CN105039566A - Nano PCR (polymerase chain reaction) campylobacter jejuni detection kit and detection method - Google Patents
Nano PCR (polymerase chain reaction) campylobacter jejuni detection kit and detection method Download PDFInfo
- Publication number
- CN105039566A CN105039566A CN201510515059.9A CN201510515059A CN105039566A CN 105039566 A CN105039566 A CN 105039566A CN 201510515059 A CN201510515059 A CN 201510515059A CN 105039566 A CN105039566 A CN 105039566A
- Authority
- CN
- China
- Prior art keywords
- campylobacter jejuni
- pcr
- detection
- nano
- test kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a nano PCR (polymerase chain reaction) campylobacter jejuni detection kit and detection method. The kit comprises 2*NanoPCR Mix, a forward primer and a reverse primer, wherein the sequence of the forward primer is shown in SEQ ID No.1; the sequence of the reverse primer is shown in SEQ ID No.2. The kit can be used for detecting campylobacter jejuni. The invention also provides a method for detecting campylobacter jejuni by adopting the kit. Campylobacter jejuni can be rapidly and specifically detected, thus greatly increasing the detection efficiency and specific amplification yield of campylobacter jejuni.
Description
Technical field
The present invention relates to the detection technique field of campylobacter jejuni.
Background technology
Campylobacter jejuni (Campylobacterjejuni) belongs to micro-aerobic Gram-negative spirobacteria, is a kind of important Zoonosis encephalapthy agent.Various animal (particularly ox, sheep, chicken) can infect, and except can causing diarrhoea, also can cause the disease such as infectious hepatitis of ox, the miscarriage of sheep and dog, infertile, mastitis and bird.The mankind infect mainly through drinking the animal food such as contaminated water source and edible meat, egg, milk, and people can be caused to suffer from diarrhoea and poison by food, and this disease is classified as one of common Food poisoning by the World Health Organization.
Set up the key that quick, the special detection method of campylobacter jejuni is effective this disease of Control and prevention.The detection method of campylobacter jejuni mainly comprises traditional pathogen separation, biochemical test, and polymerase chain reaction (PCR) etc., these methods have played vital role in Pathogen test.But campylobacter jejuni culture condition is harsh, easily enter " live non-cultivate " state, make conventional separation and Culture and biochemical identification time and effort consuming, quick diagnosis when being unfavorable for Epidemic outbreak of disease.PCR detection method is due to simple to operate, the advantages such as susceptibility is high, reproducible are widely used, but in actual applications, there is many limitation in round pcr, the problem such as such as nonspecific products amplification be there will be to the amplification of complex system and amplification efficiency is high not.For overcoming the above problems, finding the additive that can improve PCR specificity and efficiency and seeming of crucial importance.
Nano PCR technology is a kind of novel round pcr, and its principle is that the solid phase nano-metal particle being 1nm ~ 100nm particle diameter floats on a liquid formation nano-fluid.Because nano material has good heat conductivity, therefore in the PCR circulating system that with the addition of nm gold particles, PCR reaction can reach target temperature quickly, decrease the residence time in non-targeted temperature, and then shorten whole system and reach the temperature equilibrium time used, reduce the amplification of non-characteristic, improve specific amplification output.Therefore, the nano PCR detection means setting up a kind of detection campylobacter jejuni that can be quick, special is needed at present badly.
Summary of the invention
The present invention is directed to above-mentioned the deficiencies in the prior art, provide a kind of nano PCR test kit for campylobacter jejuni detection and application thereof, the detection campylobacter jejuni that this test kit can be quick, special.
The technical solution used in the present invention is: a kind of nano PCR test kit detected for campylobacter jejuni, comprises 2 × NanoPCRMix, upstream primer and downstream primer; The sequence of described upstream primer is for shown in SEQIDNo.1, and the sequence of described downstream primer is for shown in SEQIDNo.2.
