua sterilisas.By chip front side upward (fence faces up, and label is towards operator) put between hybridizing box two steady braces; Put chip cover plate, note having one of boss facing to chip, the first contact chip in upper end, then under slowly covering; Then slowly inject the hybridization solution after 15 μ L sex change with pipettor by cover plate well, hybridization solution can form liquid film together by means of between the boss of surface tension of liquid below cover plate and chip surface.Notice that vibrations cover plate or chip be not to avoid destroying liquid film.Cover tightly hybridization lid.Put into 42 DEG C of waters bath with thermostatic control, leave standstill, hybridization 2-3 hour.

After hybridization, taking out chip is placed in 42 DEG C of preheated washing lotions I, 42 DEG C shake cleaning 5 minutes, use 42 DEG C of preheated washing lotion II, 42 DEG C concussion cleanings 5 minutes (winter washing lotion II capable of washing twice, each two minutes) again, finally use 42 DEG C of preheated clean water once, within centrifugal 2 minutes, to remove the liquid of chip surface, this chip can keep in Dark Place chip 2000rpm after cleaning, all effective interscan in 4 hours.

2, scanner uni result interpretation

The chip cleaned uses micro-array chip scanner to carry out scanning analysis under brilliant core LuxScanTM10K-A micro-array chip scanner, removes negative control background, illustrates and contrast, result of determination with chip hybridization.

Embodiment 7, gurry process

Process according to local or national infectivity and potential infectious trash processing specification and to use or without the waste of used reagent and pollution.

SEQUENCELISTING

Entry-Exit Inspection and Quarantine Bureau's inspection and quarantine technique center, <110> Chongqing

<120> is for detecting gene chip and the detection method thereof of transmissible gastro-enteritis virus

<160>7

<210>1

<211>37

<212>DNA

<213> artificial sequence

<400>SEQIDNO.1

NH2-t15-gcaccatccttggcaacccagacaactccatctaatt37

<210>2

<211>18

<212>DNA

<213> artificial sequence

<400>SEQIDNO.2

NH2-t15-gctgcctcggcaaggagt-TAMRA18

<210>3

<211>38

<212>DNA

<213> artificial sequence

<400>SEQIDNO.3

NH2-t15-gtcggggctggcttaactatgcggcatcagagcagatt38

<210>4

<211>41

<212>DNA

<213> artificial sequence

<400>SEQIDNO.4

aggtgacactatagaataaggtggttcttctactacttagg41

<210>5

<211>42

<212>DNA

<213> artificial sequence

<400>SEQIDNO.5

gtacgactcactatagggaactgtcatccttcttgttattgg42

<210>6

<211>18

<212>DNA

<213> artificial sequence

<400>SEQIDNO.26

cy3-aggtgacactatagaata18

<210>7

<211>19

<212>DNA

<213> artificial sequence

<400>SEQIDNO.7

gtacgactcactataggga19

Claims (5)

1. for detecting the gene chip of transmissible gastro-enteritis virus, comprising: PCR reaction mixture, Taq polysaccharase, PCR positive control, PCR negative control, ddH ₂the point sample distribution of O, detection chip, chip probe, chip cover plate, hybridization solution, hybridization positive control, hybridizing box, adopt gene chip micro-sampling technology, testing sample probe and each special quality control probe are fixed on the substrate of chemically modified, the microarray formed, it is characterized in that: described microarray comprises Quality Control probe region and testing sample probe region, in wherein said Quality Control probe region, following subregion be set:

Point sample position Quality Control subregion (P1), comprises at least one point sample position Quality Control probe: SEQIDNO.2;

Hybridization positive quality control subregion (P2), comprises at least one hybridization positive quality control probe: SEQIDNO.3;

Hybridize negative Quality Control subregion (N), comprise spotting buffer;

Arrange at least one transmissible gastro-enteritis virus probe subregion in described testing sample probe region, wherein transmissible gastro-enteritis virus DNA probe sequence is SEQIDNO.1.

2. according to claim 1 for detecting the gene chip of transmissible gastro-enteritis virus, it is characterized in that: often open in described detection chip and comprise at least one microarray according to claim 1, each microarray can detect a sample.

3. according to claim 1 for detecting the gene chip of transmissible gastro-enteritis virus, it is characterized in that: 5 ' end of described every bar Quality Control probe and transmissible gastro-enteritis virus probe is all connected with an amino by 15 thymidylic acids.

4. utilize the detection method of the non-diseases testing goal of genechip detection transmissible gastro-enteritis virus described in claim 1, comprise the steps:

(1) testing sample preparation: extract test kit working instructions according to commercialization RNA and extract testing sample full-length genome RNA, carry out reverse transcription, prepare testing sample cDNA;

(2) pcr amplification: 25 μ LPCR reaction solutions comprise: rTaq enzyme 12.5 μ L, primer Mix:2.4 μ L, testing sample cDNA5 μ L, nuclease free aqua sterilisa 5.1 μ L;

Wherein, described primer Mix contains:

Sequence is 10 μm of ol/L transmissible gastro-enteritis virus upstream primer 0.2 μ L of SEQIDNO.4,

Sequence is 10 μm of ol/L transmissible gastro-enteritis virus downstream primer 0.2 μ L of SEQIDNO.5,

Sequence is 20 μm of ol/L universal primer upstream primer 1 μ L of SEQIDNO.6,

Sequence is 20 μm of ol/L universal primer downstream primer 1 μ L. of SEQIDNO.7

Increase as follows: 94 DEG C of 5min; 94 DEG C of 30sec, 56 DEG C of 30sec, 72 DEG C of 25sec circulate 12 times; 94 DEG C of 30sec, 50 DEG C of 30sec, 72 DEG C of 25sec circulate 30 times; 72 DEG C of 5min;

(3) hybridize: first preparing hybrid damping fluid: hybridization buffer 7.9 μ L, pcr amplification product 8 μ L, hybridization positive control 0.1 μ L, mix rear 95 DEG C of sex change 8min, place 5min on ice, then adopt 15 μ L hybridization solutions to hybridize;

(4) result interpretation: use micro-array chip scanner scanning analysis, removes negative control background, illustrates and contrast, result of determination with chip hybridization.

5. detection method according to claim 4, is characterized in that: the every 1000 μ L of described hybridization buffer comprise 20 × SSC500 μ L, 10%SDS10 μ L and DEPCH ₂o490 μ L.