Primer is the campylobacter jejuni sequence announced according to GenBank, at a pair Auele Specific Primer of its 16SrRNA gene conserved sequence region design.
Preferably, 2 × NanoPCRMix is made up of archaeal dna polymerase, 2 × NanoPCRbuffer and dNTPMixture.
Preferably, described test kit also comprises positive control.
Wherein, after positive control can be and campylobacter jejuni is inoculated LB substratum, collect 24 ~ 48 hours bacterial cultures.
The invention allows for described test kit whether to detect in testing sample containing the application in the product of campylobacter jejuni in preparation.
Apply described test kit and detect the method whether containing campylobacter jejuni in testing sample, comprise the steps:
1, the extraction of DNA of bacteria
(1) get 300 μ L tissue grinder products, ight soil or enrichment culture medium and be placed in 1.5mL centrifuge tube, add Proteinase K 10 μ L, cell pyrolysis liquid 300 μ L, 50 DEG C hatch 2h after add 600 μ Ltris-balance phenols, the centrifugal 10min of abundant concussion 5min, 12000r/min; (2) supernatant is transferred in new 1.5mL centrifuge tube and adds equal-volume phenol: chloroform: primary isoamyl alcohol (1:24:25), fully the centrifugal 10min of mixing 12000r/min; Get supernatant, add phenol: chloroform: primary isoamyl alcohol repeats extracting once; (3) after extracting, supernatant is transferred in new 1.5mL centrifuge tube, add dehydrated alcohol after 2 times of volume ice baths, 1/10 volume 3mol/L sodium-acetate, the centrifugal 10min of 12000r/min after-20 DEG C of precipitation 45min, abandon supernatant, the dry 5min of vacuum drying oven, with 20 μ L sterile distilled water dissolution precipitations ,-20 DEG C of storages are for subsequent use.
Testing sample can be ight soil, meat, egg, milk etc.Wherein, the pretreated method of testing sample is: after being shredded by testing sample, adds physiological saline and grinds evenly, carry out the extraction of DNA afterwards again according to the mass volume ratio of 1:5.If testing sample is ight soil, cross filter content get filtrate can extracting directly DNA.
2, nano PCR reaction
In reaction tubes, add the downstream primer (SEQIDNo.2) of 10 μ L2 × NanoPCRMix, the above-mentioned DNA solution of 1 μ L, the upstream primer (SEQIDNo.1) of 0.5 μ L10 μM, 0.5 μ L10 μM, finally adding nuclease free water to cumulative volume is 20 μ L.
Undertaken by following response procedures after mixing: 94 DEG C of 3min, 1 circulation; 94 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 15s, totally 30 circulations; 72 DEG C 5min1 circulation.After reaction terminates, check pcr amplification product through 1% agarose gel electrophoresis, if there is the band of 254bp size, testing sample contains campylobacter jejuni.
The invention provides the Auele Specific Primer of a pair detection campylobacter jejuni, the nano PCR test kit utilizing it to make, detection campylobacter jejuni that can be quick, special.The present invention can make PCR reaction reach target temperature quickly, decrease the residence time in non-targeted temperature, and then shorten whole system and reach the temperature equilibrium time used, substantially increase the detection efficiency of campylobacter jejuni, and effectively improve the specific amplification output of campylobacter jejuni, decrease non-specific amplification, there is good application prospect.
Accompanying drawing explanation
Fig. 1 is campylobacter jejuni nano PCR detected result;
M:DL2000Marker; 1: campylobacter jejuni; 2: negative control;
Fig. 2 is campylobacter jejuni nano PCR sensitivity Detection result;
M:DL2000Marker; 1 ~ 6 is followed successively by 10
0~ 10
-5the amplified production of doubling dilution bacterial nucleic acid; 7: negative control.
Fig. 3 is campylobacter jejuni nano PCR specific detection result.
M:DL2000Marker; 1: campylobacter jejuni; 2: intestinal bacteria; 3: Salmonellas; 4: streptococcus aureus; 5: negative control.
Embodiment
With reference to the accompanying drawings and the present invention is described in further detail in conjunction with the embodiments.But the invention is not restricted to given example.The experimental technique used in following embodiment, if no special instructions, is ordinary method.Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Embodiment 1 one kinds detects the nano PCR test kit most preferred embodiment of campylobacter jejuni
The present embodiment test kit comprises: (1) nano PCR reaction reagent: 2 × NanoPCRMix, upstream primer, downstream primer; (2) other: positive control and nuclease free water.Wherein, 2 × NanoPCRMix is made up of archaeal dna polymerase, 2 × NanoPCRbuffer and dNTPMixture, and positive control is after campylobacter jejuni is inoculated LB substratum, and 24 ~ 48 hours results bacterial culturess, primer is lyophilized powder, and HPLC is pure.The primer sequence that the present embodiment test kit comprises is in table 1.
Table 1 primer sequence
| Primer | Sequence (5 '-3 ') |
| Upstream primer (SEQ ID No.1) | AGACACGGTCCAGACTCCTAC |
| Downstream primer (SEQ ID No.2) | AGAGACTTGATAATCCGCCTAC |
Embodiment 2 non-diagnostic object detects the method for campylobacter jejuni with nano PCR method
The present embodiment detection method adopts the test kit in embodiment 1.Get ight soil, meat, egg, milk is testing sample.
The present embodiment detection method comprises the following steps:
1, DNA of bacteria extraction concrete steps are as follows: (1) is got 300 μ L tissue grinder products, ight soil or enrichment culture medium and is placed in 1.5mL centrifuge tube, add Proteinase K 10 μ L, cell pyrolysis liquid 300 μ L, 50 DEG C hatch 2h after add 600 μ Ltris-balance phenols, the centrifugal 10min of abundant concussion 5min, 12000r/min; (2) supernatant is transferred in new 1.5mL centrifuge tube and adds equal-volume phenol: chloroform: primary isoamyl alcohol (1:24:25), fully the centrifugal 10min of mixing 12000r/min; Get supernatant, add phenol: chloroform: primary isoamyl alcohol repeats extracting once; (3) after extracting, supernatant is transferred in new 1.5mL centrifuge tube, add dehydrated alcohol after 2 times of volume ice baths, 1/10 volume 3mol/L sodium-acetate, the centrifugal 10min of 12000r/min after-20 DEG C of precipitation 45min, abandon supernatant, the dry 5min of vacuum drying oven, with 20 μ L sterile distilled water dissolution precipitations ,-20 DEG C of storages are for subsequent use.
2, nano PCR reaction: add 10 μ L2 × NanoPCRMix, the above-mentioned DNA solution of 1 μ L, 0.5 μ L upstream primer (10 μMs), 0.5 μ L downstream primer (10 μMs) respectively in reaction tubes, finally adding nuclease free water to volume is 20 μ L, mixing.
Response procedures is as follows: 94 DEG C of 3min, 1 circulation; 94 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 15s, totally 30 circulations; 72 DEG C 5min1 circulation.
3, electrophoresis detection: after reaction terminates, check pcr amplification product through 1% agarose gel electrophoresis, the stripe size of the positive control amplified production of campylobacter jejuni is 254bp, the results are shown in Figure 1.If there is the band of 254bp size after testing sample electrophoresis detection, containing campylobacter jejuni, otherwise then not containing campylobacter jejuni.
The sensitivity test of embodiment 3 campylobacter jejuni nano PCR detection method
Measured by ultramicrospectrophotometer, getting the campylobacter jejuni STb gene concentration recorded is that the nucleic acid-templated of 39.5ng/ μ L carries out sensitivity test.Adopt nano PCR and regular-PCR method to 10 times of nucleic acid-templated detections of the campylobacter jejuni of diluting simultaneously.
The nano PCR of campylobacter jejuni and regular-PCR operating process are carried out according to embodiment 2, wherein, common PCR reaction changes 2 × NanoPCRMix in step 3 into 2 × PCR reaction solution, it is composed as follows: archaeal dna polymerase, 2 × PCRbuffer, dNTPMixture, and all the other operating process remain unchanged.
Detect pcr amplification product with 1% agarose gel electrophoresis, result as shown in Figure 2.Visible, the most low energy of regular-PCR detects that 0.395ng/ μ L campylobacter jejuni is nucleic acid-templated, and the most low energy of nano PCR detects that 3.95pg/ μ L campylobacter jejuni is nucleic acid-templated.Nano PCR reaction is 100 times of common PCR reaction susceptibility.
The specific test of embodiment 4 campylobacter jejuni nano PCR detection method
According to the method for embodiment 2, respectively to the canonical reference strain of campylobacter jejuni, intestinal bacteria, Salmonellas and streptococcus aureus, and the negative control of sterilizing ultrapure water carries out nano PCR reaction, detects the specificity of nano PCR method.Above amplified production is all analyzed with the agarose gel electrophoresis of 1%.
As shown in Figure 3, campylobacter jejuni nucleic acid amplification has gone out the band of the 254bp conformed to expection size to result, and negative control and other 3 kinds of bacterial nucleic acids all do not amplify any band.The above results shows nano PCR detection method energy specific amplification campylobacter jejuni nucleic acid of the present invention, and not with other bacterial nucleic acid generation cross reaction, nano PCR detection method of the present invention has good specificity.
The present invention can make PCR reaction reach target temperature quickly, decrease the residence time in non-targeted temperature, and then shorten whole system and reach the temperature equilibrium time used, substantially increase the detection efficiency of campylobacter jejuni, and effectively improve the specific amplification output of campylobacter jejuni, have and detect the advantage quick, specificity is high.
Claims (4)
1., for the nano PCR test kit that campylobacter jejuni detects, described test kit comprises 2 × NanoPCRMix, upstream primer and downstream primer; The sequence of described upstream primer is for shown in SEQIDNo.1, and the sequence of described downstream primer is for shown in SEQIDNo.2.
2. the nano PCR test kit detected for campylobacter jejuni according to claim 1, is characterized in that described 2 × NanoPCRMix is made up of archaeal dna polymerase, 2 × NanoPCRbuffer and dNTPMixture.
3. the nano PCR test kit detected for campylobacter jejuni according to claim 1, is characterized in that described test kit also comprises positive control.
4. whether the test kit as described in any one of claims 1 to 3 detects in testing sample containing the application in the product of campylobacter jejuni in preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510515059.9A CN105039566A (en) | 2015-08-21 | 2015-08-21 | Nano PCR (polymerase chain reaction) campylobacter jejuni detection kit and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510515059.9A CN105039566A (en) | 2015-08-21 | 2015-08-21 | Nano PCR (polymerase chain reaction) campylobacter jejuni detection kit and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105039566A true CN105039566A (en) | 2015-11-11 |
Family
ID=54446532
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510515059.9A Pending CN105039566A (en) | 2015-08-21 | 2015-08-21 | Nano PCR (polymerase chain reaction) campylobacter jejuni detection kit and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039566A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112080571A (en) * | 2020-09-22 | 2020-12-15 | 扬州大学 | Campylobacter jejuni detection kit and method based on CRISPR-Cas12b system |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103224995A (en) * | 2013-04-10 | 2013-07-31 | 中国农业科学院哈尔滨兽医研究所 | Nanometer PCR detection kit for rapidly identifying and diagnosing virulent virus and attenuated virus of porcine pseudorabies virus, and applications thereof |
-
2015
- 2015-08-21 CN CN201510515059.9A patent/CN105039566A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103224995A (en) * | 2013-04-10 | 2013-07-31 | 中国农业科学院哈尔滨兽医研究所 | Nanometer PCR detection kit for rapidly identifying and diagnosing virulent virus and attenuated virus of porcine pseudorabies virus, and applications thereof |
Non-Patent Citations (2)
| Title |
|---|
| 刘清岱等: "纳米粒子PCR研究进展", 《生物学通报》 * |
| 王振国等: "应用pcr技术检测空肠弯曲菌及结肠弯曲菌的研究", 《中国家禽学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112080571A (en) * | 2020-09-22 | 2020-12-15 | 扬州大学 | Campylobacter jejuni detection kit and method based on CRISPR-Cas12b system |
| CN112080571B (en) * | 2020-09-22 | 2022-11-11 | 扬州大学 | Campylobacter jejuni detection kit and method based on CRISPR-Cas12b system |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ye et al. | Application of in situ loop-mediated isothermal amplification method for detection of Salmonella in foods | |
| CN105483292A (en) | FAdV-4 PCR detection kit and detection method | |
| Du et al. | Effective pre-treatment technique based on immune-magnetic separation for rapid detection of trace levels of Salmonella in milk | |
| Wei et al. | Development and application of a multiplex PCR assay for rapid detection of 4 major bacterial pathogens in ducks | |
| CN105039578A (en) | Method for measuring intestinal tract setting capacity of lactobacillus | |
| CN105018485A (en) | Primer and probe for detecting peste des petits ruminants virus by virtue of RPA (Recombinase Polymerase Amplification) technique | |
| CN104195266A (en) | Quadruple fluorogenic quantitative PCR kit for detecting three pathogens of infantile pneumonia | |
| CN111635950A (en) | Kit and method for rapidly detecting bordetella pertussis | |
| CN104263845B (en) | A kind of triple PCR method simultaneously detecting mycoplasma hyopneumoniae, pig pasteurella multocida and haemophilus parasuis | |
| Gao et al. | Antibacterial and probiotic promotion potential of a new soluble soybean polysaccharide‑iron (III) complex | |
| CN102373302B (en) | Primer, kit and detection method for quickly detecting capripoxvirus virus by adopting isothermal amplification technology | |
| CN104328175A (en) | Loop-mediated isothermal amplification (LAMP) primers, kit and method for detecting mouse Klebsiella pneumoniae | |
| CN105039566A (en) | Nano PCR (polymerase chain reaction) campylobacter jejuni detection kit and detection method | |
| CN111394483B (en) | Kit and detection method for simultaneously detecting three fish-source streptococci | |
| CN102628042B (en) | Specific ribonucleotide of legionella pneumophilia O9 wzm gene and application thereof | |
| CN104004842A (en) | Multiplex PCR primer set and detection method for simultaneously detecting three pathogenic bacteria causing sepsis of aquatic animals | |
| CN104278098A (en) | Kit and method for fast detecting enterohemorrhagic escherichia coli 0157:H7 | |
| CN103305613B (en) | Giant salamander pathogenic hydrophila gingivalis PCR diagnostic kit | |
| CN103436623A (en) | Rapid detection kit for viable salmonella in food and use method thereof | |
| CN104164467B (en) | Method for extracting antibacterial peptide from chicken blood | |
| CN103627811B (en) | Kit for rapidly detecting salmonella in meat and application thereof | |
| CN104946782A (en) | Dual Tem-PCR quick detection method for salmonella and escherichia coli O78 | |
| CN109811073A (en) | Double PCR early stage quickly detects primer and its application of Streptococcusagalactiae and Streptococcus iniae | |
| CN102304585A (en) | Immunocapture PCR (polymerase chain reaction) detection kit of staphylococcus aureus and using method of kit | |
| CN104593516A (en) | Isothermal amplification method for rapid detection of listeria monocytogenes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151111 |
|
| RJ01 | Rejection of invention patent application after publication |